h6OUhUP
49
very slow walk
slow trot-like walk
slow rack-like walk
normal walk
slow trot
slow canter
3.5
Fig.7. Scattergram showing correlation between the gait cycle and the rhythm of limb
work.
200
180
160
140
e
120 Jackal
Hindlimb length ratio to the trunk (%)
100
80
Carnivora
Asiatic elephant
@ 132
A 132
1.5
Gait cycle (sec)
2D
Very slow walk
Slow trot-like walk
Slow rack-like walk
Normal walk
Slow trot
Slow canter
3.5
Fig. 8. Scattergram showing correlation between the gait cycle and the hindlimb length ratio
to the trunk. Numerals show the shoulder heights in cm and M3 refers to age using the last
molar.
50 Mammal Study 21: 1996
70
@
60
Lateral
e
© ® Elbow joint
> @ Wrist joint
Se A Knee joint
@ Ankle joint
@
D
S
©
(2
oO
ic
Forelimb
support phase
Ser) ras TS
sasllin support Phecee
Gait cycle (sec)
Fig.10. Joint angles of the sub-unguligrade Asiatic elephant. Time, from the footfall of the
hindlimb, is shown on the X-axis, and the flexion angle, from the position of extension, on the
Y-axis. In the ankle joint, dorsiflexion is indicated with + and plantarflexion with—.
” Giraffe (unguligrade)
60
22)
®
© 50 e oe f
S wlhe 2
es .
DO) 30 @
©
—
g ‘ j @ Elbow joint
v1 @ Wrist joint
: A Knee joint
@ Ankle joint
Forelimb Supe er pase
c Ee
-20
Fig.11. Joint angles of the unguligrade giraffe. Time, from the footfall of the hindlimb, is
shown on the X-axis, and the flexion angle, from the position of extension, on the Y-axis. In
the ankle joint, dorsiflexion is indicated with + and plantarflexion with—.
52, Mammal Study 21: 1996
100 Bias:
Cheetah (digitigrade)
@ Elbow joint
@ Wrist joint
a \ A Knee joint
D x @ Ankle joint
®
o)
_
D 60
®
&
o)
ro 40
(S
©
= * ;
© Forelimb support phase
Gait cycle (sec)
-40
Fig.12. Joint angles of the digitigrade cheetah. Time, from the footfall of the hindlimb, is
shown on the X-axis, and the flexion angle, from the position of extension, on the Y-axis. In
the ankle joint, dorsiflexion is indicated with + and plantarflexion with—.
a Polar bear (plantigrade)
100
@ 80 ~ ’
2 <
D
a 60
S
® 40
oD
S
© 20
£ |
oO : Forelimb support phase ;
=) § (je mello
__ _Hindlimb support phase 1 ;
-20 - /
®
-40 :
@ Elbow joint e ». fe
60 @ Wrist joint a baa sf
A Knee joint - ae) ee po a ‘e 4 .
a @ Ankle joint Se
Gait cycle (sec)
Fig. 13. Joint angles of the plantigrade Polar bear. Time, from the footfall of the hindlimb,
is shown on the X-axis, and the flexion angle, from the position of extension, on the Y-axis.
In the ankle joint, dorsiflexion is indicated with + and plantarflexion with—.
Inuzuka, Gait analysis in mammals 5S}
4. Comparison of Joint Flexion Angles
In all species examined, except for the Asiatic elephant, the elbow joint is
flexed even during the support phase, and flexes even further during the free
transit phase (Fig. 14). The wrist joint is mostly extended during the support
phase, except in the plantigrade Polar bear where it is in dorsiflexion. It
flexes further in the free transit phase in all species studied, with the greatest
variation observed in the elephant and the bear. The change in angle, between
the maximum and minimum, for the wrist, is the largest among the four joints
(Fig. 15). During the support phase the knee joint is extended in the elephant
and the bear, whereas it is flexed in the giraffe and the cheetah. It flexes
further in the free transit phase in all species and this motion is most distinctive
in the bear. The change in angle, between the maximum and minimum, for the
knee, is the smallest among all joints (Fig. 16). The angle of the ankle joint
varies little on the whole, though each species is clearly distinct as a result of
differences in foot posture. The ankle flexes just before the foot is raised and
this motion is most distinctive in the bear (Fig. 17).
Comparing the flexion angles of joints during the support phase between
species, the orders for the elbow and ankle joints are the same, and as follows:
sub-unguligrade < unguligrade < digitigrade < plantigrade. The order for
the wrist joint is the exact reverse. The order for the knee is the same as the
wrist except in the Asiatic elephant.
90
Elbow joint
80
70
60 Cheetah _ Giraffe
50
Polar bear
40
30 m= Asiatic elephant
Flexion angle (degrees)
\ support phase free transit phase
(sec)
-10
Fig. 14. Change of angles in the elbow joint. Time from the footfall of both limbs is shown
on the X-axis, and the moment when the foot is raised, is shown by arrows.
D4 Mammal Study 21: 1996
3 80
oO L a L
8 Wrist joint
< 60
2
x<
® 4 (
© Asiatic
a elephant
Ps support phase , Cheetah _ free transit phase
0
Mare Stee 2 (sec)
S
oO 2 Polar bear
x<
£2
5S LO
y)
—
O
QO -60
-80
Fig. 15. Change of angles in the wrist joint. Time from the footfall of both limbs is shown
on the X-axis, and the moment when the foot is raised, is shown by arrows.
80
a a
Knee joint
70 ¥ . aa
.)) %
. Giraffe
x
~
GS ey
a”
Asiatic elephant
Flexion angle
Polar bear
2 (sec)
free transit phase
Fig. 16. Change of angles in the knee joint. Time from the footfall of both limbs is shown
on the X-axis, and the moment when the foot is raised, is shown by arrows.
20
Inuzuka, Gait analysis in mammals
—
—
oO
Ankle joint
(Ce)
Oo
Polar bear
/ Cheetah
~
(2)
C54]
(o>)
Sgn,
SS Quang
€ SEI Wag,
SK
Giraffe
ie)
(o)
Sak
Dorsiflexion angle (degrees)
Asiatic elephant
: 2
free transit phase a
support phase
Fig. 17. Change of angles in the ankle joint. Time from the footfall of both limbs is shown
on the X-axis, and the moment when the foot is raised, is shown by arrows.
DISCUSSION
Usually, primates walk using the lateral sequence, making then different
from other mammals. However, primates have been observed walking down-
hill in a diagonal sequence supporting Iwamoto and Tomita’s (1966) theory that
gait type is related to the center of gravity, because the forelimbs support more
weight than usual on a downward slope.
A diagram of correlation between the rhythm of limb work and the rhythm
of locomotion corresponds to a diagram (Fig. 18) by Hildebrand (1976).
Common features shared by the Asiatic elephant, giraffe, cheetah and
Polar bear are that the wrist joints vary most markedly during a cycle, show
marked flexion during the free transit phase, and also that the moment of
maximum flexion is earlier in the wrist than in the elbow in the forelimb, and
earlier in the knee than in the ankle in the hindlimb.
Comparison of flexion angles of joints during the support phase, indicates
that: foot posture is closely related to the angles of limb joints; the elbow is
analogous to the ankle and the wrist to the knee, and that the sub-unguligrade
posture of the elephant is unique.
The other results from the comparison of joint angles may be summarized
as follows: The knee joint is not so synchronized with the ankle as is the elbow
with the wrist. The wrist joint is analogous to the knee joint in the degree,
direction and timing of flexion. This is another analogy of fore- and hind-
limbs differing from the analogy of the forearm and foot, which explains the
56 Mammal Study 21: 1996
WALK | RUN
Se
Tr) Pace
® Ww
= O
© it
” =)
20
5 g
= n
=
& <
a :
g 40 5
fe)
2 Trot
£ im
once O
ro Zz
— LU
=)
® 6)
: 2
= 2
@W 80 Zz
S 5
® <
Oo Q
D>
O Pace
‘© 00
oS
% of cycle that each foot is on the ground
Fig. 18. A diagram showing the rhythm of limb work and the rhythm of locomotion after
Hildebrand (1976).
position of the elbow and knee which appears with the emergence of the
mammals.
Extrapolating from these results, one of the possible gaits of the desmos-
tylian is a very slow diagonal walk using a diagonal sequence. Estimation of
locomotion velocity, maximum velocity and gait are subjects for future study.
Acknowledgements : | am much indebted to B. Endo, K. Adachi, S. Nishizawa
and N. Yaguramaki, of the Department of Anthropology, Faculty of Science,
University of Tokyo, for their considerable assistance with the videotape
analyses. I am also grateful to M.Okada of the Department of Applied
Anatomy, Tsukuba University for providing valuable references, and wish to
thank S. Nemoto, K. Sotani and Y. Kawaguchi for collecting the samples. The
study was partly supported by a Grant-in-Aid for Scientific Research in 1993
-1995 from the Ministry of Education, Science and Culture, Japan (No.
05804024).
REFERENCES
Gambaryan, P. P. 1974. How Mammals Run. John Wiley, New York, 367 pp.
Hildebrand, M. 1976. Analysis of tetrapod gait : general consideration and symmetrical gaits. Jn (R.
H. Herman ef al., eds.). Neural Control of Locomotion pp. 203—236. Plenum Press, New
Inuzuka, Gait analysis in mammals Dil
York.
Inuzuka, N. 1984. Skeletal restoration of the desmostylians: herpetiform mammals. Mem. Fac. Sci.,
Kyoto Univ. Ser. Biol. 9 : 157—253.
Iwamoto, M. and M. Tomita. 1966. On the movement order of four limbs while walking, and the
body weight distribution to fore and hind limbs while standing on all fours in monkeys. J.
Anthrop. Soc. Nippon 74 : 228—231.
Sukhanov, V. B. 1974. General System of Symmetrical Locomotion of Terrestrial Vertebrates and
Some Features of Movement of Lower Tetrapods. Amerind, New Delhi, 274pp.
(accepted 17 May 1996)
Mammal Study 21: 59-63 (1996)
© the Mammalogical Society of Japan
Short Communication
Spatial segregation between the Japanese field vole
Microtus montebelli and the Japanese wood mouse
Apodemus speciosus on the Naka River flood plain,
northern Kanto
Kohtaro URAYAMA*
Department of Biology, Faculty of Science, Ibaraki University, Mito 310, Japan
The Japanese field vole Microtus montebelli and the Japanese wood mouse
Apodemus speciosus often occur sympatrically in Honshu and Kyushu, Japan,
whereas only A. speciosus occurs in Shikoku and Hokkaido. These two
species differ in several ecological features. For example, MM. montebelli
inhabits grasslands, including flood plains, and eats mainly grass leaves, stems
and roots, while A. speciosus occurs in a wide range of habitats from woodlands
and secondary forests to grasslands, and eats nuts, berries, seedlings and insects
(Tatsukawa and Murakami 1976). Despite these differences, the two species
often occur together in cultivated fields (Kaneko 1973, 1979) and flood plains
(Kaneko 1979, Saito et al. 1980, Sasaki et al. 1989). Kaneko (1979) investigated
the habitat preferences of the two species using snap-traps in western Honshu,
and suggested that A. speciosus was subordinate in habitats where VM. montebel-
li predominated.
In this study the spatial distribution of M. montebelli and A. speciosus
sympatrically inhabiting a flood plain with heterogeneous vegetations is
examined and the interspecific interactions between the two rodent species are
briefly discussed.
STUDY AREA AND METHODS
The field study was conducted along the Naka River flood plain, at Mito
(36°25’ N, 140°26’ E), central Japan. The vegetation of the study area was
heterogeneous dominated by the perennial reed Phragmites communis and the
perennial forb Solidago altissima with sparse patches of shorter grasses and
forbs (Fig. 1).
A total of 64 trapping stations, spaced at seven meter intervals, were set on
the flood plain to form an approximately 0.25 ha (49 m X 49 m) open grid (Fig.
1). A single Sherman-type live-trap was placed at each trap station. Traps
baited with sunflower seeds and were set at about 17:00 hrs and checked the
*Present address: Laboratory of Ethology, Department of Veterinary Medicine, Faculty of
Agriculture, Tokyo University of Agriculture and Technology, Fuchu 183, Japan
60 Mammal Study 21: 1996
Pe (3) & Sa Q) Sa (5)
Pe (1) & Sa (4)
BON OS REOPEN ai ie Ge eke
+———+
7m
Fig. 1. Distribution and quantity of the two dominant plants, Phragmites communis (Pc) and
Solidago altissima (Sa), in the study area along the Naka River. Numerals in parentheses
indicate the coverage class of these two species (0: <1%, 1: 1-10%, 2 : 10-25%, 3: 25-50%, 4:
50S (a0, D2 (a= l00%6):
following morning at about 08:00. Trapping took place 13 times during the
period from 6 June to 18 July 1991. All individual MM. montebelli and A.
speciosus caught were sexed, weighed (to the nearest 0.5 g with a spring balance)
and marked individually by toe-clipping. The trap location was also noted.
Trappings were repeated every two or three days during the research period.
Microhabitat segregation between M. montebelli and A. speciosus was
examined using multiple regression analysis based on the total number of
captures at each trap station for M. montebelli (variable X,) and for A.
speciosus (variable X,) and the coverage class (0: <1%, 1: 1-10%, 2: 10-25%, 3:
25-50%, 4:50-75%, 5: 75-100%) of two dominant plants, Solidago altissima
(variable X;) and Phragmites communis (variable X.). In the analysis for /.
montebelli the criterion variable was X, and the explanatory variables were Xz,
X; and X,, and for A. speciosus the criterion variable was X, and the explana-
tory variables were X,, X3 and X4.
Urayama, Spatial segregation of voles and mice 61
RESULTS AND DISCUSSION
A total of 318 captures of 78 individuals were made during the study, of
which 261 captures (82.1%) of 63 individuals were of M. montebelli and 56
captures (17.6%) of 14 individuals were of A. speciosus. The only other small
mammal captured was a single (0.3%) Japanese white-toothed shrew (Crocidur-
a dsinezumt). Population densities, estimated using the Jolly-Seber method,
for both species from 6 June to 18 July showed little fluctuation, with mean
densities of 126.2+8.1 (SD)/ha for M. montebelli and 24.2+5.7/ha for A.
speciosus. Kanamori and Tanaka (1968) suggested that the typical population
density of M. montebelli was 50 /ha, while the maximum density so far reported
was 1120 /ha on the flood plain of the Tone River (Kitahara 1980). The density
of the Naka River flood plain population is known to have been 171 /ha in the
autumn of 1990 (Inada, pers. comm.). The population density of A. speciosus is
generally fairly constant within a range of 10-50 /ha (e.g., Murakami 1974, Doi
and Iwamoto 1982). In the present study, the population density of WM.
montebelli was somewhat higher than the typical level, while that of A.
speciosus was relatively low, indicating that W/. montebelli was the predominant
species in this area.
The mean lengths of home ranges (based on the minimum polygon method)
of individuals caught more than four times during the research period were
16.145.4 (SD) m for M. montebelli and 26.6+8.8 m for A. speciosus. The facts
that the mean range lengths for both MW. montebelli and A. speciosus were longer
than the distances between neighboring traps (7 m), and that the home ranges
of most animals included several trap stations, suggest that multi-collisions of
animals at each trap station was not so frequent as to greatly affect the
observed number of captures.
Captures of A. speciosus were concentrated along southern and eastern
edges of the grid, whereas WM. montebelli was less frequently captured there
than in other parts of the area (Fig. 2). The number of M. montebelli captured
at each station was negatively correlated with that of A. speciosus (vy =0.496,
n=64, p<0.001). Multiple regression analysis showed that the most important
variable determining the spatial distribution of WM. montebelli was the presence
of S. altissima (X;), while the most important variable affecting A. specizosus was
the distribution of MM. montebelli (X,)(Table 1). These results support
Kaneko’s (1979) conclusion that A. speciosus hardly intrudes into microhabitats
where M. montebelli is predominant. The present results also support Kaneko’
s (1982) supposition that M. montebelli is the dominant rodent in Tohoku, Kanto
and Chubu districts, while it is subordinate from Kansai to Kyushu districts.
62 Mammal Study 21: 1996
(a) M. montebelli N=261 (b) A. speciosus N=56
= INS OY CN SS) C9
MPN wWw BH A NX Oo
A -B-C Di EE eiGeer
1 2.3 4 '5. 6 7 3 eeomnG
Fig. 2. Total number of captures at each trap station for (a) Microtus montebelli and (b)
Apodemus speciosus between 6 June and 18 July 1991. Circle sizes indicate the number of voles
and mice captured.
Acknowledgments : | thank Dr. J. Kojima for his valued comments on an earlier
draft of the manuscript, and Dr. H. Tamura, Dr. H. Morino and Mr. T. Inada for
their helpful suggestions throughout the study. I am also grateful to anony-
mous reviewers for valuable comments on the manuscript.
Table 1. Results of the multiple regression analysis on the spatial distribution of Microtus
montebelli and Apodemus speciosus at each trap station of the study grid. Variables X,, X2, X;
and X, are the number of MM. montebelli and of A. speciosus captured and the degree of
coverage of Solidago altissima and of Phragmites communis, respectively.
Criterion Explanatory Regression Standerd ple ae Za Propeller
variable variable coefficient error
M. montebelli xe -().596 0-200 2.878 60 0.006
(X,) xe =i085 0.314 3 aS 60 0.001
X4 -0.569 0.296 G22 60 0.059
A. speciosus xe -0.204 0.071 2.878 60 0.006
(X;) X3 0.229 0.199 1.150 60 ORZ55
X, 0.156 OPM 0.877 60 0.384
Urayama, Spatial segregation of voles and mice 63
REFERENCES
Doi, T. and T. Iwamoto. 1982. Local distribution of two species of Apodemus in Kyushu. Res.
RopulsEcoleZ4= 1022:
Kanamori, M. and R. Tanaka. 1968. Studies on population ecology of the vole, Microtus montebelli,
in mountain grasslands of Sugadaira and its adjacent areas. I. Results of research on five
populations in 1966-1967. Bull. Sugadaira Biol. Lab. Tokyo Kyoiku Univ. 2:17—39 (In
Japanese with English summary).
Kaneko, Y. 1973. Geographically small scale distribution of Japanese meadow mice, Microtus
montebelli. Distribution pattern of small rodents in the alluvial area of Kyoto City. Mem.
Fuc. Educ., Kagawa Univ. II (224): 1—13 (In Japanese with English abstract).
Kaneko, Y. 1979. Habitat preference of Apodemus speciosus and Microtus montebelli in lowland
habitats in western Honshu and northern Shikoku, Japan. J. Mammal. Soc. Japan 7 : 254—
260.
Kaneko, Y. 1982. An approach to distribution studies in Japanese small field rodents. Honyurui
Kagaku (Mammalian Science) 43°44: 145—160 (In Japanese with English summary).
Kitahara, E. 1980. Notes on ecological respects of high dense Microtus population. J. Mammal.
Soc. Japan 8: 144—147 (In Japanese with English abstract).
Murakami, O. 1974. Growth and development of the Japanese wood mouse (Apodemus speciosus). I.
The breeding season in the field. Jpn. J. Ecol. 24:194—206 (In Japanese with English synop-
Sis).
Saito, T., K. Machida, S. Inoue and M. Takahashi. 1980. Reproductive activity of Microtus montebel-
li at Okegawa City in Saitama Prefecture. J. Mammal. Soc. Japan 8: 122—128 (In Japanese
with English abstract).
Sasaki, M., T. Saito and M. Takahashi. 1989. Small mammal fauna of Okegawa City in Saitama
Prefecture. Bull. Saitama Mus. Nat. Hist. 7:25—32 (In Japanese with English abstract).
Tatsukawa, K. and O. Murakami. 1976. On the food utilization of the Japanese wood mouse,
Apodemus speciosus (Mammalia: Muridae). Physiol. Ecol. Japan 17:133—144 (In Japanese
with English synopsis).
(accepted 3 March 1996)
Ee
“Hiei, ee % <
relive ini el alae "2
oki alagos a
— nck Sli
ae
c j Ki ri
x ae hy sta each Sc bonne eet oti m sepern
i re 1 day -- fe rset fit VO: a sowie ® sa — ney
=< =
Mammal Study 21: 65-69 (1996)
© the Mammalogical Society of Japan
Short Communication
Longevity of captive shrews in Hokkaido
Satoshi OHDACHI*
Institute of Low Temperature Science, Hokkaido University, Kita-ku, Sapporo O60, Japan
Fax. 011-706-7142, E-mail. ohdachi @ bio. hokudai. ac. jp
Information concerning the longevity of animals is invaluable for various
biological studies. The longevity of some shrew species (Soricidae) has been
reported both from the wild and in captivity (Churchfield 1990). Churchfield
(1990) also showed that captive shrews tended to live longer than those in the
wild in general, because of the preferential conditions in the laboratory. For
a shrew species of Hokkaido, Inoue (1990) reported a maximum estimated life
span of 511 days for Sovex unguiculatus in the field. For S. unguiculatus in
captivity, Yokohata (1989) reported a maximum keeping period of 493 days and
estimated that the oldest might live for 710-830 days. However, longevity for
Sorex caecutiens and S. gracillimus, other common soricine species in Hokkaido,
is little known. In the present study, all the three species were kept in the
laboratory, slightly modifying Yokohata’s (1989) rearing method. The purpose
of the present study is to report the longevity of captive Sorex caecutiens and S.
gracillimus along with that of S. unguiculatus.
MATERIALS AND METHODS
1. Animals examined
Shrews were collected in June 1992 and 1993 from Tomakomai (Yufutsu
moor), and in June 1992 and August 1993 from Horonobe near the Teshio
Experimental Forest of Hokkaido University. The methods of capturing
shrews were essentially the same as those described by Ohdachi (1992). Seven-
teen S. caecutiens, 22 S. gracillimus, and 28 S. unguiculatus were used for analy-
SIS.
The animals examined for the present report were originally used for
behavioral laboratory experiments (Ohdachi 1994, 1995a, b). During the exper-
iments, laboratory conditions were maintained at either 16L8D, 20°C or 10L14D,
9-15°C. After the experiments, the animals were kept in order to record their
longevity, but photoperiodic cycle was no longer controlled. Mixed paste diets
of pork meat, pork liver, canned tuna, dog food and rabbit pellets were supplied
every day. In addition to the mixed pastes, living mealworms (Tenebrio sp.),
living earthworms and frozen silkworm pupae (Bombyx mori) were given
occasionally. The supplementary natural foods seemed to contribute to the
*Research Fellow of the Japan Society for the Promotion of Science
66 Mammal Study 21: 1996
greater longevity of these captive shrews. Animals that were sexually im-
mature when captured experienced neither copulation, pregnancy, nor parturi-
tion during their lives. The most significant difference between Yokohata’s
(1989) rearing methods and those in the present study was that I always kept
cages clean while Yokohata did not. See Ohdachi (1994) for more detailed
methods.
2. Estimation of Longevity
Two methods for estimating longevity were used depending on the age of
the shrews when captured ; the first is for young of the year, and the second for
individuals that have overwintered. Ages at capture were assessed on the
basis of wear to hair and body weight (Abe 1958, Ohdachi and Maekawa 1990).
The young shrews that were caught were all considered to be fully indepen-
dent from their mothers. Inoue (1990), who reviewed the literature concerning
lactation periods (~the period from birth to independence) of six soricine
species (Sovex cinereus, S. vagrans, S. araneus, Cryptotis parva, Neomys fodiens
and Blarina brevicauda), concluded that the lactation periods ranged from 16 to
30 days. Inoue (1990) also estimated that the lactation period of S. un-
guiculatus in the field averaged 27.6 days. Churchfield (1990) considered that
the period from birth to complete independence in S. avaneus lasted 25 days. In
the light of these studies, it is assumed that for the three soricine species in
Hokkaido, the period from birth to independence averages 25 days. Therefore,
in order to estimate the life span of the individuals that were captured as
youngsters, 25 days were added to their survival periods in the laboratory, thus,
giving a minimum estimate of longevity, as 25 days is the estimated minimum
age of the young animals captured from the wild.
Most soricine species bear young from spring to autumn (mostly in spring)
and new-born individuals, usually, do not become sexually mature until the
following spring (e.g., Crowcroft 1957, Churchfield 1990). In S. unguiculatus of
central Hokkaido, most females bear offspring between April and September
(Inoue 1990). Pregnant female S. caecutiens and S. gracillimus were recorded
no later than in late September, although some females are known to survive
until November (Ohdachi unpublished data). It is assumed, therefore, that the
last possible birth date of shrews in Hokkaido is October Ist. Thus, in order
to estimate the age of shrews that were captured after they had overwintered
(z.e., sexually mature individual), the period from October lst of the previous
calendar year to the date of capture was added to the period survived in the
laboratory. Again, this method of estimation provides only a minimum life
Span, since the estimated period survived in the wild is also a minimum.
RESULTS AND DISCUSSION
Most wild-captured shrews were successfully introduced into the labora-
tory, although several died during transportation. Two out of 17 S. caecutiens,
2 out of 22 S. gracillimus, and 4 out of 28 S. unguiculatus which were success-
Ohdachi, Longevity of shrews 67
fully introduced to the laboratory died within the first week. Most S.
caecutiens and S. unguiculatus which survived the first week in the laboratory
survived for more than 100 days. In contrast, 13 out of the 20 surviving S.
gracillimus died within 100 days (mean = 52.4 days). In most cases, animals
died suddenly without apparent symptoms, and the cause of death were un-
known.
The maximum estimated life span for S. caecutiens was 609 days, for S.
gracillimus 419 days and for S. unguiculatus 946 days (Fig. 1). The maximum
life span for S. caecutiens would, in fact, have been longer, had it not died as a
result of its water supply failing. The maximum of 946 days for S. un-
guiculatus reported here is one of the longest life span records among the
Soricinae (Churchfield 1990).
Churchfield (1990) pointed out that larger shrew species tended to live
longer than smaller species, which seems to be related to activity and basal
metabolic rates. S. unguiculatus is the largest species and S. gracillimus the
smallest among the three species in Hokkaido, and in the present study S.
gracillimus tended to live shorter lives than the other two species (Fig. 1). It
seems, therefore, that interspecific differences in the maximum estimated life
spans of Hokkaido shrews seems to be related to body size, as pointed out by
Churchfield (1990).
Acknowledgments : Students at the Institute of Low Temperature Science and
the Laboratory of Applied Zoology, Faculty of Agriculture, Hokkaido Univer-
sity, especially Y. Yamaga and K. Nishimura, kindly assisted me in taking care
of the shrews. T.Segawa and H. Ishii, and other technicians of the Institute
made devices for keeping the shrews. Dr. K. Sasa, Dr. K. Ishigaki, T. Shida, A.
Nishihara, and H. Takemoto supported my field work, and Dr. Y. Yokohata
made useful suggestions for keeping shrews. I express my deep gratitude to all
of them.
68 Mammal Study 21: 1996
S. caecutiens
| a rere eee | C10
Ege || Bi di!
2j,t di?
ad.? 2j,t
st 609 days !
3a,h ] st !
419 days
Mi life span in laboratory
[_] minimum period in the field |
3a,h
29 3a,h
3a,h
open AA
2j,t
2j,t
2j,h
f) 2a,h |
2a,h
3a,h
3a,h
3a,h
2j,t
2j,h
2a,h
2a,h
o& | 3ah
3a,h
3a,h
3a,h
3a,h
' 946 days
St
J :di (euthanasia by ether)
0 200 400 600 800 1000
days
Fig.1. The estimated longevity of three species of Sovex in captivity in Hokkaido. Black
bars indicate the actual period shrews survived in the laboratory, and white bars indicate the
estimated minimum duration in the field (see text for calculation). Young animals surviving
fewer than 100 days in the laboratory were omitted from the figure. Letters to the left of the
bars indicate dates of capture and localities (“2j, t” = June 1992 in Tomakomai, “2j, h” =
June 1992 in Horonobe, “2a, h” = August 1992 in Horonobe, and “3a, h” = August 1993 in
Horonobe). Letters to the right of the bars record the causes of death (ac = accidental kill,
di = disease, st = starvation or a lack of water, in = injured, and no letter = unknown).
Double sex symbols denote sexually mature animals when captured, and single ones immature
animals (ad.? = sex-unknown but mature individual).
Ohdachi, Longevity of shrews 69
REFERENCES
Abe, H. 1958. Individual and age variation in two species of genus Sovex, Insectivora in Hokkaido.
Mem. Facul. Agr., Hokkaido Univ. 3: 201—209.
Churchfield, S. 1990. The Natural History of Shrews. A & C Black Ltd., London, 178 pp.
Crowcroft, P. 1957. The Life of the Shrew. Max Reinhardt, London, 166 pp.
Inoue, T. 1990. Study of Social Structure and Life History of Sovex unguiculatus Dobson. A Special
Reference to Sexual Variation in Dispersal of the Young. Ph. D. dissertation at the Graduate
School of Agriculture, Hokkaido University, Sapporo, 134 pp. (In Japanese).
Ohdachi, S. 1992. Home ranges of sympatric soricine shrews in Hokkaido, Japan. Acta Theriol.
Sf 3 QUO
Ohdachi, S. 1994. Total activity rhythms of three soricine species in Hokkaido. J. Mammal. Soc.
Japan 19: 89—99.
Ohdachi, S. 1995a. Burrowing habits and earthworm preferences of three species of Sovex in
Hokkaido. J. Mammal. Soc. Japan 20: 85—88.
Ohdachi, S. 1995b. Comparative Ecology and Ethology of Sympatric Soricine Shrews in Hokkaido:
A Special Reference to Their Interspecific Interactions. Ph. D. dissertation at the Graduate
School of Science, Hokkaido University, Sapporo, 116 pp.
Ohdachi, S. and K. Maekawa. 1990. Relative age, body weight, and reproductive condition in three
species of Sovex (Soricidae ; Mammalia) in Hokkaido. Res. Bull. Coll. Exp. For., Facul. Agr.,
Hokkaido Univ. 47 : 535—546.
Yokohata, Y. 1989. Rearing of big-clawed shrew, Sovex unguiculatus. Honyurui Kagaku [Mam-
malian Science] 29: 23—28 (In Japanese with English summary).
(accepted 14 June 1996)
Reviewers of the Journal of the Mammalogical Society
of Japan, Volumes 18-20
The Editorial Board thanks the following persons for reviewing manu-
scripts.
Hisashi Abe
Motokazu Ando
Shusei Arai
Minoru Asahi
John M. Bedford
Katsuhiro Fukuda
Nobuo Goto
Masashi Harada
Noriko Hayashi
Hirofumi Hirakawa
Akira Hirotani
Shin-Ichi Horino
Tetsuji Hosoda
Hiroshi Ikeda
Yoshiharu Imaizumi
Tadayuki Inoue
Nobuo Ishii
Shis-ichi Iwasaki
Masako Izawa
Koichi Kaji
Noriyuki Kaneko
Nobuo Kanzaki
Mieko Kawamichi
Takeo Kawamichi
Yoshinari Kawamura
Eiji Kitahara
Ryousuke Kishimoto
Yuko Koike
Ryo Kusunose
Tsutomu Mano
Shingo Miura
Tetsuo Morita
Okimasa Murakami
Keisuke Nakada
Yoshitaka Obara
Keiji Ochiai
Senichi Oda
Teruki Oka
Minoru Onchi
Keiichi Onoyama
Takashi Saitoh
Tsuneo Sekijima
Satoshi Shiraishi
Hitoshi Suzuki
Norihisa Takaragawa
Seiki Takatsuki
Naoyuki Takemura
Naoyuki Take
Masahiko Takeuchi
Hidetoshi B. Tamate
Tsutomu Tanikawa
Mikihiko Tokuriki
Kimiyuki Tsuchiya
Kouji Uraguchi
Tsuneaki Yabe
Masami Yamanaka
Yasushi Yokohata
Mayumi Yokoyama
Mizuko Yoshiyuki
8 °L “9 °G ‘bE ST SSIA ‘ZIT ‘TIT “dd : z soquiny “0z owmyjo,
WINE
INSTRUCTIONS TO CONTRIBUTORS
The Mammal Study (the continuation of the Journal of the Mammalogical
Society of Japan) publishes original Articles and Short Communications, written in
English, on all aspects of mammalogy. In principle, membership of the Society is
a prerequisite for the submission of papers, but non-members may be co-authors.
Manuscripts are submitted to qualified referees for critical scientific reviewing.
Authors are notified, with referees’ comments, on acceptance, rejection or need for
revision. The editor also customarily sends manuscripts to qualified reviewers for
English editing.
Manuscripts should be submitted typewritten on one side of the paper (use A4
21.0 cm X 29.7 cm paper), and double-spaced. An approximately 3 cm margin
should be left on all sides. Do not hyphenate words at the right margin. Manu-
scripts should be arranged in the following order: the title, name(s) of author(s)
and affiliation, fax number and E-mail number if available, abstract (fewer than
200 words) and key words (five words or fewer), main text, acknowledgments,
references, tables, figure legends, figures. Titles of papers must be accurate and
concise, and (for abstraction services) include any relevant taxonomic name. A
Japanese title and a Japanese abstract should be written on separate sheets. Text
pages should be numbered through from title to references. Manuscripts should be
line-numbered, every five lines, in the left margin. Short Communications do not
exceed four printed pages. Abstracts and key words are omitted from Short
communications.
Tables and figures should be simple and self-explanatory, and their preferred
locations should be indicated in the right margin of the text. The ratio of tables and
figures to text pages cannot exceed 1:2 and they should be as few as possible. The
author’s name and figure numbers should be written on the back of original figures
and on the surface of copies.
Scientific names should be underlined. All measurements should be in metric
units. The following abbreviations should be used. Length : km, m, cm, mm, etc. ;
eaealanamimea nec: volumes km, m->. kil milk etce.; weight: ke. o mes. etc. :
HiMmMerminemiin Sec, etc; others: cal, keall (C, Hz, p (orobability), SD) SE, etc.
Arabic numerals should be used for numbers exceeding 10.
References in the text should follow the forms: “Uchida and Shiraishi (1985)
stated that ...” (Abe and Kawamichi 1990), and (Miura et al. 1993). More than one
reference within the same parentheses should be listed chronologically, alphabeti-
cally if of the same year. Full references cited must be listed alphabetically by the
first author according to the following examples:
Abe, H., S. Shiraishi and S. Arai. 1991. A new mole from Uotsuri-jima, the Ryukyu
islands. 3. Mamme: Soc. Japan 15: 47—60:
Hisenberg, J. F. 1981. The Mammalian Radiations. Univ. of Chicago Press,
Chicago, 610 pp.
Geist, V. 1982. Adaptive behavioral strategies. Im (J.W. Thomas and D.E.
Toweill, eds.) Elk of North America. pp. 219—277. Stackpole, Harrisburg.
Obara, Y. 1991. Karyosystematics of the mustelid carnivores of Japan. Honyurui
Kagaku [Mammalian Science] 30: 197—220 (Gn Japanese with English
abstract).
Authors are recommended to refer to recent issues of the journal for details of style
and layout.
Manuscripts should be submitted in triplicate, with a separate sheet giving the
title, author(s) name(s) and address(es) for editorial correspondence, a running
head (fewer than 20 letters), the numbers of main text pages, tables and figures, and
the number of copies of reprints requested.
Galley proofs will be sent to the author. Reprints may be purchased in blocks
of 50.
Mammal Study 7
Vol. 21, No.1 September 1996
CONTENTS
ORIGINAL PAPERS ,
Kaneko, Y : Age variation of the third upper molar in Eothenomys smithi
SCHOSSCSOHSHSHSHSHSSSHOHHOSHHSHOHOHSEHHOCHOHOHSHOHSHHHOHSHSOHHHOHSHSHOHOHHEHOHHSHSETHHOHOHHHEHHOHEHHHOHSHOHSTEHHHOHOHSHHOESOHOHHOHHOSOHOHHSHSHOCTEESSEZESEO
Wakana, S., M. Sakaizumi, K. Tsuchiya, M. Asakawa, S.H. Han, K. Nakata
and H. Suzuki: Phylogenic implications of variation in rDNA and mtDNA
in red-backed voles collected in Hokkaido, Japand and Korea ***:**+*++++**+*
Endo, A. and T. Doi: Home range of female sika deer Cervus nippon on Nozaki
Island, the Goto Archipelago, Japan 0010 0 © 0) 0's 0/0 ele 0 «10 0/0 c101p e0\0/0\0 010/0 c10)0)s)eleleloleleleiele)eleleleinletelarelelatelstetata
Endo, H., E. Hondo, D. Yamagiwa, T. Wakayama, M. Kurohmaru and
Y. Hayashi: Distribution of cardiac musculature in the pulmonary venous
wall of three species of the genus Mustela p0000000000 Felelelelclelalelcloleleletelelelelalalolclaletalalctalalaleteteleletetete
Inuzuka, N: Preliminary study on kinematic analysis in mammals **°***+***+***** 3
SHORT COMMUNICATIONS .
Urayama, K: Spatial segregation between the Japanese field vole Microtus
montebelli and the Japanese wood mouse Apodemus speciosus on a flood —
plain of the Naka River, northern Kanto «ois oo dave sieldleidie « 0 b.ce ocic.cieniee ae teen Ee ee eee
Ohdachi, S: Longivity of captive shrews in Hokkaido °-:-:- SER GUE DODSboSuocab coos. occa. |
The Mammalogical Society of Japan
su a
ey
sei
Beare
*
=
| The Continuation of the Journal of
the Mammalogical Society of Japan
b& E
‘Y,
“a,
pice >
OGIcaL soc’™
The Mammalogical Society of Japan’
THE MAMMALOGICAL SOCIETY OF JAPAN
OFFICERS AND COUNCIL MEMBERS FOR 1995 — 1996
President : Satoshi Shiraishi
Secretary General : Takanori Mori
Executive Secretary : Shusei Arai
Treasurers : Seiji Ohsumi, Toshiro Kamiya
Council Members : Hisashi Abe, Minoru Asahi, Kimitake Funakoshi, Yu-
kibumi Kaneko, Takeo Kawamichi, Shingo Miura, Okimasa Murakami,
Hideo Obara, Noriyuki Ohtaishi, Takashi Saitoh, Seiki Takatsuki, Kazuo
Wada
The Mammalogical Society of Japan publishes original papers in two
journals: the Mammal Study (the continuation of the Journal of the
Mammalogical Society of Japan) for papers written in English, and Honyurui
Kagaku |Mammalian Science] for those submitted in Japanese. Each jour-
nal is published twice a year. Submissions are considered on the understand-
ing that they are being offered solely for publication by the Mammalogical
Society of Japan. In principle, authors submitting articles to the journals
should be members of the Mammalogical Society of Japan. Both journals
are distributed free of charge to the members of the Society.
The following are the annual dues for the membership :
Domestic members ¥7,000 (Student ¥6,000)
Overseas members US $60.00
Institutional subscriptions ¥20,000
All correspondence regarding application for membership, subscription,
address change, and other matters should be addressed to:
The Mammalogical Society of Japan
Business Center for Academic Societies of Japan, Academic Society
Center C21, 16-9 Honkomagome, 5-chome, Bunkyo-Ku, Tokyo 113, Japan
Mammal Study : the continuation of the Journal of Mammalogical
Society of Japan
Editor-in-Chief : Seiki Takatsuki
Editorial Secretary : Yukihiko Hashimoto, Masamichi Kurohmaru
Editorial Board: Mark A. Brazil, Hideki Endo, Hirofumi Hirakawa,
Toshio Kasuya, Takeo Kawamichi, Shingo Miura, Takashi Saitoh,
Hitoshi Suzuki, Hidetoshi Tamate
All correspondence regarding manuscripts and editorial matters
should be addressed to:
Dr. Seiki Takatsuki
The University Museum, The University of Tokyo, Hongo 7-3-1, Bunkyo
-ku, Tokyo 113, Japan
Lax 03 .o0l5—(0as. e-mMalle waka @ sum U-tokyonacamm
Mammal Study 21: 71-87(1996)
© the Mammalogical Society of Japan
Habitat factors affecting the geographic size
variation of Japanese moles
Hisashi ABE
Laboratory of Applied Zoology, Faculty of Agriculture, Hokkaido University, Sapporo O60, Japan
Abstract. Japanese moles of the genus Mogera show remarkable
geographic variation in body size. In order to determine which
habitat factors affect them, 260 specimens of Mogera imaizumii
were collected from 27 localities, 280 specimens of /. wogura were
collected from 23 localities, and 41 specimens of M/. tokudae were
obtained from two localities. The relationships between size,
geographic location and seven habitat factors consisting of habitat
(rice field) area, soil hardness, and five meteorological compo-
nents, were analyzed. All three species showed a positive correla-
tion between greatest skull length and habitat area. Populations
of M. imaizumi from areas with heavy snow were significantly
smaller than those from areas with little or no snow and this
variation was also explained by the negative correlation with total
annual precipitation. In addition, the size of M. zmaizumzi varied
positively with the variation in annual mean temperature. In the
correlation between skull size of WM. wogura and habitat area, there
was a significant difference in the Y-intersept between the popula-
tions from central Honshu and those from southern Honshu,
Shikoku and Kyushu. This variation was well explained by the
negative correlation between skull size and mean minimum temp-
erature. This variation, however, was not constant across all
populations examined, because M. wogura were smaller in narrow
valleys, even where mean minimum temperatures were low.
Key words. geographic size variation, habitat factors, Mogera.
Three species of Mogera, M. wogura, M. imaizumiit and M. tokudae occur in
Japan (Abe 1995, Motokawa and Abe 1996). MM. wogura occurs in the southern
half of Honshu, in Shikoku, Kyushu and smaller islands such as Oki, Tsushima,
Goto, Tanegashima and Yakushima. M. itmaizumii occurs mainly in the north-
ern half of Honshu and on the small island of Awashima, but also has some
scattered relic populations in certain mountainous regions in southern Honshu
and Shikoku and on the small island of Shodoshima in the Inland Sea of Japan
(Fig. 1). The relic populations are surrounded by populations of M. wogura.
M. tokudae is restricted to the central part of the Echigo Plain, Honshu and to
Sado Island, located off the west coast of the plain. The ranges of these three
species are usually sharply segregated from each other except in some moun-
tainous regions with very complicated topographies, as for example in Ashiu,
Kyoto Prefecture, and Hiwa, Hiroshima Prefecture (Sagara et al. 1989, Yuka-
AD Mammal Study 21: 1996
i T=M. tokudae
M=M. imaizumii
W=M. wogura
f : M1 Noheji
= 130° MS Sannai
= M6 Jumoji La
memege M8 Mogami. M2 Morioka
M7 Tachikawa
M9 Awashima
M11 Echigo
M3 Hanaizumi
T2 Echigo ;
M16 Tokamachi TI ae M4 Semine
M19 Joetsu
M17 Nozawaonsen
M10 Koriyama
=
="
=
—
—<
—— M18 Nakano
— Z M20 Toyama M12 Bange
——} M21 Tsubata
_—> W1 Mikawa M13 Takazato
_————4 M24 Shiojiri M14 Yanaizu
——— W8 Okinoshima ——e@ M25 Agematsu iste dsen
_———4 ae W6 Agematsu
——— W11 Hiroshima M22 Numata
———"— W10 _ Togouchi
EJ ~—SCOWW12: Houhoku M23 Sano
v4 ad W1 9
ae yereushine W2 Tatsuno
W5 Gotenba
W3 Chiyo
i W4 Iwata
ee W7 Inazawa
W13 Tokushima
M27 Tsurugisan
W15 Hikosan
W16 Ukiha
W17 Zendoji M26 Kozagawa
W9 Nara
W18 Yatsushiro
W20 Hitoyoshi
W21 Kagoshima
“ POG
mee Gann W22 Tanegashima
“W23 Yakushima
W19 Ashikita _
0 100 200km
aS
Fig. 1. The distribution and collecting sites of the three species of Japanese moles. For the
locality numbers, refer to Tables 1 and 2.
Abe, Geographic variation of Japanese moles 13
wa 1977).
The Japanese moles are highly variable from range to range and in the past
this has caused confusion in taxonomy (Abe 1967). Geographical variation in
these moles has generally been described in relation to Bergmann’s rule (Ima-
izumi 1966, 1970). The variations to be observed among Japanese moles,
however, are not so simple as to be totally explained by this rule. Factor
analysis, based on many probable habitat factors is required for a further
understanding (Abe 1967). In this study, therefore, correlation analyses
between the sizes of the moles and certain habitat factors believed to influence
variation, have been carried out.
MATERIALS AND METHODS
A total of 260 MM. imaizumi were collected from 27 localities, 280 M™.
wogura were collected from 23 localities and 41 M. tokudae were collected from
two localities (Appendix 1).
The body sizes of the specimens were expressed by the greatest skull length
(GSL) measured to the nearest 0.01 mm with dial calipers. An average GSL for
each local population was adopted as the representative size of moles in that
population.
It has been shown empirically that the size of moles varies with habitat
area, especially when the habitat consists of more or less flat fields with deep
damp soft soil (Abe 1967). In Japan, this kind of habitat usually consists of rice
fields, which are distributed from low alluvial plains to montane valleys. Rice
fields are usually among the best habitats for moles. As an indicator of
habitat size, therefore, the area (km?) of rice field in each locality was measured
on a topographical map of 1/50,000 or 1/200,000. Mountains, narrow gorges
and rocky slopes all represent potential barriers to mole distribution (Abe 1974,
1985) ; therefore the area of contiguous rice fields more or less isolated from
others by such the barriers was measured, representing the size of the habitat
surrounding the collecting site (Tables 1 and 2). When the collecting site was
located in a montane area without any rice fields, the size of the habitat was
recorded as 0.01 km’.
Soil hardness (kg/cm?), an important habitat factor, was measured with an
intrusive proctor needle (Daiki-rika-kogyo, DIK-5520) to a depth of 60cm.
The hardness values used in the analyses were taken every 5cm from 12 layers
(5~60 cm depth). Such measurements were taken at about 15 points for each
habitat. From field surveys in Nagano Prefecture where the distributions of
M. wogura and M. imaizumii are parapatric, it has been noticed that soft soils
being less than 10 kg/cm? in hardness and also deeper than about 30cm are
necessary for the larger M. wogura to survive (Abe unpubl.). In terms of soil
hardness, therefore, the deepest level at which soft soils (<10 kg/cm?) can be
found at more than 50 percent of the survey points, is an important indicator of
the depth of habitat appropriate for moles.
Meteorological data for the collecting localities were obtained from nearby
74 Mammal Study 21: 1996
Table 1. Location, sample size (N), greatest skull length (GSL), and seven habitat factors of
M. imaizumit.
Locality N GSL Habitat area Soft soil Monthly mean temperature(C) Annual
(mm) (km?) depth Annual Max. Min. Max. precip.
(cm) mean range* mean* mean (mm)
1 Noheji 6 33.60 8.10 60 9.5 24.9 OVRZI ae
2 Morioka MY 83525 4.00 60 OE7 28 “= OIC O27 Ro is
3 Hanaizumi 147 53503 21.20 60 10-9" 28-9 —0; SoZ sn ommeeele
4 Semine QAO S68 U0) .00 60 10 (2.3255; a Osea 995
5 Sannai 3 B18 1.80 60 09) lots 0) 2 2ZeG e225
6 Jumoji 0 33.083 681.00 90 IO.3. Zs) OP 2350, G2
7 Tachikawa Aeon oll 984.00 30 UL 2038 ey LIMO
8 Mogami Seo. 9 35). 90 60 3.9 2530 023-2, gale
9 Awashima AL BOocu) 0.01 IS.4 Zo.0 0)..59'4 Zot ne woul
10 Koriyama ® FO J 734.00 45 9 = 238 05.240) 325 plea
11 Echigo IG 33.25 ilo7l.0o 60 We 208 ee AD- ISSS
12 Bange ASA 70 330.00 60 ee Aine SO 23 — Ze
13 Takazato 5) B04 8.40 45 I 26.8 0 2454 ge
14 Yanaizu Al 33} 19) 2.90 30 10.5 — 26.5 0, 2358eryz02i
15 Tadami Ae 1.20 20 OP eZ 5s 234 e2268
16 Tokamachi S401 149.10 60 ks 277.0 Os Z5s0 2055
17 Nozawaonsen 2 33.26 2.10 60 O25 ZH. We Z8scr ISS
18 Nakano IG 35.06 298.00 60 LORS 2626 0, 24507 S388
19 Joetsu Goel! 320.00 60 IIe Zaleth OF 2250 E285"
20 Toyama 4 35.64 1061.00 60 Wt Biss O25 57 eas
21 Tsubata A 83.39) 457.00 60 IAD ZS.0 As, = 2489
22 Numata (eo 5eo 4 33.80 D5 IDS 40.5) 0), 36) 9923 50m meno aa
23 Sano 4 36.58 1000.00 60 See 280 2 V4 925) 6y SteSG
24 Shiojiri ZA SASS 3.70 60 10 2807: 0789 23s ees
25 Agematsu 1G, 33.79 190 30 10.4" 20.3) 028) 22 Roe lee
26 Kozagawa 3 ego 0.06 WR G8 3.74 2525 eo
27 Tsurugisan Aeole 69 0.01 WD MOS 0 “WS vdiekeZ 814
*In localities with continuous heavy snow cover (> 25 cm in depth) during winter, the average
temperature at ground level was adjusted to a constant 0°C in those months.
Abe, Geographic variation of Japanese moles (5)
Table 2. Location, sample size (N), greatest skull length (GSL), and seven habitat factors of
M. wogura and M. tokudae.
Locality N GSL Habitat area Soft soil Monthly mean temperature(’C) Annual
(mm) (km?) depth Annual Max. Min. Max. precip.
(cm) mean range* mean* mean (mm)
M. wogura
1 Mikawa iy 3). 95 456.80 60 MAO 279) OS00R265 255 82262
2 Tatsuno 13 429) 202.80 55 ORAS 202519) O22 oe 535
3 Chiyo by BYEZ 0.43 Boo - ZIcO- les Adele ZS
4 Iwata Calis AY 410.40 15.6 2408 DML AS.3 IGE)
9 Gotenba 7 40.68 38.40 Wane) ZANT DUS 2324552908
6 Agematsu 26 38.90 30 60 USS) AG) 59) OMS 23.5. + Zoey)
7 Inazawa 15 Soe coe LOO0R00 30 Wy, 25).5) ZS Bod U7
8 Oki 30> Sy e00 2.80 Us Adal BM) B52 NAO
9 Nara Hy 49) 401.00 45 3 Ade Il D000 As. — sey!
10 Togouchi I Bi 6.90 29 Ue ile ZAG aI 203 75.4 ikekow
11 Hiroshima I) sealoesilh 86.50 ay) = 2559) a0) AI.0 MAI
12 Houhoku a4 89 3.0 ICO ZS50 GO Ad IA
13 Tokushima A384 344.80 IG 2A? G54 ADS)" Sy25i/
14 Tsushima Bosov! 2.00 We 258) AZO 2045
15 Hikosan a) FSO 0k 0.38 25 102RO 2658 0.08 22.6 2469
16 Ukiha WA: Sls OO 44.60 20 yeh Adel 4.03 25.5 1868
17 Zendoji Seon 0e) we Z00200 20 15gSiey 22674 Ana eile Ome plik
18 Yatsushiro OY Bl ss 453.70 60 GAS e250 D033 20.0 AVOZ
19 Ashikita Gerson 6.80 30 GRO 92269 GROG ZOOM a9G8
20 Hitoyoshi 8 BOoa8 142.70 45 WA Zda2 D4 25.9. Zax
21 Kagoshima Ub 9 SHO 0.20 60 eS) 2838S Gs ZI, ZAM
22 Tane 18 34.41 SAY) I. IS lO Zr, 225"!
23 Yaku i Ball 0.24 Il 20.4 WO.G3 ArcZ = Say
M. tokudae
1 Sado OOS 104.40 1330) 43.58 oe Zag Isoe/
2 Echigo DA Atel shoe 00 60 e820) aks 25.0 a
*Refer to Table 1.
76 Mammal Study 21: 1996
meteorological observatories or stations. Mean values for the 16 years from
1967 to 1982 were used (Takahashi 1983) except for those from Hikosan where
data from 1980 to 1994 were used. Data collected included: the annual mean
temperature ; the maximum annual range of monthly mean temperatures; the
mean of monthly minimum temperatures; the mean of monthly maximum
temperatures, and the mean of total annual precipitations. In localities with
continuous heavy snow cover (>25 cm in depth) during the winter months, the
average temperature at ground level was adjusted to a constant 0°C, irresp-
ective of ambient temperatures recorded during those months. Fifteen local-
ities in northwest Honshu and on Mt. Tsurugisan (alt. 1995 m), Shikoku, are
located in area with heavy snow falls.
A multiple or simple regression analysis was performed to detect the
relationships between size variation of moles and habitat factors. ANCOVA
test was used for the intraspecific comparison of geographic variations between
two groups of localities, and Mann-Whitney’s U-test was used for the comparli-
son of two samples with different variances.
RESULTS
Japanese moles are highly variable geographically (Fig. 2). The two main
species, M. imaizumi and M. wogura, however, differ in their trends of
latitudinal variation. A multiple regression analysis between GSL, a depen-
dent factor, and seven independent habitat factors: the log-transformed area of
habitat ; the log-transformed depth of soft soil (except for M. wogura, where
many localities lacked data); the annual mean temperature; the maximum
annual range of monthly mean temperatures; the mean of monthly minimum
temperatures ; the mean of monthly maximum temperatures, and the mean of
annual precipitation. The regression was significant for both M. imaizumii
(R?=0.734> F—6:317, p—0.0011) and MM wogura (R7—0.692, F 5:99 p00):
The mean of annual precipitation (f=0.0106) for M. zmaizumi and habitat area
(pb =0.0007) for MW. wogura were significantly correlated with size (Table 3). In
M. imaizumit, the size of Echigo specimens was considerably smaller than all
others, probably, as discussed later, due to factors other than habitat and asa
consequence the regression model was not significant (p=0.1804). When re-
calculated ignoring the data from Echigo, the regression was refined (p<
0.0001), and the correlation between mole size and habitat area became signifi-
cant (p=0.0496). Thus the sizes of both species varied positively with habitat
area.
Based on a stepwise regression analysis, the crucial habitat factors were
reduced to: habitat area, annual mean temperature, and annual precipitation
in M. imaizumit (R?=0.797, F=28.839, p<0.0001), and habitat area and mean
maximum temperature in M. wogura (R?=0.682, F=21.448, p=0.0001).
For a detailed examination of the variation in some local mole populations,
further analyses were carried out for habitat factors selected above.
Populations of M. tmaizumii from areas with heavy snow appeared to
Abe, Geographic variation of Japanese moles Mel.
Sado Is.. Niigata § —_—_—_—_
M. tokudae Echigo, Niigata ———_———
EEE SS Noheji. Aomori
—emeee— =) Morioka. Iwate
we ese ee eeeses
— oa Hanaizumi, Iwate 8}
$a — Semine, Miyagi =
——SE Sannai, Akita 5.
ae Jumoji. Akita x
—}-——Ss Tachikawa, Yamagata a
ee Mogami. Yamagata
—+— Awashima Is., Niigata
epee — Ss Koriyama, Fukushima
a Echigo. Niigata
ee Bange, Fukushima
—_—j— Takazato, Fukushima
——_—— Yanaizu, Fukushima ay: x
——j— Tadami. Fukushima M. imaizumi
eape— = =Tokamachi, Niigata
os eH Nozawaonsen, Nagano
——— Nakano, Nagano
== Joetsu, Niigata
—_— Toyama, Toyama
—- Tsubata, Ishikawa
—___ Numata, Gunma
-asioe Sano, Tochigi
ae —Shiojiri, Nagano
epee — 9 Agematsu. Nagano
+— —_ Kozagawa. Wakayama n°)
= Tsurugisan, Tokushima 2
o
Mikawa. Ishikawa —— o
ae
Tatsuno, Nagano aaa
Chiyo, Nagano —————__——_———
Iwata, Shizuoka) fe
Gotenba, Shizuoka SS
Agematsu, Nagano ——————_
Inazawa, Aichi —
Oki Iss., Shimane SS
M. wogura Nara, Nara ——
Spe Togouchi, Hiroshima
a — Hiroshima, Hiroshima
| Houhoku, Yamaguchi
— Tokushima, Tokushima
—emmmfee— 2 Tsushima Iss.. Nagasaki
aS Hikosan, Fukuoka
ee,
te.
—eepee— kia, Fukuoka
eee — Zendoji, Fukuoka
——emeepee— = Yatsushiro, Kumamoto
—emmfjeeee— = Ashikita, Kumamoto
—emhes = Hitoyoshi, Kumamoto
———S Kagoshima, Kagoshima
—emjee- ane 's.. Kagoshima
——_—emeee— Ss Yak Is., Kagoshima
ae. aa Se er 8S cr" )
31 32 33 34 35 36 37 38 39 40 41 42 43 44
Greatest skull length (mm)
Fig. 2. Geographic variation in greatest skull length of three species of Japanese moles.
Localities are arranged from south (lower) toward north (upper) for each species and those
connected with dotted lines are localities situated along a river basin. The horizontal line
indicates the total variation of the sample; the broad portion of the line, one standard
deviation on each side of the mean; the vertical line, the mean.
78
Mammal Study 21: 1996
Table 3. Results of the regression analyses between greatest skull length and habitat
factors. C. coefficient, SC. standard coefficient.
(1) Multiple regression analysis
Cc: SC. p-value
M. imaizumi All populattions
Ann. mean temp. OU 0.141 0.7164
Max. range temp. ORS3 0.187 0.4000
Mean min. temp. 0.057 0.028 0.8793
Mean max. temp. 0.164 0.148 0.7238
Ann. precip. -0.001 =() Sol 0.0106
Log area 0.300 0.286 0.1804
Log soil depth =02278 -0.020 0.8865
Intercept 27.945 0.0050
M. wogura All populations
Ann. mean temp. 0.189 0.224 ORS a7
Max.rangetemp. -0.168 =) LEG 0.6647
Mean min. temp. =, SU =(() 4174 0.5701
Mean max. temp. -0.512 >) Aya 0.5467
Ann. precip. 0.0001 OR055 0.7645
Log area 1.234 05725 0.0007
Intercept 01.609 <0.0001
(2) Simple regression analysis
M. imaizumiu Heavy snow area’s populations
C. SC: p-value
Sample excluding Echigo pop.
0.154 0.169 0.5782
0.165 URZa9 0.1988
0.151 0.076 0.6143
Dedisill 0.116 0.7218
-0.001 -0.538 0.0047
0.364 0.340 0.0496
= 0.019 SOROOM 0.9904
ZOR O29 0.0013
Little or no snow area’s populations.
Log area 0.509 0) 7 0.0012 0.543 0.742 0.0140
Intercept SY) SRY) <0.0001 34.620 <0.0001
M. imaizumi All populations All populations
Ann. precip. O00 —OROZS 0.0005
Ann. mean temp. 0.328 OL SIL7 0.0068
Intercept 36.478 <0.0001 30.643 <0.0001
M. wogura Northern populations Southern populations
Log area 0.422 0.637 0.0651 0.904 0.834 0.0002
Intercept 39.432 <0.0001 35.490 <0.0001
M. wogura All populations All populations
Mean min. temp. -().388 -().580 0.0037
Mean max. temp. -0.446 -0.398 0.0598
Intercept SIE <0.0001 49.326 <0.0001
Abe, Geographic variation of Japanese moles 79
differ in the relationship between GSL and log-transformed habitat area from
those from little or no snow areas (Figs. 3 and 4). A simple regression analysis
revealed significant regressions for the two groups (heavy snow: R?=0.515,
F=15.913, p=0.0012; littl or no snow: R?=0.550, F=9.791 p=0.0140).
Furthermore, an ANCOVA test revealed a highly significant difference in
Y-intercept between the two groups (/<0.001; regression coefficient: p=
0.485). In M. wogura, the same analysis was made comparing northern (Nara-
Oki Island and northern ones) and southern populations (southern Honshu,
Shikoku and Kyushu). In the northern populations, no significant regression
was observed (R*?=0.406, F=4.776, )=0.0651), while in the southern population
it was significant (R?=0.696, F=27.512, p=0.0002). An ANCOVA test showed
a significant difference in the Y-intercept between the two groups (#<0.001 ;
regression coefficient : =0.156).
Simple regression analyses suggest that the size of /. imaizumii decreased
as annual precipitation increased (regression coefficient=-0.001 ; R?=0.388,
F=15.844, p=0.0005) and varied positively as annual mean temperature in-
creased (regression coefficient =0.328 ; R*=0.268, F=8.776, p=0.0068) (Figs. 5
and 6). In M. wogura, the simple regression analysis between GSL and mean
monthly maximum temperature showed an insignificant relationship (R?=
0.159, F=3.958, p=0.0598), whereas a significant relationship between GSL and
mean monthly minimum temperature was indicated (R?=0.337 F=10.658, p=
0.0037 ; Fig. 7). Thus, the size of M. wogura increased as mean monthly
minimum temperature decreased, with a regression coefficient of -0.388 (Table
3). Other factors were not significant for this species.
There are only two major populations of VW. tokudae and these are isolated
on Sado Island, and on the Echigo Plain, Honshu, both of which experience very
similar climatic conditions (Table 2). Consequently, geographic variation in
relation to meteorological factors could not be analyzed in detail. The rela-
tionship between GSL and habitat area for the two populations of M. tokudae,
however, resembled those in the former two species; M. tokudae from the
larger Echigo Plain were significantly larger than those from Sado Island
(Mann-Whitney U-test, p<0.0001).
DISCUSSION
In all three species of Japanese moles, geographic variation in size as
indicated by GSL was significantly correlated with habitat area, such that size
increased as habitat area increased. M. imaizumi and M. wogura differed
somewhat, however, in their reaction to habitat factors with M. imaizumii
responding differently to habitat area in regions of heavy snow, and in regions
with little or no snow, a difference which could be attributed to a correlation
with annual precipitation. Toyama, Tsubata, Tokamachi and Joetsu popula-
tions, all in areas experiencing heavy snow falls close to the Japan Sea, were
all relatively large in comparison with from inland localities with heavy snow
but narrow areas of habitat, e. g. Takazato, Sannai, and Tadami (Fig.5). The
80 Mammal Study 21: 1996
Greatest skull length (mm)
0.01 0.1 1 10 100 10004
Habitat area (km2)
Fig. 3. The relationship between greatest skull length and habitat area (log scale) in MM.
imaizumi. Solid marks indicate samples from heavy snow areas; open ones, those from
little or no snow areas. Localities connected with lines are those situated along a river basin.
Numbers at each mark are those of localities in Table 1.
Greatest skull length (mm)
0.1 1 10 100 10004
Habitat area (km2)
Fig. 4. The relationship between greatest skull length and habitat area (log scale) in ™.
wogura. Solid marks indicate samples from Nara-Oki and northern populations ; open ones,
those from southern Honshu, Shikoku and Kyushu. Refer to Fig.3 and Table 2 for other
legends.
Abe, Geographic variation of Japanese moles 81
Greatest skull length (mm)
500 1000 1500 2000 2500 3000 3500 4000
Total annual precipitation (mm)
Fig.5. The relationship between greatest skull length and total annual precipitation in /.
imaizumi. Refer to Fig. 3 for legends.
Greatest skull length (mm)
4 5 6 7 8 9 1 TM 12 18 “4 “As
Annual mean temperature (°C)
Fig.6. The relationship between greatest skull length and annual mean temperatures in M.
imaizumiu. Refer to Fig. 3 for legends.
82 Mammal Study 21: 1996
Greatest skull length (mm)
22. GO. eaek2 | Sh 4. SWS 6) Bizae eS KODE OMMEIET
Mean minimum temperature (°C)
Fig. 7. The relationship between greatest skull length and mean monthly minimum tempera-
tures in VM. wogura. Refer to Fig. 4 for legends.
populations from Awashima and Kozagawa where continuous snow cover does
not occur in winter were also relatively large (Fig. 5). Of these, the former
may be explained by the high annual mean temperature affected by the
Tsushima Warm Current, while the latter could not be well accounted for by
this factor. The exceptional size of the Awashima population in Fig. 3 may
also be attributable to the same factor.
The size of M. tmaizumii varies positively with annual mean temperatures
(Fig. 6), and the size variation indicates a reverse of Bergmann’s rule. In this
case, the populations of Echigo, Joetsu, Tsubata, and Kozagawa are relatively
small. The reasons for this are not known, but they may differ between the
former three and the last, because of the great difference in habitat areas
between them.
Thus, some local M. imaizumii populations differed in body size from the
general trend. One of the most remarkable variations from the general trend
was found in the population of Echigo, followed by those of Tsubata and Joetsu
(Figs. 3 and 6). The most remarkable aspect of the habitat in Echigo is that
two species, VM. tmaizumi and M. tokudae occur there, and the former are very
small while the latter are very large (Fig. 2); thus the biotic situation in this
habitat is different from most of the others. Interspecific competition in moles
appears to be so severe that in plains with simple topographies such as at
Echigo, two species of moles never have overlapping ranges and are strictly
parapatric (Abe 1974, 1985). In the Echigo Plain, VM. imaizumii and M. tokudae
are clearly parapatric, consequently, the extremely small size of M. imaizumii
there cannot be attributed to a change in size due to character displacement
Abe, Geographic variation of Japanese moles 83
(Brown and Wilson 1956) which is a common biological mechanism serving to
reduce competition between ecological equivalents. One further interesting
aspect of this case, is that the larger species, M. tokudae, is actually retreating,
and reducing its original distribution, while /. zmaizumii, despite its smaller
body size, is invading the habitat of M. tokudae and expanding its range on the
plain (Imaizumi and Imaizumi 1970, Abe unpubl.). From these facts, it is
plausible to hypothesize that the extremely small M. zmaizumii of the Echigo
are recent newcomers, in the geological or evolutionary sense, having immi-
grated from the surrounding, small-bodied mountain populations. Probably
they are moles that have not yet fully adapted to the high quality habitat, which
typically results in larger-bodied moles.
In the south of its main range of VM. zmaizumii in Honshu, there are three
known populations which abut those of M. wogura, another large species, at
Tsubata, Agematsu and Shiojiri (Kita-ono) (Fig. 1). In these areas, however,
M. imaizumii is retreating as MW. wogura is expanding its range (Abe 1974, 1985).
Agematsu and Shiojiri (Kita-ono) are located along the uppermost reaches of
the Kiso and Tenryu rivers, respectively. At both these sites M. zmaizumiti
remain reasonable sizes with respect to the size of the respective habitats (Figs.
3,5, 6). M. imaizumi at Tsubata, another population confronting M. wogura,
are somewhat smaller than might be expected in proportion to habitat area and
annual mean temperature. The reason for this, however, is not known.
In M. wogura the relationship between body size and habitat area differs
between the northern and southern populations (Fig. 4), but as a whole body size
increases aS mean monthly minimum temperatures decline, a variation which
coincides with Bergmann’s rule (Fig. 7). When examined on a smaller scale,
however, size variation in each group of sites along a river basin showed the
reverse tendency, with body size decreasing as temperatures decreased along
the upper reaches of rivers (Fig. 7). This aspect of size decrease in MV. wogura,
consequently, may be accounted for by the effect of reduced habitat area at
such locations. When studying size variation in this species, therefore, sam-
ples should only be compared with those from habitats of a similar size.
The M. wogura populations of Tatsuno, Agematsu and Mikawa are para-
patric with those of MW. imaizumi and are expanding northwards, replacing
those of the latter (Abe 1974, 1985). In these three areas, only the moles of
Tatsuno are relatively larger than the others, probably as a result of the
compounded effect of the relatively wide habitat area in the Ina Valley, where
Tatsuno is located, and the lower monthly minimum temperature (Figs. 4 and
7). Although the moles of Mikawa and Agematsu experience similar monthly
minimum temperatures, the former are slightly larger than the latter, perhaps
accounted for by the wider habitat at Mikawa.
The moles of Chiyo and Agematsu are large relative to the restricted areas
of habitats available. This may be explained taking the same perspective as
that of M. imaizumii in the Echigo Plain, that is they are recent immigrants
from populations of very large moles such as from the Iwata-Tatsuno popula-
tions for the Chiyo moles, and from the Inazawa population for the Agematsu
84 Mammal Study 21: 1996
moles, both of which represent the expanding nothernmost frontier populations
of M. wogura. The extraordinarily large size of the moles in these two popula-
tions may be the main reason for the insignificant correlation between size and
habitat area only in the northern populations mentioned above (Fig. 4). Thus,
it is expected that the moles of these two populations will decrease in body size
in the future to a level reasonable for the habitat area.
It is interesting that the populations of the species showing extraordinary
variation, irrespective of whether they are larger or smaller, at the contact
point between areas occupied by two species are not original residents of the
area but immigrants. Thus, whereas the original residents are reasonably
proportioned in relation to their habitat as a result of evolutionary or historical
adaptation, while the immigrant population has not yet attained the optional
size for the habitat, and still retain, in their new habitat, their original size
related to their original native habitats. This is the most plausible explana-
tion for the extraordinary sizes of moles observed at the expanding edge of
their ranges.
Soil hardness has been considered to be an important limiting factor for the
fossorial life of moles (Abe 1974) ; however, in this study it was not found to be
significantly correlated with variation in body size. This might be a natural
consequence of moles usually preferring habitats with deep soft soils within
their range and because hardness was measured precisely in habitats preferred
by the moles. At Kita-ono, Shiojiri City, Nagano Prefecture, for example, the
range of M. wogura reaches its northernmost frontier along the uppermost
tributary of the Tenryu River. The range expansion of this species has been
blocked since at least 1959 when I first surveyed the area, by the shallow hard
soil surrounding the present habitat, which is confined here only to narrow
zones of soft soil along the banks of small streams (Abe 1985 and unpubl. data).
This type of localized habitat preference may result in an apparent non-rela-
tionship between soil hardness and mole body size as in the present analysis.
Boyce (1979) presented a hypothesis in which the seasonality of habitat
aspects was a very important factor in the evolution of large body size in
homeothermic vertebrates. In the present study, the maximum annual range
of monthly mean temperatures was one of the factors, but it was not significant
in the variation of M. wogura and M. imaizumiz.
Much work has been devoted to body size variation of mammals on islands,
and several hypotheses have been presented (Foster 1964, Heaney 1978, Lawlor
1982, Angerbjorn 1985, Lomolino 1985, Abe and Ishii 1987). There are, how-
ever, still no concrete hypotheses to explain all the size variations on islands.
In the present study of moles from the Japanese islands, no definite tendency in
size variation was observed. In M. wogura, for example, variation between
islands was basically explained by habitat area or by mean minimum tempera-
tures (Figs. 4 and 7); however, the Awashima population of M. tmaizumii, was
considerably larger than all others, in relation to habitat area. This is con-
sidered to be the effect of the warm climatic conditions on Awashima, on the
general tendency of size variation in this species.
Abe, Geographic variation of Japanese moles 85
Acknowledgments: | am grateful to Dr.$S. Shiraishi Dr. K. Maeda, Dr. T. Aoi,
Dr. Y. Yokohata, Dr.S. Yamane, Miss M. Umemoto and Miss M. Nishijima for
their kind assistance during the field work. I also wish to express my obliga-
tion to Dr. S. Shiraishi and Mr. M. Okazaki, who kindly supplied meteorologi-
cal data from Mt. Hikosan for my use. Thanks are also due to Mr. M. Takagi
for assistance with statistical procedures, and to Dr. Y. Yokohata for comment-
ing on an early draft This study was supported by a Grant-in-Aid for Sci-
entific Research from the Ministry of Education, Science and Culture, Japan
(no. 05454029).
REFERENCES
Abe, H. 1967. Classification and biology of Japanese Insectivora (Mammalia). I. Studies on
variation and classification. J. Fac. Agr. Hokkaido Univ. 55: 191—265.
Abe, H. 1974. Change of the boundary-line of two moles’ distributions in a period of 14 years. J.
Mamm. Soc. Japan, 6: 13—23 (in Japanese with English Summary).
Abe, H. 1985. Changing mole distribution in Japan. Jn Contemporary Mammalogy in China and
Japan. (T. Kawamichi ed). pp. 108-112. Mammalogical Society of Japan.
Abe, H. 1995. Revision of the Asian moles of the genus Mogera. J. Mamm. Soc. Japan 20: 51—58.
Abe, H and N. Ishii. 1987. Mammals of Tsushima Island. Ju Biogeography of Tsushima Island.
(Nagasaki Prefecture, ed.) pp. 79—109 (in Japanese with English Summary).
Angerbjorn, A. 1985. The evolution of body size in mammals on islands: some comments. Amer.
Nat. 125: 304—309.
Boyce, M.S. 1979. Seasonality and patterns of natural selection for life histories. Amer. Nat. 114:
569 — 583.
Brown, M.L. and E. O. Wilson. 1956. Character displacement. Syst. Zool. 5: 49—64.
Foster, J. B. 1964. Evolution of mammals on islands. Nature 202: 234—235.
Heaney, L. R. 1978. Island area and body size of insular mammals: evidence from the tricolored
squirrel (Callosciurus prevosti) of Southeast Asia. Evolution 32: 29—44.
Imaizumi, Y. 1966. Principles and Methods for Zoological Classification. Daiichihoki-shuppan,
Tokyo 326pp (in Japanese).
Imaizumi, Y. 1970. Land mammals of the Tsushima Islands, Japan. Mem. Natn. Sci. Mus., Tokyo
3: 159-176 (in Japanese with English summary).
Imaizumi, Y-H, and T. Imaizumi. 1970. Interspecific relationship in two mole species in the plains
of Niigata, Honshu. I. Geographic distribution. J. Mamm. Soc. Japan 5: 15—18 (in Japanese
with English summary).
Lawlor, T.E. 1982. The evolution of body size in mammals: evidence from insular populations in
Mexico. Amer. Nat. 119: 54—72.
Lomolino, M. V. 1985. Body size of mammals on islands: the island rule reexamined. Amer. Nat.,
Zee SO S16:
Motokawa, M. and H. Abe. 1996. On the specific names of the Japanese moles of the genus Mogera
(Insectivora, Talpidae). Mammal Study, 21: 114—122.
Sagara, N., S. Kobayashi, H. Ota, T. Itsubo and H. Okabe. 1989. Finding Euvoscaptor mizura (Mam-
malia: Insectivora) and its nest under Hebeloma radicosum (Fungi: Agaricales) in Ashiu,
Kyoto, with data of possible contiguous occurrences of three talpine species in this region.
Contr: Biol. Lab. Kyoto Univ. 27: 261—272.
Takahashi, K. (ed.). 1983. Nihon-kisho-soran (A Comprehensive Meteorological Bibliography of
Japan). Two volumes. Toyo-keizai-shinposha, I, 1060pp, II, 1064pp. (in Japanese).
Yukawa, M. 1977. Mammals of Hiwa Town, Hiroshima Prefecture. Nature of Hiwa, pp. 157—180
(in Japanese).
86 Mammal Study 21: 1996
APPENDIX 1
Specimens examined
All the speimens used in this work were collected by the author. Locality, with
the third mesh (ca. 1 x 1 km’) code number (LC no.) of the Environment Agency,
Japan, the month and year of collection, and the registration number (Hok-
kaido University Abe’s collection number: A no.) of all specimens examined
are listed below.
M. imaizumiu
1) Noheji T., Aomori Prf. LC6141-21-10~20, October 1959, A3028~30, August
1993, A5811~12, Tenmarin V., LC6141-01-74, August 1993, A5813. 2) Morioka
C., Iwate Pref.: Kuroishino LC5941-41-81, October 1959, A3031~35;
Kamiyonai LC5941-41-96, October 1959, A3036~45; Asagishi LC5941-41-58,
October 1959 A3046~50. 3) Hanaizumi T., Iwate Pref. LC5841-11-95, July
1960, A3394~3407. 4) Semine T., Miyagi Pref. LC5741-70-76, July 1960, A3374
~93. 5) Sannai V., Akita Pref. LC5840-75-26, August 1993, A5883~85. Jumo-
ji T., Akita Pref. LC5840-64-81, August 1993, A5876~82. 7) Tachikawa T.,
Yamagata Pref. LC5839-17-85, August 1993, A5867~69, 5875. 8) Mogami T.,
Yamagata Pref. LC5840-13-16, August 1993, A5870~74. 9) Awashima, Niigata
Pref. LC5739-52-50, August 1991, A5780~83. 10) Koriyama C., Fukushima
Pref. LC5640-12-38, August 1993, A5823~30. 11) Echigo Plain, Niigata Pref. :
Gosen C. LC5639-41-82, August 1991, A5774~76; Niitsu C. LC5939-51-33,
August 1991 A5777~79, 5792; Shibata C. LC5639-72-17, October 1960, A3430
~38. 12) Bange T., Fukushima Pref. LC5639-26-66, November 1959, A2971
~84. 13) Takazato V., Fukushima Pref. LC5639-26-91~92, November 1959,
A2985~99. 14) Yanaizu T., Fukushima Pref. LC5639-25-27, November 1959,
A3000~09; Mishima T.LC5639-15-84, November 1959, A3010~13.
15) Tadami T., Fukushima Pref. LC5639-02-15, November 1959, A3014-27.
16) Tokamachi C., Niigata Pref. LC 5538-56-40, August 1993, A5856~64.
17) Nozawaonsen T., Nagano Pref. LC5538-33-04, August 1993, A5854~55.
18) Nakano C., Nagano Pref. LC5538-02-66 and 76, August 1991, A5758~73.
19)_Jioetsu ‘©, Niigata Pref. 11€5538-32-52- and 83, August 1991) Ao(s0—— 55
20) Toyama C., ‘Toyama Pref. @5537-01-24, August “1993 aecale os.
21) Dsubata Ts Ishikawa Pref) U@5536-15-l6—17" August) 199i a5 26s:
22) Numata C., Gunma Pref. LC5439-70-83, August 1993, A5839-45. 23) Sano
C., Tochigi Pref. LC5439-34-55, August 1993, A5846~49. 24) Shiojiri C.,
Nagano Pref.: Hiraide and Kanai LC5437-17-16 and 18, August 1959, A2518
~23; Kitaono LC5437-07-58, Agust 1959, A2524~31, November 1959, A2969
—i0= Sosa. Vi LC5437-07-62;, August 1959, A253 172 +25)» Ateremiarcumee lie
Nagano Pref. LC5337-55-24, August 1959, A2499~2508 ; Kiso V. LC5337-76-22,
August 1959, A2509~12; Fukushima T.LC5337-65-16, July 1959, A2497~98.
26) Kozagawa T., Wakayama Pref. LC5035-35-65, October 1994, A5948~950.
27) Tsurugisan, Tokushima Pref. LC5437-07-58, August 1959, A2928~30, 3347.
Abe, Geographic variation of Japanese moles 87
M. wogura
De Wikaway Wi Ishikawa Pref. 1L@5436-53579; August 1991, A5742~45, 2)
Tatsuno T., Nagano Pref. LC5437-07-17, November 1959, A2883, 2887~90 ;
Kitaono, Shiojiri C. LC5437-07-57, August 1959, A2436~38, November 1959,
A2881~82, 2884~86. 3) Chiyo V., Nagano Pref. LC5337-06-99, July 1959,
Bia oo stase V~ E@5338soil-3l, July 1959; A2426; Ohdaira, lida ©. L@5337-
25-68, July 1959, A2422~25. 4) Iwata C., Shizuoka Pref. LC5237-07-21 and 40,
Auouse 199 A5713~21. 5) Gotenba C., Shizuoka Pref. 1.C5238-67-73, July
1991, A5706~12. 6) Agematsu T., Nagano Pref. LC5337-45-87, August 1959,
A2409 ; Midono, Yomikaki V. LC5337-34-29, August 1959, A2410~21; Ohkuwa
V.LC5337-45-25 and 56, August 1959, A2396~2408. 7) Inazawa C., Aichi Pref.
IC5736-06-52 and 63. July 1991, A5722~36. 8) Oki Islands, Shimane Pref. -
Saigo LC5433-22-55, December 1959, A2891~2920. 9) Nara C., Nara Pref.
LC5135-76-77, April 1991, A5685, LC5135-76-67, August 1993, A5893~96. 10)
itocouchidh) Hiroshima, Pret. L@5132=71-l6, June 1959, A2439~53. 11) Hiro-
shima C., Hiroshima Pref. LC5132-53-38, June 1959, A2454~69. 12) Hohoku
T., Yamaguchi Pef. LC5130-37-46, August 1994, A5939. 13) Tokushima C.,
Tokushima Pref. LC5134-04-70, January 1960, A2925~27; Jingo, Kawashima
T. LC5134-02-76, January 1958, A2076, January 1957, A2093~94, November
1958, A2221, January 1959, A2222, 3348, December 1959, A2923, January 1960,
A2924; Nishioe, Kamojima T. LC5134-02-76, January 1959, A2223~25. 14)
Tsushima Islands, Nagasaki Pref.: Izuhara T. LC5i29-21-59, December 1959,
A2961~68. 15) Hikosan alt. 670m, Fukuoka Pref. LC5030-17-72, June 1959,
A2493~94 ; alt. 350m LC5030-17-71, August 1994, A5913~14; Soeda T.
LC5030-26-88, June 1959, A2495. 16) Ukiha T., Fukuoka Pref. LC5030-06-05,
December 1959, A2931~42. 17) Zendoji, T., Kurume C., Fukuoka Pref. LC4930-
74-98, May~June 1959, A2470~78 ; Izumi, Chikugo C. LC4930-63-49, August
1959, A3339~42. 18) Yatsushiro C., Kumamoto Pref. LC4830-54-78, December
1959, A2952~60. 19) Ashikita T., Kumamoto Pref. LC4830-34-50, December
1959, A2943~51. 20) Hitoyoshi C., Kumamoto Pref. LC4830-25-78, August
1994, A5931~38. 21) Kagoshima C., Kagoshima Pref.: Kogashira LC4730-34-
71, April 1959, A2479~87 ; Kamifukumoto T. LC4730-24-31, April~May 1959,
A2488, 3343. 22) Tanegashima Island, Kagoshima Pref: Nishinoomote C.
LC4630-07-48, November 1958, A2205~20, May 1959, A2490; Noma, Nakatane
T. LC4530-67-37, May 1959, A2489. 23) Yakushima Island, Kagoshima Pref. :
Anbo LC4530-35-82, November 1958, A2190~94, 2196~2204; Funayuki
LC4530-45-02, November 1958, A2195; Miyanoura LC4530-54-05, May 1959,
A2491~92.
M. tokudae
DmevoztieC= Sado dsland: Niigata Pret; E@5738=l3=13 Juner 1958, AZN03.:
LC5738-13-04, July 1960, A3358~73. 2) Echigo Plain, Niigata Pref.: Niitsu C.
C5639, 50 os ulys L960 AS35538) WO5639-sile334 August 1991 A5784~91l-
Kitayama, Kameta T.LC5639-60-59, July 1960, A3354-57; Suginokoshi,
Shibata C. LC5639-72-17, October 1960, A3421~29.
(Accepted 7 July 1996)
For viel) aware 2
mide
= ae r or eo! be at aay eee nea aaa! 4 % we ee sy
* ) 4 eee 7 ; a
fo! ER Te ite: ea
'’ ‘Tagen ee * Leiber aut:
Es ' y ' ; ; cle : :
e
“ E | om, x
pak ‘ye Ne fea ae x inhi i
rhe 2 :
Mammal Study 21: 89-114(1996)
© the Mammalogical Society of Japan
Morphological variation, and latitudinal and
altitudinal distribution of Kothenomys chinensis,
E. wardi, E. custos, E. proditor, and E. olitor
(Rodentia, Arvicolidae) in China
Yukibumi KANEKO
Biological Laboratory, Faculty of Education, Kagawa University, Takamatsu 760, Japan
Fax. 0878-36-1652
Abstract. A total of 308 museum specimens of the genus Eothe-
nomys from five separate areas in Sichuan (Szechwan) and Yun-
nan Provinces, China, were categorized by the relationship
between condylobasal length (CBL) and tail length (TL). These
specimens were allocated to three larger species, FE. chinensis, E.
wardi and E. proditor, and two smaller ones, F. custos and EL.
olitor.
E. chinensis and FE. wardi are allopatric, and their distribu-
tions separated by about 240 km in northern high mountain areas
(28-30° N). E. chinensis lives at altitudes above 1500 m, whereas
E. wardi was found above 2300m. Lengths of bulla (BL), tail
(TL) and hind foot (HFL) were slightly larger in E. chinensis than
in £. wardi
E. custos has a large latitudinal range between 26° and 29° N in
Sichuan and Yunnan Provinces, whereas E. proditor occurs near
the borders of Sichuan and Yunnan (27-28 N). The latitudinal
range of E. custos overlaps with that of E. proditor in the areas of
26-28 N and 100-102° FE, but E. custos was found at slightly higher
altitudes (2500-4800 m) than E. proditor (2500-4200 m).
The distance between the anterior-most point on the upper
incisor to the posterior-most edge of the third upper molar (I-M3)
ANGE MOn a GUSIOS tended= tom increase thom South to- north,
whereas those of EF. proditor tended to decrease. FE. custos had
longer tails in localities around 29° N and 101.5° E than in other
areas.
E. olitor was recorded from two widely separated localities
(Gae7 3m Neand 99a andeca2() Neandal04 5):
Key words: distribution, Lothenomys, identification, southwest China, taxon-
omy.
The classification and identification of the genus Eothenomys (Rodentia,
Arvicolidae) have remained confused, because no study on morphological
variation has been carried out over the entire geographical range of the genus.
Furthermore, a number of nominated species have all been identified as
Clethrionomys rufocanus (Hinton 1926, Allen 1940, Tokuda 1941, Ellerman 1941,
90 Mammal Study 21: 1996
Ellerman and Morrison-Scott 1951, Jones and Johnson 1965, Gromov and
Polyakov 1977). Kaneko (1990, 1992) has already documented the mor-
phological variation, identification, and geographical distribution of E. vegulus,
E. shanseius, E. inez, and FE. eva on the Korean Peninsula and in northern and
central China, all of which proved to be distinct from C. rufocanus.
The classification of, and keys for the identification of other species of
Eothenomys living in central and southern China, Taiwan, Vietnam, Thailand,
Burma, and India, have not been well established yet, and only crude distribu-
tion maps have been provided (Allen 1940, Corbet 1978, Corbet and Hill 1992).
In Sichuan and Yunnan Provinces, China, with the exception of the E.
melanogaster group (which includes fidelis, eleusis, and muletus), some tax-
onomists recognize four species of Eothenomys (chinensis, custos, proditor and
olitor) (Allen 1940, Ellerman and Morrison-Scott 1951, Corbet 1978, Honacki et
al. 1982, Corbet and Hill 1991, Musser and Carleton 1993), whereas others
recognize five (chinensis, wardi, custos, proditor and olitor) (Hinton 1926,
Ellerman 1941, Gromov and Polyakov 1977, Corbet and Hill 1992).
The purpose of this paper is to describe identification methods and to
establish the geographical distribution of EHothenomys spp. in Sichuan and
Yunnan Provinces, China, based on the morphological variation in external and
skull measurements, and in molar characteristics.
MATERIALS AND METHODS
A total of 308 specimens were examined in the following institutions: the
Natural History Museum, London (BM); the United States National Museum
of Natural History (USNM); the American Museum of Natural History
(AMNH); the Museum of Comparative Zoology, Harvard University (MCZ) ;
the Field Museum of Natural History (FMNH); the Zoological Institute,
Academia Sinica (ASZI); and the Kunming Institute of Zoology, Academia
Sinica (ASKZI).
The localities from which specimens were collected, and their reference
numbers, are shown in Fig.1, while the latitude, longitude, altitude, date
collected, museum and registration number of all specimens examined can be
found listed in the Appendix. The latitude and longitude of each locality were
determined from gazetteers (Zhuang 1983, Su 1984) and from accounts of
collecting expeditions (Kingdon Ward 1923, Roosevelt and Roosevelt 1929).
Altitudes and distances were obtained from labels attached to specimens, and
those recorded in feet and miles were converted to meters and kilometers.
Some of these specimens had previously been described or identified by other
researchers (Thomas 1891, 191la, b, 1912a, b, 1914, 1923, Miller 1896, Allen 1912,
1924, 1940, Hinton 1923, 1926, Howell 1929, Osgood 1932, Pen et al. 1962, Lu et
al. 1965).
It is difficult to appreciate the variation among these vole species at first
glance, because of the great variation among the 42 localities from which they
were collected. These localities were grouped into five geographical areas:
Kaneko, Five species of Eothenomys in China
erte et,
eertey
Sil
N iY
Sas, a
? o
‘
, \
v \
¢ ‘
»
o
v
: i
? t
eee ‘
.
,
.
ry
sy
8
>
«
a
s
i AY
°
Xi 3
lan Es
N
t
i)
ere eae uent
‘ N
~~ sf
ea
oor”
a
R. chang Jiang
200 to
Fig.1. Sichuan and Yunnan Provinces, China, showing Localities 1-42 grouped into Areas I-
V, as defined in this study.
9? Mammal Study 21: 1996
Area I, Localities 1-8 7 Area ll, Localities 9-14" b7-21 235245 27.28) ances oe 0k
Area Ill, Localities 15-16, 22, 25-26) 29-32, and 34-37 Areal Localitvaser
and Area V, Localities 33, and 41-42. Locality 38 (the Lichiang Range) was
divided into ten different altitudinal zones.
Measurements of head and body length (H & BL), tail length (TL), and hind
foot length (HFL), were obtained from labels attached to specimens. The
presence of mammae was checked for on the skins of females. Condylobasal
length (CBL), incisor-third upper molar length (I-M3), condyle-first upper molar
length (C-M1), the length of bulla (BL), and the interorbital width (IOW), were
measured to the nearest 0.1 mm with a dial caliper by the author (the minimum
accuracy — 0.05 mm).
These measurements are defined as follows: the CBL is the distance
between the occipital condyle and the anterior point of the premaxillae ; I-M3
is the distance from the anterior-most point on the upper incisor to the
posterior-most edge of the third upper molar ; C-M1 is the distance between the
occipital condyle and the anterior edge of the first upper molar; BL is the
longest length of the auditory bulla, and IOW is the shortest measurement of the
frontal bones between the orbits.
Where specimens skulls had been damaged, CBL was estimated from
regression lines between I-M3 and CBL or between C-M1 and CBL, using data
from specimens with undamaged skulls. The regression lines were calculated
separately for four geographical areas: Area I (~=49) CBL=1.492(I-M3)+
2.644, CBL=1.482(C-M1)#1.171; Area II (n=45) CBL=1.551(I-M3)+1.514;
Area [Il (w=31) CBL=1.5370-M3)--1.543, CBL=1.:693(C-M1)— 1955] and
Area IV @=64) CBL=1.422(I-M3)=-3.193, CBE= lL67(CeMil) = 590s neanes-
sion coefficients of these lines ranged from 0.906 to 0.982 (p<0.05).
Specimens were identified as adult by the presence of mammae, or as
young by the presence of minute skull perforations and the absence of full
ossification.
Enamel patterns on the occlusal surfaces of the upper molars, were drawn
from pictures taken of the molar rows using a Nikon SMZ-10 stereo micro-
scope at 6.6X magnification. Original close-up photographs were taken of the
museum specimens using an accessory close-up lens (1.75 magnification)
attached to an Olympus camera. The enamel patterns on the third upper
molar were classified into five types (A-E; see Fig. 2). Type A has three
salient and two re-entrant folds on the lingual side. It also has a posterior loop
in which the inner enamel lamellae has either a straight or concave outline
which does not protrude posteriorly beyond line “h” which crosses perpendi-
cularly to the longitudinal axis of the tooth on the lingual side of the posterior
loop (Fig. 2); Type B has four salient and three re-entrant folds on the lingual
side, where the base line of the enamel lamellae of the third re-entrant fold
protrudes beyond line “h”; Type C has four salient and four re-entrant folds
with a posterior loop where the inner enamel lamellae has either a straight or
concave outline but does not protrude line “h” (compared with Type A); Type
D has five salient and four re-entrant folds on the lingual side where the outline
Kaneko, Five species of Eothenomys in China 93
TypeC TypeE
ini as
Fig.2. Types A-E enamel patterns on the third upper molar. These patterns differ in the
number of re-entrant angles and the shape of the posterior loop. The line (h), crossing at a
right angle to the longitudinal line of the tooth at the antero-external margin of the last
re-entrant angle, shows whether the concavity of the re-entrant angle exceeds the line
posteriorly or not. Patterns of five rectangles below the molars of Types A-E are used in
Figs. 4, 6, 8, 9 and 11.
Fig. 3. Enamel patterns on the third upper molar of the EKothenomys holotypes examined in
this study. A=MEo= Microtus (Eothenomys) olitor Thomas, 1911 (BM 11. 9. 8. 122), B=Mc=
Microtus chinensis Thomas, 1891 (BM 91. 5. 11. 3), C=MAct= Microtus (Anteliomys) chinensis
tarquinius Thomas, 1912 (BM 11. 2. 1. 207), D=MAw= Microtus (Anteliomys) wardi Thomas,
1912 (BM 12. 3. 18. 15), E=MAc= Microtus (Anteliomys) custos Thomas, 1912 (BM 12. 3. 18. 19),
F=MAcr= Microtus (Anteliomys) custos rubellus Allen, 1924 (AMNH 44001), G=EAch=
Eothenomys (Anteliomys) custos hintoni Osgood, 1932 (FMNH 33073), H=Ep= Eothenomys
proditor Hinton, 1926 (BM 22. 12. 1. 10).
94 Mammal Study 21: 1996
of the enamel lamellae of the fourth re-entrant fold protrudes beyond line “h”
(compared with Type B); and Type E has five salient and four re-entrant folds
with a posterior loop where the inner enamel lamellae appear as in Type A.
RESULTS
1. Variation among specimens from Sichuan and Yunnan
Thomas (1911b, 1912a) described Eothenomys olitor having a prominent
inner salient angle on the second upper molar, and lacking supplementary
postero-internal salient projection on the first upper molar (Fig.3-A). Six
specimens, collected from Area V (Localities 33, 41 and 42), were identified as
FE. olitor, with a TL of 35 mm, a HFL of 14-18 mm, and a CBL ranging from 20.9
to 24.1mm (z=5; Fig. 4). The dominant enamel pattern on the third upper
molar was of Type B (Table 1).
Except for those of E. olitor, all specimens examined were provisionally
identified as belonging to one of four groups, according to the relationship
between CBL and TL, and according to the geographical areas where they were
collected (see Fig.5). Specimens for which CBL was measured could be
grouped into two clusters in each area. Some specimens for which CBL could
be estimated were also included in, or were scattered close to their respective
clusters (except for several young specimens). Adults were included in the
respective clusters in each area except for one Area III cluster, in which no
adults appeared. In Areas I and II, there were two clusters of specimens with
longer CBL and longer TL (CI-L in Area I and CII-L in Area II) and with
Bil | M3
5 6 7 omm 134 15.2 mm
Soa She at Pe ER TT TY
: Mar ° MEO: a ™ Mar & Dec dl - MEo
ae ! ! ——
ba feat 'Feb 42 CI ‘Feb
ae pee
“srtiasts Vi tee oo! Ss arpa se eee
Mar & Dec Dec : Mar & Dec
MEo MEo
Dec
33
Apt io ep eur eo i Ape eter
Feb | [ae ny eh Ee
ee) ae Ye ae eee eee, ee ee
20 35 mm 14 18
Tee fallgtge le
Fig. 4. Geographical variation in BL, I-M3, TL and HFL in Eothenomys olitor.
One square refers to one specimen. Month indicates collecting month of specimens
examined. For details of Localities #33, and #41-42, see the Appendix. For enamel patterns
and abbreviation of the holotype, see Figs. 2 and 3.
Kaneko, Five species of Eothenomys in China 95
Area II
Fig.5. Relationships between CBL and TL in Areas I-IV. For abbreviation of the
holotypes (EAch, Ep, MAc, MAcr, MAct, MAw and Mc), see Fig.3. In each area, young
individuals were located to the left of a cluster of adults. Symbols: young=@; young with
estimated CBL=y ; adult= @ ; adult with estimated CBL= 4 ; individual not clearly adults
or young= O ; individual not clearly adult or young with estimated CBL=/ ; individual
missing the tip of the tail= ?. It will be shown later that clusters CI-S, CII-S, CIII-S and
CIV-S correspond to Eothenomys custos; CIII-L and CIV-L to E. proditor ; CI-L to E.
chinensis ; and CII-L to E. ward.
shorter CBL and shorter TL (CI-S in Area I and CII-S in Area II). In Areas
III and IV, there were two clusters of individulas with longer CBL and shorter
TL (CHI-L in Area III and CIV-L in Area IV) and with shorter CBL and longer
TL (CIII-S in Area III and CIV-S in Area IV). In each area, young individuals
were found to the left of a cluster of adults: 7. e. young in Area I=CI-L, young
in Area II=CII-L, young with 20-22 mm in CBL in Area IV =CIV-S, and young
Withee =2 4mm ime Cit im Area 1V—=ClV-L.
Geographical and monthly variations in two external and two skull charac-
ters (TL, HFL, BL and I-M3) along with the enamel patterns of the third upper
molar, were examined for each of CI-L, CI-S, CII-L, CII-S, CIHU-L, CHI-S, CIV-
L, and CIV-S clusters (see Figs. 6-12). A marked difference was observed
between CI-L and CII-L in the sizes of BL, TL and HFL, with only slight
overlap between the two clusters in the relationship between CBL and TL (Fig.
a De ae Bil and ios were slightly longer in CIi-E than in /Cl-L and
there was no clinal variation in these dimensions (see Figs. 6 and 7). Inclusters
96 Mammal Study 21: 1996
CI-L and CII-L, BL, I-M3, TL and HFL did not vary over the geographical
range (Figs.6 and 7). Molar enamel patterns differed between clusters CI-L
and CII-L (Table 1), with Type C more common in CI-L (87%) than in CII-L
(68%), and Types D and E less common in CI-L (2.2%) than in CII-L (2494),
The clusters CIHII-L and CIV-L overlapped (Fig. 5). The sizes of I-M3, BL,
and HFL tended to increase from north to south (Fig. 8). Type A molar
enamel was commonest in CIV-L than in CIII-L (Table 1).
Clusters CII-S, CHI-S and CIV-S all overlapped one another, but were
mostly segregated from cluster CI-S (Fig.5). TL differed discontinuously
BL I-M3
q/ 8 134 152 170
Flatt leet a lean \
Mar & Apr: r
ae EEE 2 1
Mc 2
fesearceemins fisae 27 vor GY ae 3
Aug
: =a
June O83
sa tito ecoltona ey beer =)
Oct & others ‘ Nov. cm June}
EINE
unerup ;
Oct & others
June & July
July
ii 2 12
Sept : !
ey em Ren ee He eS RR
July All
ea) : TR ‘ .
ip oS : Os, aut 3 =
July Juty & Aug eee — a
ee eye | foweAug ct ol ee
Se MAw : '
20°. Ra
1
7 8 mm 134 152 120mm
BL 1-M3
[oe] adult [0] young
Fig.6. Geographical variation in BL and I-M3 in Eothenomys chinensis (CI-L) and E. ward
(CII-L). One square represents one specimen. Month indicates collecting month of speci-
mens examined. For detailes of Localities 1-6, 10, 12-13, and 17-21, see the Appendix. For
enamel patterns and abbreviations of the holotypes, see Figs. 2 and 3.
Kaneko, Five species of Eothenomys im China O07
beeween clusters) CI-S; -Cll-S and CIll-S. In cluster CII-S, I-M3 and BL
decreased in size clinally from north to south, while TL and HFL did not differ
among localities (Figs. 9-10). Type C molar enamel predominated in all four
clusters (Table 1).
The length of I-M3 varied according to the elevation on the Lichiang
Range (Locality 38), where R. C. Andrews and E. Heller (the Asiatic Expedition
in 1916) and G. Forrest in 1921-22 collected specimens (Figs. 11 and 12). Both
I-M3 and HFL increased in size from higher to lower elevations in cluster CIV-
S, whereas they did not show aclinal change in CIV-L. Type A molar enamel
+ :
June O June 7 :
: MAct aL
N ; 6
& June June May
June & July June & aay
: : 3 ! eee
12 = ) :
13
sal
ee!
© 18
19
20
21
Alie
Fig. 7. Geographical variation in TL and HFL in Eothenomys chinensis (CI-L) and E. wardi
(CII-L). Month indicates collecting month of specimens examined.
98
Mammal Study 21: 1996
Table 1. Variations in the enamel patterns on the third upper molar in Eothenomys chinensis
(ECHI), E. wardi (EW), E. proditor (EP), E. custos (EC), and E. olitor (EO).
Type A Type B Type C Type D Type E Total
xa tte CLD SC 6.5%) 2( 4.8%) 0CT0%) «1 @.29%4) 0 46
Given Te CTL) 0 3IC 7-396)! 2868237) a 819575) Coe eT
Three Ths CUT) CE.) MEG) CIB%), 1 B88) 0 30
thse Ts CONT) SECIS) IC 2.9%) 0 0 0 34
OP CES 0 15.9%) 13(76.5%) 317 6%) 0 17
eet. MES) 0 (B29) 1BGBI) 1D(EB.79%) 0 31
Cea Ts CUTS) 0 LC 823%) 6(G00%), 43:32) ana) ae
Gon. 1 2 CRIS) 2236) 22125375) 55638276) 8 ESO) 0 87
(een 129596) | 5 (6259) = ASN) 0 0 8
BE
y 8 = =omm
GE ae | ee oe | ee
es ma :Apr
to = Apr
: : Es
co ‘Mar lh
: : O
Feb | =
4] ‘Jan
a eee Se ee ee ee a ees
7 8
—_
i
O
35 mm
L
18
mute IL
22 mm
Fig. 8. Geographical variation in BL, I-M3, TL and HFL in Eothenomys proditor in Area III
(CHU):
Month indicates collecting month of specimens examined.
For detailes of Localities 15-16, 22, 25, 29, 32, and 36-37, see the Appendix.
Kaneko, Five species of Eothenomys 7 China 99
was commonest in CIV-L, whereas Type C predominated in CIV-S (Table 1).
Specimens from CIV-S were collected at rather higher elevations than those of
CN EAs
Adult females and young were collected in May, June, July, August and
November in cluster CI-L; in August and September in CII-L; in February,
April, and May in CIII-L; and in May, June, and July in CI-S, CII-S and
CIII-S, respectively (Figs. 6, 8 and 9). On the Lichiang Range, adult females
and young were collected in August (4200 and 3300 m), September (4200 and 3900
m) and October (4500-4800, 3900 and 3600 m) in CIV-S, whereas they were
captured in May (4200-3900 and 3900 m) and September (4200 and 2700 m) in
CIV-L. One pregnant female collected in October in CIV-S (Locality 38,
Bese I-M3
on
(op)
~
3
3}
Cl-s ——————+-— cl-S ——-— c-s
3 8
134 152 mm
BL I- M3
Fig.9. Geographical variation in BL and I-M3 in Eothenomys custos in Areas I-III (CI-S,
CIII-S, and CII-S). Month indicates collecting month of specimens examined. For detailes
of Localities 7-9, 11, 14, 22-24, 26-28, 30-31, 34-36, and 39-40, see the Appendix.
100 Mammal Study 21: 1996
3600 m) contained two embryos (FMNH 33792).
2. Taxonomic conclusion
All 308 specimens examined in this study were found to have: i) a palatal
shelf construction as in the genus Clethrionomys ; ii) rootless molars even in old
age, and 111) narrower re-entrant folds on the molars than in the genus Alticola
(which has little cement in the folds). All three of these characteristics are
diagnostic traits for Eothenomys, to which consequently they were allocated
(Hinton 1926, Ellerman 1941, Corbet 1978).
Some holotypes were re-presented in the respective clusters (L and S in CI-
CIV) of Areas I, II and IV (Fig.5). In Area I, specimens within cluster CI-
35 50 65mm 14 18 22 mm
Mar R
| Nov S 34 Nov CI
Fig. 10. Geographical variation in TL and HFL in Lothenomys custos in Areas I-III (CI-S,
CIII-S, and CII-S). Month indicates collecting month of specimens examined.
101
Kaneko, Five species of Eothenomys in China
L were identified as Kothenomys chinensis (Thomas, 1891) because the holotypes
of Microtus (Anteliomys) chinensis Thomas, 1891 and Microtus (Anteliomys)
chinensis tarquinius Thomas, 1912 were both included in CI-V. The latter
name Microtus (Anteliomys) chinensis tarquinius is a junior synonym of FE.
chinensis (Thomas, 1891).
Specimens within cluster CII-L were identified as Eothenomys wardi
(Thomas, 1912) in Area II, because the holotype of Microtus (Anteliomys) wardi
Thomas, 1912 occurred within the cluster.
Fig.11. Altitudinal variation in BL and I-M3 in Eothenomys custos (CIV-S) and E. proditor
(CIV-L) in the Lichiang Range (locality 38). Month indicates collecting month of specimens
examined. a=4500—4800m; b=4200—4500 m; c=4200 m; d=3900—4200 m; e=3900 m;
f=3600—3900 m; g=3600 m; h=3300m; i=2700m. Underlined records from October indi-
cate specimens collected by R. C. Andrews and E. Heller. All other specimens were collected
by G. Forrest.
102 Mammal Study 21: 1996
: AUG Aug & Sept .
Oct
| Ca aT LAS EY ce Yeas ae VE
20 3 30mm
Hil:
Fig. 12. Altitudinal variation in TL and HFL in Eothenomys custos (CIV-S) and E. proditor
(CIV-L). Month indicates collecting month of specimens examined.
Kaneko, Five species of Eothenomys in China 103
Specimens within cluster CIV-L were identified as Eothenomys proditor
Hinton, 1923, because the holotype of E&. proditor Hinton, 1923 was also in the
cluster. In Area III, although there was no holotype, cluster CIII-L overlapped
with, and was consequently regarded as conspecific with cluster CIV-L, that is
E. proditor (Fig. 5).
Specimens within cluster CII-S were identified as Eothenomys custos
(Thomas, 1912), because the holotype of Microtus (Anteliomys) custos Thomas,
1912 was included in the cluster. Clusters CIII-S and CIV-S overlapped cluster
CII-S (Fig. 5); and all the specimens were identified as Eothenomys custos
(Thomas, 1912). Microtus (Anteliomys) custos rubellus Allen, 1924 is a junior
synonym of FE. custos (Thomas, 1912).
It was noticeable that cluster CI-S did not overlap clusters CII-S, CIII-S or
CIV-S (Fig. 5), and TL in CI-S was clearly different from those in CII-S and
CIII-S (Fig. 7). However, I-M3, BL and HFL tended to either decrease or
increase in size clinally, or varied continously from north to south among these
clusters. Therefore, the taxonomic position of CI-S is considered to be the
same as CII-S and CIII-S, which were identified as EF. custos. Consequently,
Eothenomys (Anteliomys) custos hintont Osgood, 1932, included in cluster CI-S
(Fig. 5), is a junior synonym of EF. custos (Thomas, 1912).
The relationship between H & BL and TL (tail ratio=100TL/H & BL)
varied from 55-85% in E. chinesis, from 40-65% in FE. wardi, from 50-65% in E.
pres
mol
CII-S+CIV-S
Fig. 13. The relationship between H & BL and TL in five species of Eothenomys. The ratio
of TL to H & BL is shown with lines and percentages. @=E. chinensis (CI-S); O=E.
Otome — Ea proation OW CIVel) A —-. wardr (CIEL): O— 2, custos invAreas n(@l-s)
and II (CII-S); A=E. custos in Areas III and IV (CHI-S+CIV-S). For abbreviations of the
holotypes, see Fig. 3.
104 Mammal Study 21: 1996
custos from Area I, and 30-50% in E. custos from Areas II-IV, from 30-45% in
FE. olitor, and from 20-40% in E. proditor (see Fig. 13). Thus, on the basis of
this character alone, it is difficult to segregate specimens of E. chinensis and E.
custos hintoni from Area I, specimens of E. custos and E. wardi from Area II, or
specimens of FE. custos and E. proditor from Areas III and IV.
3. Latitudinal and altitudinal distributions
Eothenomys chinensis was found on both sides of the River Datu He near
Omei Shan, Sichuan Province at 29-30° N. £. wardi was found to occur from
the Jinsha Jiang River to the Salween River around 28° N and 99° E. E. chinensis
and E. wardi have allopatric ranges separated by about 240 km. EE. custos was
found from the Yalong Jiang River to the areas between the Jinsha Jiang and
Lancan Jiang (=Mekong) Rivers from 26° N to 29°N. EE. proditor was found
along the borders of Sichuan and Yunnan Provinces, from the Yalong Jiang
River to the Jinsha Jiang River around 27-28 N. E. olitor was recorded from
a fragmented range in Zhangton (Localities 41 and 42; 23° N) and Lincang
(Locality 33; 27° N) districts in Yunnan Province. The latitudinal distribution
of E. custos proved to be rather larger than those of either E. chinensis, E. wardi
Or J2, wrocnor (kik, 14),
With the exception of the fragmented range of E. olitor, the lower
altitudinal limit of these four species of Eothenomys increased from north to
south (see Fig. 15). The altitudinal range of E. chinensis, which extends down
to 1500 m, was found to be slightly lower than that of &. wardi which occurs
above 2300m. £&. custos was found at slightly higher altitudes (2500-4800 m)
than FE. proditor (2500-4200 m), though the latitudinal range of EF. custos over-
lapped that of E. proditor in the areas of 26-28° N and 100-102° E (Fig. 14). The
lower limit of &. custos, range was approximately the same, at about 2500 m, in
Areas I, HI and IV, but in Area II it decreased from 3500 m to 2700 m from north
to south.
Some information on the habitats of Kothenomys spp. was available from
specimen labels. /. wardi was noted as occurring along the banks of streams
(Locality 12), in narrow valleys in forest (Locality 18), in alpine meadows, open
meadows and among rocks (Locality 13), and in alpine meadows and alpine
rocks (Locality 21). E. custos was noted as occurring along forested banks, in
holes under trees with runs under moss (Locality 11), under roots of large trees
in very damp forests (Locality 11), in alpine meadows, rocky meadows, forests,
and open coniferous forests (Locality 38 ; 3300 m), and under logs (Locality 38 ;
3150 m). E. proditor was found in open meadows and open rocky meadows
(Locality 38), on mountain slopes (Locality 36), and under logs (Locality 37).
Thus, the main habitat differences appear to be that E. chinensis lives in both
forests and meadows, whereas FE. wardi and E. proditor inhabit meadows and
rock areas.
Kaneko, Five species of Eothenomys in China
105
30°
®@ E. chinensis
_ 4 E.wardi Sree
©E.custos
7 E. prodi tor pe!
0 E. olitor
Fig.14. Summary of the geographical distribution of Eothenomys chinensis, E. wardi, E.
proditor, E. custos, and E. olitor. The broad dotted line indicates the demarcation line
between the Palaearctic and Oriental regions based on mammals and birds (Zhang 1979),
which passes from Zoige (33.5°N, 102.9°E), through Heishui, Barkam, Kangding and Litang,
and to Batang in Sichuan Province.
106 Mammal Study 21: 1996
m e E. chinensis
A E.wardi
9000 o E. custos 5
q E. proditor A
o E. olitor :
4000 A 16
boa re tine
ane 0 :
©3000 @o 4 % ee
=) oy A 6 ie ar be .
S A or oe
-— L
2000 hee :
Ss é
1000
=«—— Area I] ———>® =—Areas]1,0.&N——>
EEE ——E—EEEEEee > fT
23 24 26 27 28 us) Lil 28 29 30°N
LATITUDE
Fig.15. Summary of the altitudinal distribution of the five species of Eothenomys examined
in this study. Numbers with open circles indicates the localities of E. olitor listed in the
Appendix. A dotted line shows the same locality.
DISCUSSION
Hinton (1926), Ellerman (1941), and Gromov and Polyakov (1977) all consid-
ered Anteliomys to be a distinct genus, separate from Eothenomys, whereas
Osgood (1932) and Allen (1940) designated Anteliomys as a subgenus of Eothe-
nomys. In the present study, I have followed the opinions of Ellerman (1949),
Ellerman and Morrison-Scott (1951), Corbet (1978), Honacki et al. (1982), Corbet
and Hill (1992), Musser and Carleton (1993) in regarding Anteliomys as a
synonym of Eothenomys.
Two distinct groups of species belonging to the genus Eothenomys have
been identified as occurring in the provinces of Sichuan and Yunnan. The first
is the £. melanogaster group, which includes confinit, eleusis, fidelis, miletus and
mucronatus, and is characterized by the fourth salient angle on the first upper
molar and the third salient angle on the second upper molar on the lingual side.
The second group consists either of the four species FE. custos, E. chinensis, E.
olitor and E. proditor (Allen 1940, Ellerman and Morrison-Scott 1951, Corbet
1978, Honacki et al. 1982, Corbet and Hill 1991, Musser and Carleton 1993) or
of the five species E. custos, E. chinensis, E. wardi, E. olitor, and E. proditor
(Hinton 1926, Ellerman 1941, Gromov and Polyakov 1977, Corbet and Hill 1992),
Kaneko, Five species of Eothenomys in China 107
all of which lack the inner salient angles on the first and second upper molars
as found in the former group.
However, Eothenomys identification has remained confused due to a lack of
research into morphological variation, and because only crude distribution
maps have been published (Hinton 1926, Allen 1940, Corbet 1978, Corbet and
Hill 1992). During research for this paper it became apparent that Allen’s
(1940) identification key for this species group was rather difficult to apply
because of the discrepancies in the number of outer salient angles and in CBL
between FE. proditor and E. olitor (Figs. 3 and 5) and in TL between E. chinensis
and E. custos (Fig. 13). The ratio of TL to H & BL (Hinton 1926, Corbet 1978)
was not sufficient for identification because of the great overlap between the
two sympatric species of EF. custos and E. chinensis (or E. wardi) and between E.
custos and E. proditor (Fig. 13). Furthermore, this study showed that the
ranges of HFL and the ratio of TL to H&BL, and the number of inner re-
entrant folds on the third upper molars given by Corbet and Hill (1992; Table
262) were erroneous for the five species.
The first basic taxonomic debate is over whether wardi is a distinct species
or just a subspecies of Kothenomys chinensis. Thomas (1891) originally des-
cribed Microtus chinensis from a specimen collected from Kia-ting-fu (=Le-
shan; Locality 3). Later, Thomas (19lla) identified 23 specimens collected
from 23 miles (=36.8km) SE of Ta-tsien-lu (= Moxi; Locality 5) and Emei Shan
(Locality 4) as the same species. Subsequently, Thomas (1912b) described
Microtus (Anteliomys) wardi from a specimen from Chamutong (=Tra-mu-
tang ; Kingdon Ward 1923; p.193; Locality 20), W. of Atuntsi, Yunnan, and
differentiated it from chinensis on the basis of its much smaller bullae. Hinton
(1926) followed this classification, but Allen (1940) changed the taxonomic
status of wardi to that of a subspecies of chinensis, because the third upper
molar was the same as that of chinensis. Ellerman and Morrison-Scott (1951),
Corbet (1978), Honacki et al. (1982), and Musser and Carleton (1993) followed
Allen (1940), whereas Corbet and Hill (1992) followed Thomas (1912b) and
Hinton (1926). Corbet and Hill (1992) distinguished wardi from chinensis on the
basis of wardi’s shorter tail and smaller auditory bulla, and remarked on the
length of the bulla (BL=6.7 mm in wardi, and 9.1 mm in chinensis) as a distin-
guishing character. From this study, however, it is clear that in wardi BL
ranged from 6.2 to 7.4 mm, and from 6.6 to 8.4 mm in chinensis. The length of
9.1mm referred to by Corbet and Hill (1992) for chinensis may well be in error.
I also regard wardi as a full species, but because not only does it have a smaller
bulla but also a shorter tail and hind foot than chinensis (Fig. 7), and because
its latitudinal distribution is isolated from that of chinensis (Fig. 14).
The second basic taxonomic debate is over whether custos is best regarded
as full species or as a subspecies of HKothenomys chinensis. Thomas (1912b)
originally described FE. (Anteliomys) custos, based on two specimens from
A-tun-tsi, Yunnan (Locality 11), which had a small bulla, and a shorter tail than
either chinensis or wardi. Hinton (1926; p. 296 and p. 298-299 in the footnote),
however, remarked that custos, was a small form very closely related mor-
108 Mammal Study 21: 1996
phologically and geographically to the larger forms chinensis and ward1, and is
best regarded as a subspecies of Anteliomys (=now Eothenomys) chinensis,
because neither the holotype of custos nor the other custos skulls examined were
“old”, though Hinton (1926) retained the taxonomic position of custos as a full
species as did Thomas (1912b) and Allen (1924). In Areas I and II, some adult
females were included into clusters composed of both large (CI-L and CII-L)
and small specimens (CI-S and CII-S), the last of which were clearly identified
as E. custos (Figs.4 and 5). Therefore, the original specimens of custos are
neither young chinensis nor wardi as suggested by Hinton (1926).
Two subspecies of Hothenomys custos have been described, excluding the
nominotypical subspecies. Allen (1924) described one as Microtus (Anteliomys)
custos rubellus, collected from Ssu-shan (=Snow Mountain), in the Lichiang
Range, Yunnan (Locality 38-e), on the basis that vubellus was a little larger on
average than typical custos. Osgood (1932) described a second subspecies,
Eothenomys (Anteliomys) custos hintont, from Wushi (Wu-chi on the holotype
label; Locality 8), south-west of Tatsienlu, Sichuan, because it has a slightly
longer hind foot and longer tail than custos. My examination showed that
although the tail was longer in the specimens described by Osgood (1932), the
hind foot length was not (see Fig. 10). Furthermore, Osgood (1932) stated that
the interorbital width (IOW) was relatively greater in hintoni than in chinensis,
and that the third inner angle of the third upper molar was usually confluent
with the fourth outer one in hzntonz but not in chinensis. On further examina-
tion, however, I was unable to confirm these differences: IOW (X + SD) of
hintont (Localities 7-8) was 4.38+0.11mm (z=16), while that of chinensis
(Localities 1-6) was 4.33220.21 mm (@W=44) G=097384, 05’Numbered as in Fig. 1
“Total number of samples observed.
Table 2. Sequence divergence among the ten mitochondrial DNA haplotypes of
Apodemus agrarius from Korea (Upper right), on the basis of the number of common and
different fragments (Lower left).
Sequence divergence (%)*
Haplotypes Aacl Aac2 Aac3 Aac4 Aacds Aac6 Aahl Aah2 Aah3 Aah4
Aacl = ial 1.38 aS 2 AS AG LG 2.4 2.8
ANaeZ 27/11 = OFZ 2.9 2.9 326 ea 2 1.9 7 of
Aac3 DoS SOP? : 3383 323 340 Led ie 22 2.6
Aac4 22/21 20/26 19/28 + 0.4 7, Boll Bell 3.8 4.4
Aacd 20/25 20/26 19/28 31/4 = Te 2D Deo Bd 4.0
Aac6 16/330) 18730) 18/306 22/22 922)//22 = SA 3), 1 Bm 4.4
Aahl DAN 25) WA DAY NG SY 2 Gi Zale 22 sy 28 = 0.2 0.8 iL!
Aah2 WY N5 DOA Myla ISV/25 BO/24. IGy25 30/2 = 0.6 2
Aah3 D2 PY) “D2 2QYD ABO IV 23 W/O ALIS 28/6 = 0.6
Aah4 20/25. 22/22, 2M 24 16/34 7/32 16/345 25) 14 26 eS =
aSequence divergences calculated according to Gotoh et al. (1979).
repeating units (repetype) of A. agvarius previously constructed by Suzuki et al.
(1990). Among the 26-27 restriction sites examined, these were an EcoRI site
in the spacer upstream of the 18S rRNA gene (Fig. 2a), an AaflI site in the
internal spacers, three were polymorphic both within and between individuals,
and a Dral site in the spacer downstream of the 28S rRNA gene. These kinds
of polymorphism were observed in both subspecies and thus were presumed to
have occured before subspecific differentiation. These polymorphic sites were
likely to have been subjected to random and independent fixation processes, as
observed in the natural populations of the Japanese field mouse, A. speciosus
(Suzuki et al. 1994). In contrast, polymorphism in a SacI site on the internal
spacers was consistently and specifically observed in the genomes of individ-
uals of A. a. chejuensis (Fig. 2b). Since the apparent differences between the
two subspecies are confined to this variation, it may be concluded that the A.
a. coreae and A. a. chejuensis have similar genomic constitutions, but have
Han et al., Molecular variation in Korean striped field mice 1S
~B
18SA INT 28S
ERR EVIE MH) IDXGLG =A Ss SA EDDVS XA BHP G
eines — Wp NZ See Va
2 Vem wo GS ss EDDVS XA BHP G
chejuensis 1, \IZ \ gel
2 kb
Fig. 3. Restriction maps of the major rDNA repetypes of Apodemus agrarius coreae and A.
a. chejuensis. With respect to the restriction sites on the flanking spacers, only those nearest
to the distal end of the genes for 18S and 28S RNA are shown. The top diagram shows the
conserved restriction sites in the coding and the internal spacer regions of the gene for 18S
and 28S RNA, which are not represented in the lower maps. Probe’s positions are shown
with arrows. Asterisks indicate polymorphic sites within and between individuals. A=
Agia — boii — Mal: b—Pcokl ~G— belll, Hi hndilP—Psil: S—Sael- Vi=
Poull; and X= Xbal.
differentiated substantially from each other as far as rDNA-RFLP is con-
cerned.
2. Restriction-fragment patterns of mtDNA
Ten different haplotypes (Aac 1-6 and Aah 1-4) were found in this study
(Table 1), their banding patterns, from the Southern blot analysis, with the ten
restriction enzymes may be seen in Fig.3c. There are distinct variations
within this species. In particular, individuals from the two offshore islands of
Jindo and Goeje, displayed different cleavage patterns from those from all
other localities.
To estimate the degree of sequence divergence between haplotypes, we
compared site differences between different mtDNA haplotypes. The
sequence divergence among mtDNA haplotypes can be estimated from the
number of common and of different restriction fragments observed (Table 2).
From estimates of the amount of sequence divergence, we constructed two
phylogenetic trees for mtDNA haplotypes using both the UPGMA and NJ (Fig.
4a) methods. Additionally, by considering the presence or absence of each of
68 restriction fragments (Table 1), we were also able to construct a
phylogenetic tree by the maximum parsimony method (Fig. 4b). The topology
of the parsimony tree was identical to that of the UPGMA tree and almost
identical to that of the NJ tree. The ten haplotypes were clustered into four
groups; Aac 1-3 from the Korean mainland, Aah 1-4 from Cheju-do, Aac 4 and
Aac 5 from Geoje Island, and Aac 6 from Jindo Island. In contrast with the
rDNA data, the mtDNA haplotypes of A. a. coreae were remarkably differ-
entiated, showing the greatest sequence divergence, of 4.3%, between Aacl and
SZ Mammal Study 21: 1996
a
Aah1 D 44 Aah1
Aah2 7 Aah2
Aah3 Sane Cheju Isl.
Aah4 Aah4
Aact 97 Aact
Aac2 99 Aac2 meee
of Ko
Aac3 Aac3 a
Aac4 Aac4
Geoje Isl.
Aac5 Aac5
Aac6 Aac6 ] Jindo Isl.
1%
Fig. 4. NJ phylogenetic tree (a) and parsimony tree (b) for the ten haplotypes of mtDNA
from A. agrarius collected from the Korean mainland, and from Cheju, Geoje, and Jindo
islands. The bar below the NJ tree indicates 1% corrected sequence divergence. The
bootstrap percentages are given for the maximum parsimony tree. Abbreviations for ha-
plotypes are the same as in Table 1.
Aacé6.
DISCUSSION
From a molecular phylogenetic perspective, two conclusions can be drawn
from our analyses of RFLP of rDNA andmtDNA. Firstly, the results of RFLP
of nuclear rDNA suggest that the degree of genetic divergence within and
between the two Korean subspecies of striped field mice, A. agrarius coreae and
A. a. chejuensis, is low. Secondly, the results of the mtDNA RFLP revealed
the presence of several distinct mtDNA haplotypes among the various popula-
tions, irrespective of their geographic distribution. These observations indi-
cate that Korean striped field mice have similar genetic backgrounds but may
have had a somewhat complex history.
From our examination of the rDNA data, we concluded that the extant
Korean populations of A. agrvarius share a similar genetic background. Two
subspecies have become slightly differentiated from each other, but only one
restriction site (among the 26-27 examined) was observed as a Cheju-specific
variation. The new SacI site was observed in approximately half the rDNA
repeating units within the genomes of individuals of A. a. chejyuensis. This
level of difference is smaller than that between the two mouse subspecies, Mus
musculus domesticus and M. m. musculus, in which four out of 20 sites examined
have differentiated substantially (Suzuki et al. unpublished data). Our conclu-
Han et al., Molecular variation in Korean striped field mice 133
sion, that the genetic backgrounds of the two Korean subspecies of A. agrarius
are generally similar though slightly differentiated, is consistent with the
conclusions of other authors. These two subspecies differ in body size (Jones
and Johnson 1965) and in their electrophoretic patterns of transferrin (Tsuchiya
1984), but they are similar in karyotypes (Tsuchiya 1984). Our conclusion is
also compatible with geographical evidence indicating that the final isolation
of Cheju-do, from the mainland of the Korean Peninsula, occurred only 10,000-
20,000 years ago (Park 1988, Ohshima 1990).
In contrast with the rDNA data, cleavage patterns of mtDNA by restriction
endonuclease digestion, revealed unexpected patterns. It was found that the
Korean populations of A. agrarius contain several distinct mtDNA haplotypes,
as shown in Tables 1 and 2. Koh et al. (1993), working with populations from
the Korean mainland, have also observed considerable differentiation in
mtDNA haplotypes, ranging from 0.2% to 2.3% sequence divergence. Interest-
ingly, our data revealed that the haplotypes of individual mice from the two
offshore islands of Jindo and Geoje, were distinct from those of the mainland,
even though these islands are geographically close to the mainland and thought
only to have been finally isolated from the Korean Peninsula within the last
10,000 years (Park 1988). The divergence between the two different groups of
mtDNA is very large, with sequence divergence of up to 4%, corresponding to
divergence times of 1-2 million years, if the evolutionary rate of mtDNA is
accepted to be 2-4% per million years (Wilson ef a@/. 1985). It is not clear why
such highly differentiated mtDNA haplotypes exist, in particular, on the off-
shore islands, however, there appear to be two possible explanations. Firstly,
1-2 million years ago may have already become differentiated ancestral
Korean populations of A. agrvarius and their distinctive mtDNA has merely
been maintained on the offshore islands which were periodically isolated during
the last ice age. During each period when the islands were connected to the
Korean mainland, mtDNA haplotypes may have been mixed among individuals
from the whole area of the Korean Peninsula, and then during subsequent
isolation, just one mtDNA haplotype may have become fixed on each of the
offshore islands. Korea has many such offshore islands and thus there are
many opportunities to maintain many haplotypes of mtDNA. Secondly, it is
possible that some of the distinct haplotypes may have migrated from other
regions of the world. A. agrarius is so widely distributed that individuals from
other areas may have been able to contribute to the accumulation of such
extensive heterogeneity of mtDNA in Korea. Although we do not have suffi-
cient data on mtDNA haplotypes from other pairs of the world, our preliminary
investigations show, however, that these Korean haplotypes are not related to
any mtDNA from individuals collected from China, Taiwan, Russia, or Ger-
many (Suzuki et al. unpublished data). Thus, it seems most likely that the
distinct haplotypes observed in Korea were generated there during the last ice
age.
Another interesting issue is the amount of heterogeneity of mtDNA from
Cheju-do. The mtDNA haplotypes from Cheju-do were related to one another,
134 Mammal Study 21: 1996
but showed relatively high sequence divergences of up to 1.4% (Aahl and Aahé4 ;
Table 2). The results indicate that mtDNA started diverging at least 0.4-0.7
million years ago. Because these forms of mtDNA are absent from the other
Korean localities examined so far, it is strongly suggested that A. agrarius was
already distributed on Cheju-do, and probably also on the Korean Peninsula, at
least by the middle of the Pleistocene. It remains uncertain, however, how
such divergent mtDNA haplotypes have survived on this small island of just
1819 km’. Distinct haplotypes were even found at the same collection points,
and a particular haplotype was found at several different localities. For
examples, haplotype Aah 2 was collected at localty 6 (980 m above sea level)
and at locality 8 (1700 m above sea level) on Mt. Halla (see Fig. 1). Thus, it
may be concluded, that there are no significant biogeographic barriers on
Cheju-do, and that no significant “bottle-neck event” has occurred in popula-
tions of A. a. chejuensis during the last half million years.
In general, mtDNA phylogeny does not always reflect the true phylogeny
of either populations or species. As found in this study, mtDNA from Korean
A. agrarius also showed such intrinsic patterns without consistency, either in
the time of divergence or in geographic distribution. Our data may, however,
provide some clues as to the reasons for the high degree of intra-specific
mtDNA differentiation. In the case of Korean A. agvarius, the intrinsic geo-
graphic distribution of the mtDNA haplotypes may be due to the random
dispersion of mtDNA which diverged many millenial ago, furthermore, the
existence of numerous offshore islands around South Korea may have helped
maintain such differentiated mtDNA. In order to clarify this issue, further
examinations of samples collected from Korea, as well as samples collected
from other countries are necessary.
Acknowledgments : We thank Dr. S. Sakurai of the Jikei University School of
Medicine, and Dr. K. Moriwaki of the Graduate University for Advanced
Studies, for motivating us to undertake this research. We also thank Dr. H.
Abe of Hokkaido University, and Dr. M. Sakaizumi of Niigata University, for
their valuable comments. This study was supported in part by Grants-in-Aid
for Scientific Research from the Ministry of Education, Science, Sports and
Culture, Japan.
REFERENCES
Allard, M. W. and R. L. Honeycutt. 1991. Ribosomal DNA variation within and between species of
rodents, with emphasis on the genus Onychomys. Mol. Biol. Evol. 8:71—84.
Arnheim, N. 1983. Concerted evolution of multigene families. 2 Evolution of Genes and Proteins
(M. Nei and R. K. Koehn, eds.) pp. 38—61. Sinauer, Sunderland Mass.
Arnheim, N., M. Krystal, R. Schmickel, G. Wilson, O. Ryder and E. Zimmer. 1980. Molecular evi-
dence for genetic exchanges among ribosomal genes on nonhomologous chromosomes in man
and apes. Proc Natl Acad) Sci-sUSAY 772 1323 — (32
Felsenstein, J. 1993. PHYLIP: Phylogenetic inference package, version 3.5c. Department of
Genetics, University of Washington, Seattle.
Han et al., Molecular variation in Korean striped field mice BS
Ferris, S. D., R. D. Sage, C. M. Huang, J. T. Nielsen, U. Ritte and A.C. Wilson. 1983. Flow of mito-
chondrial DNA across a species boundary. Proc. Natl. Acad. Sci. USA 80 : 2290—2294.
Gotoh, O., J. Hayashi, H. Yonekawa and Y. Tagashira. 1979. An improved method for estimating
sequence divergence between related DNAs from changes in restriction endonuclease cleavage
sites. J. Mol. Evol. 14: 301—310.
Hillis, D. M. and S. K. Davis. 1986. Evolution of ribosomal DNA: Fifty million years of recorded
history in the frog genus Rana. Evolution 40: 1275—1288.
Hillis, D. M. and S. K. Davis. 1988. Ribosomal DNA: Intraspecific polymorphism, concerted evolu-
tion, and phylogeny reconstruction. Syst. Zool. 37 :63—66.
Jones, J. K. and D. H. Johnson. 1965. Synopsis of the lagomorphs and rodents of Korea. Univ.
Kansas Publ. Mus. Nat. Hist. 16 : 357—407.
Jukes, T.H. and C.R.Cantor. 1969. Evolution of protein molecules. /z Mammalian Protein
Metabolism. (M. H. Munro ed.) pp. 21—132. Academic Press, New York.
Koh, H.-S., S.-K. Yoo, S.-B. Kim and B. -S. Yoo. 1993. Variation of mtDNA in striped field mice,
Apodemus agrarius coreae Thomas, from the Korean Peninsula. Kor. J. Syst. Zool. 9: 171—179.
Kominami, R., Y. Urano, Y. Mishima and M. Muramatsu. 1981. Organization of ribosomal RNA
gene repeats of the mouse. Nucleic Acids Res. 9 : 3219—3233.
Kominami, R., Y. Mishima, Y. Urano, M. Sasaki and M. Muramatsu. 1982. Cloning and determina-
tion of the transcription termination site of ribosomal RNA gene of the mouse. Nucleic Acids
Res. 10 : 1963—1979.
Maniatis, T., E. F. Fritsch and J. Sambrook. 1982. Molecular Cloning. Cold Spring Harbor Labora-
tory, Cold Spring Harbor, New York.
Ohshima, K. 1990. The History of Straits around the Japanese Islands in the Late-Quarternary.
The Quarternary Research 29 : 193—208 (in Japanese with English abstract).
Park, Y.-A. 1988. Continental shelf sedimentation. In Geology of Korea. (D. -S. Lee, ed.) pp. 406—
426. Kyohak-sa, Seoul.
Saitou, N. and M. Nei 1987. The neighbor-joining method: a new method for reconstructing
phylogenetic trees. Mol. Biol. Evol. 4: 406—425.
Sokal, R. R. and C. D. Michener. 1958. A statistical method for evaluating systematic relationships.
Univ. Kansas Sci. Bull. 28 : 1409—1438.
Suzuki, H., N. Miyashita, K. Moriwaki, R. Kominami, M. Muramatsu, T. Kanehisa, F. Bonhomme, M.
L. Petras, Z.-C. Yu and D.-Y. Lu. 1986. Evolutionary implication of heterogeneity of the
nontranscribed spacer region of ribosomal DNA repeating units in various subspecies of Mus
musculus. Mol. Bio. Evol. 3: 126—137.
Suzuki, H., K. Moriwaki and E. Nevo. 1987. Ribosomal DNA (rDNA) spacer polymorphism in mole
rats. Mol. Biol. Evol. 4:602—607.
Suzuki, H., K. Tsuchiya, M. Sakaizumi, S. Wakana, O. Gotoh, N. Saitou, K. Moriwaki and S. Sakurai.
1990. Differentiation of Restriction Sites in Ribosomal DNA in the Genus Apodemus.
Biochem. Genet. 28 : 137—149.
Suzuki, H., K. Tsuchiya, M. Sakaizumi, S. Wakana and S. Sakurai. 1994. Evolution of restriction
sites of ribosomal DNA in natural populations of the field mouse, Apodemus speciosus. J. Mol.
DVO, Sts} § OIDs
Tsuchiya, K. 1984. Development and utilization of characteristics of field mice. In Report by the
Grant-in Aid for Scientific Research from the Ministry of Education, Science and Culturof
Japan (1981 —1983). (T. H. Yoshida ed.) pp.17—25 (in Japanese).
Wakana, S., T. Watanabe, Y. Hayashi and T. Tomita. 1986. A variant in the restriction endonu-
clease cleavage pattern of mitochondrial DNA in the domestic fowls (Gallus gallus domesticus).
Anim. Genet. 17 : 159—168.
Wilson, A.C., R.L.Cann, S.M.Carr, M. George, U.B.Gyllensten, K. M. Helm-Bychowski, R. G.
Higuchi, S. R. Palumbi, E. M. Prager, R. D. Sage and M. Stoneking. 1985. Mitochondrial DNA
and two perspectives on evolutionary genetics. Biol. J. Linn. Soc. 26 : 375—400.
Wilson, G. N., M. Knoller, L. L. Szura and R. D. Schmickel. 1984. Individual and evolutionary varia-
tion of primate ribosomal DNA transcription initiation regions. Mol. Biol. Evol. 1 : 221—237.
Yonekawa, H., K. Moriwaki, O. Gotoh, J. I. Hayashi, J. Watanabe, N. Miyashita, M. L. Petras and Y.
136 Mammal Study 21: 1996
Tagashira. 1981. Evolutionary relationships among five subspecies of Mus musculus based on
restriction enzyme cleavage patterns of mitochondrial DNA. Genetics 98 : 801—816.
Yonekawa, H., K. Moriwaki, O. Gotoh, N. Miyashita, N. Matsushima, L. Shi, X.-L. Zhen and Y.
Tagashira. 1988. Hybrid origin of Japanese mice “Mus musculus molossinus” : evidence from
restriction analysis of mitochondrial DNA. Mol. Biol. Evol. 5:63—78.
(Accepted 10 January 1997)
Mammal Study 21: 137-151(1996)
© the Mammalogical Society of Japan
Foraging behavior of red foxes Vulpes vulpes
schrencki utilizing human food in the Shiretoko
National Park, Hokkaido
Hideharu TSUKADA* and Nariaki NONAKA!
Regional Sciences, Faculty of Letters, Hokkaido University, N1IO W7 Kita-ku, Sapporo O60, Japan,
‘Laboratory of Parasitology, Graduate School of Veterinary Medicine, Hokkaido University, NI8 W9
Kita-ku, Sapporo O60, Japan
Abstract. The utilization of human food (provisions) by red
foxes, Vulpes vulpes schrenckt, in the Shiretoko National Park was
investigated to clarify the significance of begging behavior in a
natural habitat. An analysis of 736 scats showed that foxes ate
prey, such as rodents, insects, fruits, birds and deer, mainly in
relation to their seasonal availability. The tendency to depend on
a single dietary component increased in the latter half of the
tourist season, when many tourists fed foxes, and was lower
during the non-tourist season and the first half of the tourist
season. The monthly variation in the utilization of provisions did
not correlate with availability, and was negatively correlated with
the increase in other single dietary components during the tourist
season. During the non-tourist season, when relatively little
natural food was available, foxes expended great energy to obtain
provisions. It is concluded that red foxes in the Shiretoko NP,
utilize provisions as a secondary food supply. Such food could be
critical for them, however, in order to compensate for the lack of
their major natural food resources at certain times of the year.
Key words: begging behavior, food habits, foraging behavior, provisions,
Vulpes vulpes schrenckt.
Red foxes, Vulpes vulpes, have a wide ranging diet, enabling them to survive in
various environments. They are also flexible in their foraging behavior,
changing to cope with the variation in the availability of each food item, as
determined by their distribution, and abundance. One example of their flex-
ibility is the development of begging, appearing in front of humans and waiting
for them to provide food.
In heavily human-influenced habitats, scavenging enables foxes to access
the abundant food source in the form of human waste, begging allows access to
additional supplies actually given by people. In England, for example, it is
well known that some urban residents actually feed foxes (Macdonald 1987),
*Present address: Laboratory of Parasitology, Graduate School of Veterinary Medicine,
Hokkaido University, N18 W9 Kita-ku, Sapporo 060, Japan
Fax. 011-717-7569, e-mail. tsuka @ vetmed. hokudai. ac. jp
138 Mammal Study 21: 1996
and in some cities in Hokkaido, Japan, foxes beg for food (Watanabe 1996).
Hence, begging for food is a profitable strategy in areas inhabited by people.
Of particular interest, however, is that foxes in more natural habitats also
develop this strategy. In the Shiretoko National Park (Shiretoko NP), one of
the most famous natural ecosystems protected in Japan, red foxes have been
observed begging for food since 1970 (Tsukada 1994, Watanabe and Tsukada
1996). Tsukada (1994) indicated that begging was acquired by foxes through
interactions with humans during their early lives, however, neither the factors
which lead foxes to beg, nor the influence of the development of begging
behavior on the utilization of natural food, have been clearly understood.
In this study, seasonal changes in the frequency of begging, and its relation-
ship to human and natural food availability, were analyzed in order to clarify
the importance of begging by foxes living in natural habitat.
MATERIALS AND METHODS
1. Study Area
The study was conducted in the Shiretoko NP, eastern Hokkaido (Fig. 1),
where the mean annual temperature is about 6°C and precipitation is 1100 mm,
with winter snow depths reaching 1-2 min lowland areas. The park is visited
by 15 million tourists every year. This intensive study was conducted along
the main tourist road in the park, the Shiretoko Park Road. This road has two
Va Gate for vehicles Sea of Okhotsk 0 ikm 2km
BOS.
a
Utoro Town ,e° : "=~. Shiretoko Park Road
National Park
— Study Road ~~ Coastline
—___ Road Town
River eeee National Park
: Boundary
@ Gate for vehicles
Fig.1 Map of the study area.
Tsukada and Nonaka, Human food utilization by red fox 139
gates, which are closed during winter. Gate A is open from May to November,
enabling tourists to visit the south-west section of the road, and Gate B is open
from June to October, enabling tourists to reach Point “E” (Fig.1). The
vegetation of the area is comprised of mixed broad-leaved and coniferous
forests, with an admixture of the wild cherries, Prunus ssiori and Prunus
sargentii, and lianes, such as the Tore vine, Actinidia arguta, and the wild grape,
Vitis coignetiae, which occur at the edge of the forest.
2. Capturing and Identification of Foxes
From 1992 to 1994, forty three red foxes (18, #25) seen begging for food
were captured in the study area, and fitted with individually identifiable
colored ear tags (Allflex 25, Allflex New Zealand Ltd.). Foxes were classified
into two age groups: juveniles ( 0.05)
142 Mammal Study 21: 1996
==@=—= begging
=@= provisions
Frequency of fbegging
Abundance of provisions
Jun Jul Aug Sep Oct Jun Jul Aug Sep Oct
1993 1994
Fig.2 Monthly variation in the frequency of begging by adult foxes (solid line with circles),
and in the abundance of provisions (broken line with squores) in the study area.
0.45 3.5
0.4
3
o
m 0.35 ©
= 25 ©
a) 0.3 =
2 (=
= 0.25 2 @
fe) >
=}
oS 0.2 =
Q : lf 3
= he
s 0.15 &
be
5
UL. 0.1 S
0.5
0.05
0 0
Jun Jul Aug Sep Oct Jun Jul Aug Sep Oct
1993 1994
Fig.3 Monthly variation in the frequency of begging by eight juvenile foxes in 1993 (solid
line and circles) and in the average number of juvenile foxes begging per km in 1993 and 1994
(histogram).
Tsukada and Nonaka, Human food utilization by red fox 143
0.35
0.30
0.25
0.20
Frequency of begging
Jun Jul Aug Sep Oct Jun Jul Aug Sep Oct
1993 1994
Fig.4 Monthly variation in the frequency of begging by three foxes born in 1993.
The frequency of begging by adult foxes varied both between and within
years. Among the 12 adults which were observed begging in both 1993 and
1994, the mean frequency of begging was significantly higher in 1993 (0.27+0.03
SE penanwimel994) (0:15s20,02 SE 2 Wilcoxon sign rank test, p<0.01). In both
years, however, adults were found to beg most in June and least in autumn (Fig.
2). This pattern of seasonal change was consistent in both years (r°=0.96, p<
0.06, m=).
The availability of provisions also varied between and within years. The
mean abundance of provisions was significantly lower in 1993 (1.12+0.32 SE),
than in 1994 (1.55+0.55 SE : Wilcoxon sign rank test, $<0.05). It increased in
summer, peaked in August, and decreased in autumn in both years. Surprising-
ly, the frequency of begging did not correlate with the availability of provi-
sions.
As with adults, the mean frequency of begging by juvenile foxes also varied
within the year, however, monthly fluctuations were not in phase with adults ;
it was, for example, lower in summer and higher in autumn, while the reverse
occurred in adults in 1993 (Figs. 2 and 3). In 1994, however, juveniles showed
little begging behavior in autumn, and the number of juveniles begging per km
was significantly lower than in 1993 (Wilcoxon sign rank test, p<0.05; Fig. 3).
Three young foxes born in 1993, also remained in their natal range throughout
the 1994 study period. Their seasonal frequency of begging differed noticeably
from that in 1993, and was highly correlated with that of other adult foxes (r=
OUI, DKWAS 2 Wie 4S Cit, ies 2),
144 Mammal Study 21: 1996
2. Food habits and food availability
Fecal analysis revealed that in terms of perctage occurrence, six food items
ranked highest : roughage, rodents, insects, fruits, birds, and deer. Although
roughage (consisting of dry twigs, dry leaves and grasses) occurred most
frequently in feces, it was assumed to have been accidentally included in
samples when collecting them, or that it had been swallowed with other food by
the foxes, because it had not been listed as a staple food in previous fox studies
(Abe 1975, Misawa 1979, Yoneda 1982, Kondo ef al. 1986). Therefore, roughage
was excluded in the following analysis. Five of the highest ranking dietary
components by weight were: fruits, rodents, insects, deer and birds, which
together accounted for 71.0% of the total weight of feces. Hence, the five
major foods of Shiretoko foxes, both by percentage occurrence and by percent-
age weight, were rodents, insects, fruits, birds and deer. Provisions appeared
in 11.8% of all fecal samples and accounted for 4.3% of total fecal weight
(Table 2).
Table 2. Annual diet composition of fox feces in the
Shiretoko National Park (n=736).
Food categories Occurrence (%) Weight (%)
Rodents 40.1 W,.2
Insects 40.1 JUL o
Fruits 2625 29.5
Birds “fh AD Cell
Deer GEG 9.9
Fishes 9.5 6.2
Other mammals evi Zod
Unidentified ALD 1.6
Soil AM Hall
Earthworms 3.4 4.3
Other animals D8 0.8
Reptiles el 0.6
Shellfishes 05 eZ
Crustcea (a3 0.1
Fungi 0.3 <0), Jl
Roughage 44.6 Daw
Human foods RS ALS}
The composition of the diet was found to vary with the seasons. The
greatest range of food categories found in feces occurred in April, May and
June. The range then decreased until September, increased again in October
and November, and decreased once more in January and February (Fig. 5).
From May to November, just one food category occurred in more than 50% of
scats each month. The percentage occurrence of the most frequently occur-
ring category, each month, increased from May to November (with the excep-
tion of September, when the sample size was very small; Fig.5). Thus, the
tendency to depend on a single dietary component increased from spring to
Tsukada and Nonaka, Human food utilization by red fox 145
%
Percent Occurrence
Number of food categories
Apr May Jun Jul Aug Sep Oct Nov Jan-Feb
Tourist Season
Fig.5 Seasonal variation in the number of food categories occurring in feces (broken line
with squares) and the percent occurrence of a food category showing the highest value each
month (solid line with circles).
autumn, and decreased in winter.
The utilization of main food categories also changed seasonally. Fruits,
such as A. arguta, V. coignetiae and Prunus spp., occurred most in autumn, with
A. arguta in particular, accounting for 87.9% of the total weight of fruits taken.
The seasonal variation in both percentage occurrence and percentage weight of
fruit in fox feces was correlated with the change in their relative abundance
(occurrence: Kendall’s r=0.68, p<0.05; weight: Kendall’s r=0.58, p<0.05;
Fig. 6A).
Rodents included the northern red-backed vole, Clethrionomys rufocanus,
and the grey red-backed vole, C. rutilus, and two endemic species of field mice
Apodemus speciosus and A. argenteus. Voles occurred in 91.8% of scat samples
containing rodents, and accounted for 90.2% of their total weight. Rodents
occurred mostly in May, although the highest percentage by weight was in
April (Fig.6B). The abundance of rodents increased sharply from June to
August, reaching a peak in October, yet there was no correlation with percent-
age occurrence in feces (Kendall’s r=-0.36, p>0.05), although there was a
negative correlation with percentage weight (Kendall’s r=-0.71, p<0.05; Fig.
6B).
Insects available to foxes included Hymenoptera, Coleoptera, Orthoptera,
and various larvae. Coleoptera in particular occurred in 91.8% of scats
containing insects, and accounted for 96.4% of their total weight. Most insects
occurred in samples collected during summer (Fig. 6C), with their percentage
occurrence (Kendall’s 7=0.81, p<0.05; Fig. 6C) in scats correlated with their
146 Mammal Study 21: 1996
¢ _ A:Fruits = C:Insects
= 1 2 * 100
8 =. 3 3
5 80 0.8 5 5 3
: > :
On 60 06 2 o ro)
or LEG g
= 40 04 § se) ow
ce} wo no)
~—_ © =
xe 20 ; j 0.2 g x Fi
= io ra
D Rao ro
Co) Apr May Jun Jul Aug Sep Oct Nov Jan- e a
= Feo Ss
g _ B:Rodents RY
e s = 100 1400
Q ae 1200 ¥
5 3 3 80 g
5 FS S 1000 2
ro} 8 60
: g 8 a
Cc Cc ig 40 ©
s eS 3 400 ©
J oO
= Fr OS 200 &
= _—
i ® Apr May J Jul Aug S Oct Nov J
® lg a in =
g rah g p y Jun Jul Aug Sep Oct Nov ca
z = F:Provisions
a) 3 ra
¢ 2 5
2 ® 80 7]
5 = 3
8 § 60 3
: 2 ;
Q Z 20 oS
= = a
2 3 0 2
s Feb S Feb
--@-- percent occurrence of each food item
—A— percent weight of each food item
[——) abandance of each food item
Fig.6 Seasonal variation in the weight and occurrence of six dietary components and their
abundance in the study area.
availability. The percentage weight, however, did not correlated with their
availability (Kendall’s r=0.52, p > 0.05).
Birds were most abundant in May and September, however, neither their
percentage occurrence nor their percentage weight in scats correlated with
their abundance (occurrence: Kendall’s r=0.42, p>0.05; weight: Kendall’s
t=—-0.99, p>0.05) (Fig. 6D). A few pieces of egg shell were present in samples
from May to July.
Tsukada and Nonaka, Human food utilization by red fox 147
Sika Deer, Cervus nippon, occurred more frequently during April, May and
June than in other months (Fig. 6E). In June, a few calf hooves were present in
samples.
Provisions occurred most frequently during the tourist season, in spring
and summer, peaking in June (Fig. 6F), and less frequently during the non-
tourist season. During the tourist season, provisions included plastic mater-
ials, paper, aluminum foil, and corn. ‘The frequency of begging by adult foxes
during this season, correlated with the percentage weight (Kendall’s r=1.0, p<
0.05, n=5), but did not correlated with the percentage occurence of provisions
(Kendall’s r=0.6, p>0.05, n=5). This is probably due to the small sample size
in September when begging was unexpectedly scarce. During the tourist
season, provisions identified in fox scats were mostly composed of food given
by people to begging foxes. The availability of provisions during the tourist
season peaked in August, but did not correlate with either the percentage
occurrence or the percentage weight of provisions in scat samples (occurrence :
Kendall’s r=-0.14, p>0.05; weight: Kendall’s r=-0.24, p>0.05; Fig. 6F).
The percentage occurrence of provisions in scats each month was found to be
negatively correlated with the percentage occurrence of the most frequently
occurring food during the tourist season (r=0.96, 6 < 0.01), and showed a similar
tendency in relation to the number of food categories, although the correlation
was not significant in this instance, perhaps because of a potential bias in
September due to the small sample size (Fig. 5, Fig. 6F).
During the non-tourist season, provisions occurred most in April and May,
and household scraps were observed in 64% of feces counting all provisions.
DISCUSSION
Begging by red foxes did not differ between the sexes, or between adults in
differing reproductive conditions, thus indicating a general similarity in feeding
strategies. This is in agreement with data on the food habits of hunted foxes
from other countries, which also indicated that males and females had similar
diets (Englund 1965, Sequiera 1980).
The difference in the frequency of begging, between juvenile and adult
foxes changed seasonally. The frequency of adults begging decreased in
autumn in 1993 and 1994, but the frequency of juveniles begging increased only
in autumn 1993. Juvenile foxes were probably fed by their parents until they
were 13 weeks old, or until July or August, and they gradually began to feed
themselves (Nakazono 1994). In general, juveniles have inferior hunting skills
during their first autumn, therefore, they tend to depend on more easily acces-
sible food than adult foxes (Englund 1969, Sargeant et al. 1984). This would
explain the increase in the frequency of begging among juveniles from spring to
autumn in 1993, and furthermore, by the following year, 1994 (by when they had
become more skillful hunters), three of those same juveniles from 1993 showed
the same seasonal change in begging frequency as other older adults.
What was unexpected, however, was a reduction in the frequency of
148 Mammal Study 21: 1996
begging by juvenile foxes from summer to autumn 1994. In October and
November 1994 the fruit biomass of A. arguta was higher than in an average
year (Matsuda pers. comm.), not surprisingly the readily available fruits
dominated the diet of the foxes, occurring in 86.6% of scats (n=149). This was
significantly higher than 1993 (33.8%, n=157; 7?=88.5, Fisher’s exact p<
0.001; Tsukada unpubl.). Thus, unlike in autumn 1993, in autumn 1994 juve-
nile foxes were easily able to depend on these fruits, their abundance probably
explaining the decrease in begging in autumn 1994.
The seasonal change in the frequency of begging by adult foxes was similar
in both 1993 and 1994. If this change was dependent on food abundance, it
should have been positively correlated with changes in the abundance of
provisions in each year. Such a correlation, however, was not observed.
Furthermore, adults begged less frequently in 1994 than in 1993, whereas
conversely provisions were more abundant in 1994 than in 1993, suggesting that
there was no relationship between frequency of begging by adults and the
availability of provisions. Why didn’t begging frequency correlate with either
seasonal or annual variation in the abundance of provisions?
According to Calisti et al. (1990), and Doncaster et al. (1990), the diet of red
foxes varies in relation to food availability. The foxes in the Shiretoko NP
study area tended to prefer one food category in each season. Such seasonal
switching of preferred foods and main food categories is likely to be dependent
on their availability. Food availability, however, can be broken down into two
important aspects: abundance and ease of acquisition.
Food items such as fruits and terrestrial insects are easily obtainable, thus
their availability is directly correlated with abundance. In fact, foxes in the
study area chose these foods in relation to their abundance. On the other hand,
the availability of active prey, such as live rodents and birds, is dependent on
both their abundance and on their ease of acquisition. Rodents and birds were
consumed by foxes but not in direct relation to their abundance.
During springs when ground cover, such as snow and grasses, were scarce,
and hence rodent vulnerability was high, rodents were eaten frequently
(Yoneda 1983, Jedrzejewski and Jedrzejewski 1992). Birds were eaten most
during the migration seasons (April and September ; Matsuda pers. comm.),
and during the nesting season (May to July), indicating that they were most
intensively predated when most vulnerable. The utilization of deer by foxes
increased from April to May (the period of highest mortality ; Kaji pers.
comm.) ; it was also common in June, the peak birth period for deer on Shireto-
ko (Yabe 1995). Thus, rodents, birds and deer, major items in the diet of foxes
on Shiretoko, were utilized depending on their vulnerability.
Adult foxes were easily able to obtain provisions during the tourist season.
Even juvenile foxes, with inferior foraging skills and still mostly dependent on
their parents for food, were able to obtain food from people. Therefore, the
availability of provisions is considered to be directly correlated with its abun-
dance. The utilization of provisions by foxes in the tourist season, however,
did not depend on their availability. In fact, fecal and behavioral analyses
Tsukada and Nonaka, Human food utilization by red fox 149
indicated that utilization of provisions was strongly dependent on the utiliza-
tion of other food items, probably based on their availability. Indeed, the
utilization of provisions was negatively correlated with the frequency of the
primary dietary component during the tourist season.
A low contribution of a principle dietary component indicates the low
availability of any particularly palatable prey. Such deficiencies tended to
occur during April, May and June, and also during January and February.
During these periods, foxes broaden their diet to include less preferred prey,
such as shrews, insectivorous small mammals (Macdonald 1977) which occur in
feces only during April (weight: 1.8% ; occurrence: 5.3%) and May (weight :
0.3% ; occurrence: 1.0%). Of particular interest is that provisions were found
more frequently in feces during April, when the park road was closed, than in
October, indicating that foxes made lengthy excursions to human residential
areas up to 13 km from the locations where feces were collected. Admittedly,
such excursions were made by some foxes which begged for food even during
the non-tourist season (Tsukada 1994). These particular individuals expended
a great deal of energy to obtain provisions when major natural foods were
scarce.
Given that foxes in the Shiretoko NP showed no notable inclination
towards provisions, even during the tourist season, when the availability of
provisions was highest, it appears that provisions were utilized mainly as a
secondary food source, when more palatable and preferred natural foods were
absent or less abundant. This observation is not unique, as Englund (1965), and
Lucherini and Crema (1994) also observed that some human waste were used as
a secondary food source in other natural habitats.
The major, previously reported, fox prey items are small rodents, hares
and rabbits, wild fruits and berries, insects, and birds (Ables 1975, Lloyd 1980,
Sequiera 1980), all of which fluctuate in their abundance, and thus in their
availability to foxes. It must be vitally important for foxes to meet the
temporal shortages in their major prey. Provisions are generally available
year round wherever human activity occurs. Furthermore, in Shiretoko NP,
many outdoor recreationists visit natural areas inhabited by foxes and make
provisions available to foxes. Provisions seem, therefore, less preferable than
natural foods, but provide an alternative when natural foods are in short
supply. It is likely that foxes inhabiting a natural area such as Shiretoko NP
may begin to beg for provisions simply because they are offered them by the
numerous visitors. Provisions may also be a critical food in terms of increas-
ing the carrying capacity of the area normally regulated by natural food
availability.
Acknowledgments : We are very grateful to: M. Yamanaka for supporting our
work from start to finish and for encouraging us ; M. Matsuda for providing his
data on birds, and for helping to trap insects; H. Okada, K. Watanabe and M.
Ohnuma for helping to capture foxes ; the staff and students of the Laboratory
of Parasitology, Hokkaido University, for collecting scats; and M. Asakawa,
150 Mammal Study 21: 1996
H. Abe, and T. Shida for advice on capturing rodents and for permission to use
their traps. We also thank Y. Ueno, K. Uraguchi, T. Ikeda, and anonymous
referees for reading our draft manuscript and for their many useful comments.
S. Kaneko, and M. Brazil kindly improved the English of the final manuscript.
This study was partly funded by the Sasakawa Scientific Research Grant from
The Japan Science Society, and by Shari Town, Hokkaido.
REFERENCES
Abe, H. 1975. Winter food of the red fox, Vulpes vulpes schrencki Kishida (Carnivora: Canidae), in
Hokkaido, with special reference to vole populations. Appl. Ent. Zool. 20:40—51.
Ables, E. D. 1975. Ecology of the red fox in North America. Jn (M. W. Fox ed.) The Wild Canids:
Their Systematics, Behavioral Ecology and Evolution. pp. 216—236.
Calisti, M., B. Ciampalini, S. Lovari and M. Lucherini. 1990. Food habits and trophic niche variation
of the red fox Vulpes vulpes (L., 1758) in a Mediterranean coastal area. Rev. Ecol. 45: 309—
320.
Doncaster, C. P., C. R. Dickman and D. W. Macdonald. 1990. Feeding ecology of red foxes ( Vulpes
vulpes) in the city of Oxford, England. J. Mamm. 71: 188—194.
Englund, J. 1965. Studies on food ecology of the red fox (Vulpes vulpes) in Sweden. Viltrevy 3:
SO — ABs
Englund, J. 1969. The diet of fox cubs (Vulpes vulpes) in Sweden. Viltrevy 6:1—39.
Goszczynki, J. 1974. Studies on the food of foxes. Acta Theriol. 19:1—18.
Goszczyniki, J. 1986. Diet of foxes and martens in Central Poland. Acta Theriol. 31: 491—506.
Harris, H. 1978. Age determination in the red fox (Vulpes vulpes) - an evaluation of technique
efficiency as applied to a sample of suburban foxes. J. Zool., Lond. 184 :91—117.
Jedrzejewski, W. and B. Jedrzejewski. 1992. Foraging and diet of the red fox Vulpes vulpes in
relation to variable food resources in Bialowieza National Park, Poland. Ecography 15:
DA D— LA.
Kondo, N., K. Takahashi and K. Yagi. 1986. Winter food of the red fox, Vulpes vulpes schrencki
Kishida, in the endemic area of multilocular echinococcosis. The memoirs of the Preparative
Office of Nemuro Municipal Museum 1: 23—31 (in Japanese with English abstract).
Kruuk, H. 1989. The Social Badger: Ecology and Behaviour of a Group-Living Carnivore (Meles
meles). Oxford University Press, Oxford, 155 pp.
Lloyd, H.G. 1980. The Red Fox. B. T. Batsford Ltd, 320 pp.
Lucherini, M. and G. Crema. 1994. Seasonal variation in diet and trophic niche of the red fox in an
Alpine habitat. Z. Sdeugetierkunde 59:1—8.
Macdonald, D. W. 1977. On food preference in the red fox. Mammal. Rev. 7:7—23.
Macdonald, D. W. 1987. Running with the Fox. Unwin Hyman, London and Sydney, 224 pp.
Misawa, E. 1979. Change in the food habits of the red fox, Vulpes vulpes schrencki Kishida,
according to habitat conditions. J. Mammal. Soc. Jap. 7: 311—320 (in Japanese with English
abstract).
Nakagawa, H. 1985. Birds of Shiretoko. Shiretoko Museum, Shari, 24 pp. (in Japanese).
Nakazono, T. 1994. A study on the social system and habitat utilization of the Japanese red fox,
Vulpes vulpes japonica. Ph. D. thesis, Kyushu Univ., 73 pp.
Sargeant, A.B., S.H. Allen and R. T. Eberhardt. 1984. Red fox predation on breeding ducks in
mid-continent North America. Wildl. Monog. 89:1—41.
Sequiera, D. M. 1980. Comparison of the diet of the red fox (Vulpes vulpes L., 1758) in Gelderland
(Holland), Denmark and Finnish Lapland. Biogeographica 18: 35—51.
Tsukada, H. 1994. A study of the ecology of foxes in Shiretoko National Park and their utilization
for nature education programs. Bull. Shiretoko. Mus. 15:63—82 (in Japanese with English
abstract).
Watanabe, K. 1996. A study on the coexistence of the red fox in Hokkaido with humans. Ms thesis,
Tsukada and Nonaka, Human food utilization by red fox 51
Faculty of Letters, Hokkaido Univ., 128 pp. (in Japanese).
Watanabe, K. and H. Tsukada. 1996. A survey on the history of provisioned foxes and on attitudes
of travel agents to the provisioned foxes in Shiretoko National Park. Bull. Shiretoko Mus.
16: 11—24 (in Japanese).
Yabe, T. 1995. A fundamental study on habitat management for wildlife : habitat use of Sika deer
and a change in the vegetation on Shiretoko Peninsula, Hokkaido. Research Bulletin of the
Hokkaido University forests 52:115—175 (in Japanese with English abstract).
Yoneda, M. 1982. Influence of red fox predation upon a local population of small rodents II. food
habit of the red fox. Appl. Ent. Zool. 17: 308—318.
Yoneda, M. 1983. Influence of red fox predation upon a local population of small rodents III.
Seasonal changes in predation pressure, prey preference and predation effect. Appl. Ent. Zool.
1} 2 LL=I0,
(accepted 22 January 1997)
=: iss “pee
2S. ee
1
4
5 z
i i
i
(ee
ret ‘
ae
Se
x
f
‘7
>
a) he
vk
3
"A
Mammal Study 21: 153-159(1996)
© the Mammalogical Society of Japan
Short Communication
Conception dates of Sika deer on the Boso Peninsula,
central Japan
Masahiko ASADA and Keiji OCHIAI’
Laboratory of Forest Zoology, Faculty of Agriculture, University of Tokyo, Yayoi 1-1-1, Bunkyo-ku,
Tokyo 113, Japan
‘Natural History Museum and Institute, Chiba, Aoba-cho, Chuou-ku, Chiba 260, Japan
Fax. 03-5800-6895, e-mail. QZE16660 @ niftyserve. or. jp
The seasonal characteristics of mammalian reproduction are partly related to
the seasonal dietary conditions of the species concerned (Lincoln 1985, Sadleir
1987, Bronson 1989). Birth and lactation of herbivores typically occur in
spring in conjunction with the peak in available vegetation (Bronson 1989).
Since this seasonal pattern of food availability varies with latitude, breeding
seasons also vary with latitude in, for example, mountain sheep (Bunnell 1982),
reindeer (Leader-Williams 1988) and deer of the genus Odocoileus (Bronson
1989).
The range of the Sika deer (Cervus nippon Temminck) extends along the
Asian coastline of the Pacific Ocean from virtually the sub-tropical (14°N) to
the sub-arctic regions (50°N) (Ohtaishi 1986, Whitehead 1993). As a conse-
quence, the breeding season of this species is expected to differ at the different
latitudes of the great length of its range. So far, however, details of the
breeding season of Sika deer have only been reported from Hokkaido (43.5°N,
Suzuki et al. 1996), Hyogo Prefecture (35°N, Koizumi 1991), and Nara Park
(34.4°N, Miura 1984), and more wide-ranging researches are required to eluci-
date the situation more fully. Here we report an examination of the concep-
tion dates of Sika deer on the Boso Peninsula in central Japan (35°N).
STUDY AREAS
The study area, of 124 km’, ranges in elevation from sea-level to 300m
above sea level, consists of steep slopes, and is located in Chiba Prefecture,
central Japan (35'N, 140°E, Fig.1). The annual precipitation in the area is
2,000-2,400 mm, and the mean monthly temperature is about 4°C in mid-winter
and 25°C in mid-summer (University of Tokyo 1988). The predominant vegeta-
tion of the area consists of evergreen broad-leaved forest, primarily Machilus
thunbergit and Castanopsis sieboldii, natural coniferous forest consisting of
Abies firma and Tsuga sieboldii, and plantations of two species of conifers,
Cryptomeria japonica and Chamaecyparis obtusa.
In order to detect intra-population differences, the study area was divided
154 Mammal Study 21: 1996
The Boso
peninsula
The distribution of sika deer
The Pacific on the Boso peninsula
O
Fig.1 Study area.
into five sub-areas according to deer density (Fig. 1): the high density AT area
where there were 22.4-37.9 deer/km?, and the lower density KG, KU, OT and
KT areas where there were: 14.7, 0.9, 1.1-5.7, and 6.7-8.4 deer/km?, respectively
(Chiba Prefecture and Deer Research Group on Boso 1993).
MATERIALS AND METHODS
Female Sika deer on the Boso Peninsula are regularly culled, as a means
of pest control. From such specimens we collected 180 fetuses in January and
February 1993, February and March 1994, and February and March 1995. The
ages of pregnant deer were determined by tooth replacement and by counting
the cementum layers of the first incisors (Ohtaishi 1980).
The crown-rump length (CRL) of each fetus was measured to the nearest
millimeter and the gestational age was estimated from the linear regression
formula proposed by Koizumi (1991):
Y =50.23+0.42X
where X equals CRL (mm) and Y equals gestational age (days). This equation
is based on a mean gestation period of 234 days and a body length at parturition
of 440 mm as found for the deer population of the Tanzawa Mountains, central
Japan (limura 1980). On the Boso Peninsula, the mean gestation period was
found by Nakajima (1929) to be 235 days. The mean shoulder height + SD of
Asada and Ochiai, Conception dates of Sika deer on Boso 155
adult females in the Tanzawa Mountains was 77.8 = 6.7cm (limura 1980)
whereas on the Boso Peninsula it was 74.0 = 3.8cm (Ochiai and Asada 1995).
Since the differences between these two populations were not large, we adopted
Koizumi’s (1991) model for the Boso Peninsula. The date of conception was
estimated from the collection date and the gestational age.
RESULTS AND DISCUSSION
Sika deer conceived between 8 September and 11 December, with a median
date of 23-24 September, in all sub-areas of our Boso Peninsula study area.
The crown-rump lengths of fetuses collected from the area ranged from 28 to
318mm. In comparing the conception period on the Boso Peninsula with that
of other populations (Fig. 2), it was found to be one month earlier than in
Hokkaido, which is 10 degrees of latitude north of the Boso Peninsula (Suzuki
et al. 1996), and was about 10 days earlier than in Hyogo Prefecture (35°N,
Koizumi 1991).
The breeding season is later at more northerly latitudes in mountain sheep
(Bunnell 1982) and in reindeer (Leader-Williams 1988), because it is related to
phenological differences in dietary vegetation (Bunnell 1982). In reindeer
populations, calving occurs one month earlier per 10 degrees higher latitude
(Leader-Williams 1988), a relationship which is supported by our own study of
Sika deer. The leaves of deciduous trees on the Boso Peninsula, common
50
45 Hokkaido
aN (gy ee
40
Hyogo
[TUS
35 SS
Degree of northern latitude
1S€9, WOeo Now Waxed dein. 21 Jem
Conception periods
Fig.2 Conception periods of Sika deer in Hokkaido, Hyogo and Boso. Bars show periods,
and open circle, rectangle and solid circle indicates peaks of conceptions in Hokkaido, Hyogo
and Boso, respectively. Data for Hokkaido and Hyogo are from Suzuki ef al. (1996) and
Koizumi (1991), respectively.
156 Mammal Study 21: 1996
browse of the deer, begin to develop from early April to early May whereas in
Hokkaido they develop from early May to mid May (Watanabe 1978, Sasaki
1983).
On the Boso Peninsula, local differences in the frequency distribution of
conception were recognized from late October onwards (Fig. 3). During this
period, pregnancy ratios were 16.7% in the KG, 19.2% in the KU, and 26.5% in
the OT sub-areas, though only two deer (3.2%) were pregnant in sub-area AT,
where deer density was high, and in sub-area KT, this tendency was not clear
because of the small sample size.
In Nara Park, tame Sika deer at a high population density (276 / km?)
30
AT area
N=62
20
MH 1995
1994
10 LJ] 1993
KG area
N=48
10
No. of conception
10 OT area
KT area
N=10
Early Mid. Late Early Mid. Late Early Mid. Late Early Mid.
Sep. Oct. Nov. Dec.
Conception date
Fig.3 Estimated distribution of conception date of Sika deer on the Boso Peninsula, central
Japan. Samples were collected in January and February 1993, and February and March 1994
and 1995.
Asada and Ochiai, Conception dates of Sika deer on Boso 7
conceived synchronously (Miura 1984). Koizumi (1991) thought that such
synchrony of conception was a consequence of gregariousness, a factor which
also appears to be born out by our own observations from the Boso Peninsula.
Among Cervid deer, it is known that the conception rate, in any particular
age class, is related to body weight during the rutting season. Thus, only deer
above a specific body weight threshold can conceive (Mueller and Sadleir 1979,
Hamilton and Blaxter 1980, Verme and Ullrey 1984, Sadleir 1987, Langbein and
Putman 1992). Young deer conceive later than older deer, because they
achieve this weight threshold later (Smith 1974, Hamilton and Blaxter 1980,
Suzuki et al. 1996). To examine the relationship between the age of pregnant
females and conception date, maternal age classes and conception periods were
compared (see Table 1). Although four-year-old and older deer tended to
conceive earlier than did younger deer, no significant difference was detected
(y?-test ; >0.05), 2. e. the conception period appeared to be independent of
maternal age on the Boso Peninsula. In Hokkaido, during the second half of
the conception period, only 4% of two-years-old or older females were pregnant
(Suzuki et al. 1996), whereas on the Boso Peninsula 13% of such young females
from all five sub-areas, and 18% from four sub-areas, excluding the high density
AT sub-area, were pregnant. Thus, it appears that conception among the
two-year-old and older females is less synchronized on the Boso Peninsula than
it is in Hokkaido. Since deer densities on the Boso Peninsula (with the
exception of sub-area AT) and in Hokkaido were similar, at 5.0 + 4.9 (mean
SD/km? n=10, Chiba Prefecture and Deer Research Group on Boso 1993) and
4.6 + 4.9 (n=21, Hokkaido Institute of Environmental Sciences 1995), respec-
tively, it is considered that this regional difference in conception synchrony was
not due to differences of density.
We believe that this difference results from variation in the phenology of
food plants used by the deer in different regions. It has been considered that
the optimum periods for conception and parturition are affected by the periods
of peak growth of the available vegetation (Bronson 1989). Bunnell (1982)
showed that mountain sheep at more northerly latitudes began lambing later
and lambed over a shorter duration than did sheep at more southerly latitudes,
and that the timing of lambing was determined primarily by forage quality and
quantity.
As mentioned above, spring leaf growth occurs approximately one month
earlier on the Boso Peninsula than in Hokkaido. In Hokkaido, deciduous trees
change color in autumn from late September onwards (Sasaki 1983), whereas
they do so from mid-October onwards on the Boso Peninsula (Watanabe 1978).
Furthermore, the first snows of winter occur from November onwards in
Hokkaido, whereas little snow falls at all on the Boso Peninsula. Sika deer on
the Boso Peninsula can continue to eat evergreen leaves from fall to winter
(Asada and Ochiai 1996). Therefore, the duration of the optimum period for
parturition seems to be longer, and synchrony seems to be weaker on the Boso
Peninsula than in Hokkaido.
158 Mammal Study 21: 1996
REFERENCES
Asada, M. and K. Ochiai. 1996. Food habits of sika deer on the Boso Peninsula, central Japan. Ecol.
Res. 11 : 89—95.
Bronson, F. H. 1989. Mammalian Reproductive Biology. Univ. of Chicago Press, Chicago, 325 pp.
Bunnell, F. L. 1982. The lambing period of mountain sheep: synthesis, hypotheses and tests. Can.
le Zoolno0 alae
Chiba Prefecture and Deer Research Group on Boso. 1993. Science Report on the Management of
Sika Deer on Boso Peninsula, Chiba Prefecture, 1., Chiba, 48 pp. (in Japanese)
Hamilton, W.J. and K.L. Blaxter. 1980. Reproduction in farmed red deer. 1. Hinds and stag
anlar, Ie Acne, Sen, Cara), $5 2 ZOl—= F733.
Hokkaido Institute of Environmental Sciences. 1995. Reports on the Status of Brown Bear and Sika
Deer in Hokkaido. Hokkaido Government, Sapporo, pp. 164 (in Japanese)
limura, T. 1980. An ecological study on the Japanese deer, Cervus nippon cetralis, in the Tanzawa
mountains from the view point of forest protection. Dainippon-sanrinkai, Tokyo, 154 pp. (in
Japanese with English summary)
Koizumi, T. 1991. Reproductive characteristics of female Sika deer, Cervus nippon, in Hyogo
Prefecture, Japan. Ongules/Ungulates 91 : 561—563.
Langbein, J. and R. Putman. 1992. Reproductive success of female fallow deer in relation to age and
condition. Jv (R.D. Brown, ed.) The Biology of Deer. pp. 293—299. Springer-Verlag, New
Wonks
Leader-Williams, N. 1988. Reindeer on South Georgia. Cambridge Univ. Press, New York, 319 pp.
Lincoln, G. A. 1985. Seasonal breeding in deer. Jn (P. F. Fennessy and K. R. Drew ,eds.) Biology of
Deer Production. Roy. Soc. New Zeal., Bull. 22: 165—179.
Miura, S. 1984. Annual cycles of coat changes, antler regrowth, and reproductive behavior of sika
deer in Nara Park, Japan. J. Mamm. Soc. Japan 10:1—7.
Mueller, C.C. and R.M.F.S. Sadleir. 1979. Age at first conception in black-tailed deer, Biol.
Reprod.21 : 1099-1104.
Nakajima, M. 1929. Experimental report of penned sika deer at the University Forest, Chiba. Misc.
Inform. Tokyo Univ. For. 8: 95—114. (in Japanese)
Ochiai, K. and M. Asada. 1995. Growth in the body size of sika deer (Cervus nippon) on the Boso
peninsula, central Japan. J. Nat. Hist. Mus. Inst., Chiba 3 : 223—232. (in Japanese with English
summary)
Ohtaishi, N. 1980. Determination of sex, age and death-season of recovered remains of Sika deer by
jaw and tooth-cement. Koukogaku To Sizenkagaku 13:51—74. (in Japanese)
Ohtaishi, N. 1986. Preliminary memorandum of classification, distribution and geographic variation
on Sika deer. Honyurui Kagaku [Mammalian Science] , 53:13—17. (in Japanese)
Sasaki, C. 1983. Phenology of woody plants and temperatures in central Hokkaido. Review of
Forest Culture 4:77—86. (in Japanese)
Sadleir, R. M.F.S. 1987. Reproduction of female cervids. Jn (C.M.Wemmer, ed.) Biology and
Management of the Cervidae. pp. 123—144. Smithsonian Inst. Press, Washington, D. C.
Smith, M.C. T. 1974. Biology and management of the Wapiti (Cervus elaphus nel/sont) of Fiordland,
New Zealand. Wellington, New Zealand: New Zealand Deer Stalkers Association.
Suzuki, M., K. Kaji, M. Yamanaka and N. Ohtaishi 1996. Gestational age determination, variation
of conception date, and external fetal development of sika deer (Cervus nippon yesoensis
Heude, 1884) in Eastern Hokkaido. J. Vet. Med. Sci. 58: 505—509.
University of Tokyo. 1988. An Outline of the University Forest in Chiba 1988 , Chiba, 44 pp. (in
Japanese)
Verme, L. J. and D.E. Ullrey. 1984. Physiology and nutrition. Jn (L.K. Halls, ed.) White-tailed
Deer Ecology and Management. pp. 91—118. Stackpole Books.
Watanabe, R. 1978. Seasonal division based on the phenological records in two different climatical
Asada and Ochiai, Conception dates of Sika deer on Boso 159
regions of Japan. Bull. Inst. Nature Educ. Shiga Heights, Shinshu Univ. 17 : 19—32.
Whitehead, G. K. 1993. Encyclopedia of Deer. Swan Hill Press, Shrewsbury, 597 pp.
(accepted 7 January 1997)
a
ie
a
a]
#2 '
‘i ;
‘ A
ee i , =
4 - A i j 4
oY = 7 * =
; E : j Sign = ;
3 an Fe 4 * r t J ‘irs
spe oS “ ; 4! = Y = v >
i 2 z Sn BBY LS Magli 7
+ = Tso ‘ Law
‘ = e < = ies
a 4 “yet 7 >i 3 = js
t re = We
oe) on ae _ : as
reesei 5 Ltn ; :
5 z Tes ¥ 4 (ae
ae af : i ee
= - : rer ; t q i pe
1 La 7 q a q = >, .
Sir ok oe ~ 1 3
E 4
aes ;
Ss o , t i } i ( J
sof : { F ; ee
as : ; : s
= f € hoe iy a
a4
= Som ne = a es =
m3 - Nie Z
= es ¥ =
i “a
ey - : le
z 2 DP sna z
- ice ‘ A a =) y
= i)
~ oj i S \ &
{ + - F
‘ 2 om 8
5 ~ ‘ 2
) 2 ee = yi
; : or aoe : - a?
: ‘ =. ces a ee
oa = Z —_ y -
1 —) = ‘
< Fi !
Peo y
- } ‘ fe ‘ *
¢ othe ‘ a.
4 Ya ”) tz
Fi aay 2
\ 2 ~ ' Z
c p) = = a
2 ai 5 Ae = Bi
~ t 7 = y
~ < Ps ?
a—)\ Z
Jt -
3 S es
+ ; }. —— ~
5 } /
> A yi ¥
he Ho = + 3
- = n 1 - = ;
rae , oa a ee
i 4 = * pone ; ; = {
os “ a)
hes .
= = = E Fis)
1 - Need) x >
~ 5 ~ we Sot
x o ae
J he y
a = 3
ol ‘ i y : 4
ig és , ?
ai a /
= 5 ‘ Dive < 7
Mammal Study”. We hope and trust that
Dr Abe and Dr Shiraishi, though retiring from their university positions, will,
however, continue in encouraging and guiding the work of younger generations
of scientists for many more years to come.
REFERENCES
Abe, H. 1967. Classification and biology of Japanese Insectivora (Mammalia) I. Studies on variaion
and classification. J. Fac. Agr. Hokkaido Univ. 55: 191—265.
Abe, H. 1968. Classification and biology of Japanese Insectivora (Mammalia) II. Biological aspects.
J. Fac. Agr. Hokkaido Univ. 55 : 429—458.
Abe, H. 1982. Ecological distribution and faunal structure of small mammals in central Nepal.
Mammalia 46 : 477—503.
Abe, H. 1996. Habitat factors affecting the geographic size variation in Japanese moles. Mammal
Swuchy Zils V1=87.
4
Abe, H.N. Ishii, Y. Kaneko, K. Maeda, S. Miura, M. Yoneda. 1994. A Pictorial Guide to the Mam-
mals of Japan. Tokai Univ. Press. (in Japanese)
Abe, H., S. Shiraishi and S. Arai. 1991. A new mole from Uotsuri-jima, the Ryukyu Islands. J.
Mammal. Soc. Japan 15: 47—50.
Ando, M., S. Shiraishi and T. A. Uchida. 1985. Feeding behaviour of three species of squirrels.
Behaviour 95: 76—86.
Ando, A., S. Shiraishi and T. A. Uchida. 1990. Reexamination on the taxonomic position of two
intra-specific taxa in Japanese EKothenomys : Evidence from cross breeding experiments (Mam-
ooubiey S Inoelemtine), “Zool, Sen, 72 14145;
Hasegawa, H., S. Shiraishi and Rochman. 1992. Tikusnema javaense n, gen., n. sp. (Nematoda:
Acuarioidea) and other nematodes from Rattus argentiventer collected in West Java, Indonesia.
J. Parasit. 78 : 800—804.
Kakuda, H., T. Mori and S. Shiraishi. 1992. Functional morphology of Gene’s organ in Haema-
physalis longicornis (Acari: Ixodidae). Exp. Appl. Acar. 16 :63—275.
Koga, K.and S. Shiraishi. 1994. Parent-offspring relations during the post-fledging dependency
period in the Black Kite (Milvus migrans) in Japan. J. Raptor Res. 28: 171—177.
Lin, L. -K., T. Nishino and S. Shiraishi. 1993. Postnatal growth and development of the Formosan
wood mouse Apodemus semotus. J. Mammal. Soc. Japan 18:1—18.
Min, B. Y., K. Honda, R. Tatsukawa and S. Shiraishi. 1984. Biometry of growth and food habits of
young of the Eastern great white egret, Egretta alba modesta, in Korea. J. Fac. Agr. Kyushu
Universo) 235-33.
Ohdachi, S., R. Masuda, H. Abe, J. Adachi, N.E.Dokuchaev, V. Hasegawa, H., S. Shiraishi and
Rochman. 1992. Tikusnema javaense n, gen., n. sp. (Nematoda: Acuarioidea) and other
nematodes from Rattus argentiventer collected in West Java, Indonesia. J. Parasit. 78 : 800—
804.
Okura, N., S. Shiraishi and T. A. Uchida. 1984. Karyotypes of the Japanese harvest mouse (M-
cromys minutus japonicus) from Fukuoka and Tsushima Islands. J. Fac. Agr. Kyushu Univ.
U2 MW Moss
Yamada, F., S. Shiraishi, A., Taniguchi and T. A. Uchida. 1990. Growth, development and age
determination of the Japanese hare, Lepus brachyurus brachyurus. J. Mammal. Soc. Japan 14:
= Ws
Yoshinaga, Y.and S. Shiraishi. 1997. Growth, development, and reproductive patterns in the
Japanese field vole, Microtus montebelli. J. Mammal. 78 : 830—838.
Seiki TAKATSUKI (Editor-in-chief), Takashi SAITOH and Takanori MORI
Mammal Study 22: 5-10 (1997)
© the Mammalogical Society of Japan
Cross-species amplification of microsatellite DNA in
Old World microtine rodents with PCR primers
for the gray-sided vole, Clethrionomys rufocanus
Yasuyuki ISHIBASHI’, Takashi SAITOH’, Syuiti ABE?’, and Michihiro C. YOSHIDA’
1 Chromosome Research Unit, Faculty of Science, Hokkaido University, North 10, West 8, Kita-ku,
Sapporo O60, Japan
Fax. +81-11-736-6304, e-mail. stone @ees. hokudai. ac. jp
2 Wildlife Management Laboratory, Hokkaido Research Center, Forestry and Forest Products Research
Institute, Hitsujigaoka 7, Toyohira-ku, Sapporo O62, Japan
3 Laboratory of Cytogenetics, Graduate School of Environmental Earth Science, Hokkaido University,
North 10, West 5, Kita-ku, Sapporo O60, Japan
Abstract. Applicability of seven primer sets, originally designed
for polymerase-chain-reaction (PCR) amplification of microsatel-
lite DNA in the gray-sided vole, Clethrionomys rufocanus, was
examined in other 12 microtine species from three genera (Cleth-
rionomys, Eothenomys and Microtus). Of the primer sets used, one
distinctly amplified PCR products in all the species examined.
Three sets gave PCR products in all but one species. The remain-
ing three sets failed to amplify any products in several species.
Non-amplification occurred mostly in Microtus species, although
two primer sets were not available for two Clethrionomys species.
Since most amplified loci showed allelic variations, the present
primers are useful for molecular ecological studies of related
microtines, especially Clethrionomys and Eothenomys species.
Key words. Clethrionomys, Eothenomys, microsatellites, Microtus, PCR
primer.
Microsatellite loci, which consist of tandem repeats of short DNA sequence
motif ($5 base-pairs), are highly variable in repeat number, thereby providing
an excellent molecular marker for both ecological and population genetic
studies (Burke et al. 1992, Queller et al. 1993). Genotyping at microsatellite
loci facilitates assessment of paternity (Morin et al. 1994b, Sillero-Zubiri et al.
1996) or relatedness (McDonald and Potts 1994, Blouin ef al. 1996, Ishibashi et
al. 1997), and also allows to summarize the genetic structure within or among
populations (Morin ef al. 1994a, Paetkau et al. 1995, Lade et al. 1996).
Microsatellites can be amplified from a minute amount of DNA using the
polymerase chain reaction (PCR) technique (Litt and Luty 1989, Tautz 1989,
Weber and May 1989). Hair roots (Washio 1992, Morin et al. 1994a), bones
(Taberlet and Fumagalli 1996) or feces (Tikel et al. 1996) can all be used as
sources of DNA, if necessary. PCR-based analysis has a great advantage over
conventional allozyme analysis, because of the high resolution and because
6 Mammal Study 22: 1997
sample collection is none, or less, invasive.
Microsatelites are thought to be localized in rapidly evolving non-coding
regions, and hence cross amplification is generally restricted to closely related
species (Schlétterer et al. 1991, Coltman et al. 1996, Kayser et al. 1996, Valsec-
chi and Amos 1996). In this study, a cross-species microsatellite amplification
was conducted in 12 species of Old World microtine rodents. Seven primer sets
originally designed for the gray-sided vole, Clethrionomys rufocanus, in Hok-
kaido, Japan, were used. So far microsatellite loci have not been cloned in
other microtines, thus cross amplification could justify the applicability of these
microsatellite primers in the species examined.
MATERIALS AND METHODS
Seven microsatellite primer sets, designed for Clethrionomys rufocanus in
Japan, were used in this study (Table 1). They consisted of primer sets for five
loci previously cloned, MSCRBs-1 to -5 (Ishibashi et al. 1995), and two further
loci, MSCRBs-6 and 7, newly cloned from the C. rufocanus genomic library and
sequenced as described by Ishibashi et al. (1995). One of the paired primers
was newly designed for two loci, MSCRBs-2 and -5, so as to shorten the size of
PCR product. For MSCRB-3, one of the paired primers was also redesigned so
as to avoid non-amplification which is caused by base substitutions near the
CA- and GA-repeats (Ishibashi ef al. 1996). Cross-species amplification was
performed using one to six individuals from each of 12 species from the three
genera, Clethrionomys, Eothenomys and Microtus (Table 2). Three Cleth-
rionomys species captured in three widely different localities, Japan, Finland
Table 1. Microsatellite primer sets used in this study, including those for the previously
described loci, MSCRBs-1 to 5 (Ishibashi et a/. 1995) and newly cloned loci, MSCRBs-6 and -7.
Locus Repeat structure? Primers (5’-3’) TA° Product size‘
MSCRB-1 (AC)po4 AGTGTTTGGAAGCCATGCGGTA 58 150-270
CAGGAGCTTCATGGCTGGAATA
MSCRB-2 (AC),; with several AAGGGTGAGTATGCCAATCA 48 100-200
short AC-repeats TCTCAGATTCTGTGATATGCTGTC!
MSCRB-3 (CA),9(GA)o, CATGACCTTCTATTTCTGTCAG 48 250-350
CTCTAGCATGATGTTACTGT?
MSCRB-4 (CA)ao GTGCTGCTTACTGGCTTCTTGT 60 70-130
CCTGAGTTGTATAAGAAAGCAGGC
MSCRB-5 a mixture of CA-, ATAC- GGTTGGTGTTTGCATTTAGG 54 130-230
and ATGT-repeats CGTCTGGGTTTTACATCTGA?
MSCRB-6 = (AC),.(AG),5 TATAATAGATTTGAGTATCTGC 52 150-220
GATGTCCATCAAGTTAATCGT
MSCRB-7 (AC)ao GTTTTATGTTAGTCTCATCTG 52 80-150
AGGCAATCCTGGTGAGTAACA
4Nucleotide sequence of the clones obtained from the Japanese C. rufocanus genomic DNA
library, "Annealing temperature in PCR (°C), “Estimated PCR product size for all the species
examined in this study (in base-pairs), “The primer sequence differed from that previously
described by Ishibashi et al. (1995).
Ishibashi et al. Cross-species amplification of microsatellite DNA in microtines
-A10}e10qe'T, ‘([feJap 1OFJ 1X9} JIS) S[TENPIAIPUI BUIOS UI UOT} eoTfI[duIe-uON, ‘orydsourAjod : + ‘orydsowououl
‘speumlue poiq
>— ‘0I—-V | ‘e1nj}e10dule} Suljyeouue
JOMO] 7 poljijdwue : 7 (7 s[qe L 9es) VL “einjzesoduie} suljeouue 1sysiy je porjijdure : Fy ‘(4vowis 10 jOnpo.id ou) poryijdure jou :(¢ ‘ suoNelAsiqgy,
‘pozA[eue STENPIAIpUl JO JaequUINN, ‘S19y}0 [[B 1OJ (T1661) [[}H Pue Joqiog pue soloeds ssouedef 10J (PG6I) “7M 72 VQY MOT[OJ soureuU sordeds,
a / Jl
+/H
0
= fle
+/H
= / i
ar / JE
+/H
sig dl
ae//Je
+/H
0
0
0
0
0
+/H
sey Jal
az / lal
LAYMOSIN 9AYXOSIN SAYOSIN FAYNOSIN € ANOS @AYNOSW T-aeOSIN
ar (Jel
= (Tel
s/s
+/H
+/H
= (Jal
axial
+/H
+/H
+/H
+/H
ae ul
+/H
al
Jel
/ Jl
= Jab
4-/ Jal
a/ 18
aP/ Jel
atoy/alell
e/a
ae //15l
+/H
+/H
+/H
= Tel
yall
sora
p—/H
p= IE
st
e/a
= 4
“//18
a" Jel
0
+/H
=) al
apy tel
+/H
a / Fel
ay / tel
sip el
+/H
= / Jel
ai / Tel
+/H
ate / sted
aig? Jel
+/H
0
0
cial
17/4
Pf Jel
—// 18
8
sig bel
se// 1
a // tel
a Jel
+/H
ary lel
shoo]
+/H
0
af 1
+/H
“P// lal
+/H
ap / 18
+/H
+/H
+/H
e/a
a/b
gor Ale
a ala
sl
sP/ Jal
+/H
gael
aA
0
= sl
=
+/H
=A
= 1
0
an a
0
sF/
ate tal
ay tal
J BSD EO oe Mes) Mee) se) Mis SNe SMO) SO) Ne) 6 Me) Oo ool) Seal GN ral sn
Ke)
aN
sAPMION
SSIMS
URAL |
UeMIE TL
SPUPR[IOUION IL
wedEif
ealoy
uede(
(Us Iry) uedef
(nyoyo ,,) uedef
uede[
sAP MIO N
Pue ier
,uede[
sAPM1O NI
Por eel
sAPMION
PU er
uedef
uol}e007T
SNULOU0IAO “WV
Sypaiu
AAJSDGOUDIAUL “J
CUGIIES SLIM
SYDAAD “JW
YJaqaquou “py
SUINGOA “FT
MORES. Gi
1UOSAAPUD “A
XOL “D)
SNUYNA “Dd
SNJOOAD]S “DI
SNUDIOJNA “DJ
psd100dS
SNJOLIU
SAMOUaYIOT
SKULOUOILYIA])
snudsy
‘SIOUILId 9}I[[O}BSOIDIUL SNUDIO{NA “J JO SATed UBAVS YIM UOTVeOTFI[duIe SaIdedS-SssO1D °Z VIGe
8 Mammal Study 22: 1997
and Norway, were also examined for a possible variation in the applicability of
these microsatellite primers (Table 2). DNA was isolated from each animal
using the conventional phenol/chloroform method (Sambrook ef al. 1989).
The PCR amplification was carried out in 10 wl of reaction mixture
containing 50 mM of KCl, 1.5mM of MgCl,, 10 mM of Tris-HCl (pH 8.3), 0.2 mM
of dNTP, 0.25 uM of each primer, and 0.25 unit of Tag DNA polymerase
(TaKaRa). About 30 ng of genomic DNA was used for each reaction. After
denaturation at 93°C for two minutes, the reaction was carried out for 30 cycles
under the following conditions using a DNA Thermal Cycler PJ2000 (Perkin
Elmer Cetus) ; 93°C for 30 sec, TA°C (see Table 1) for 20 sec, and 72°C for 20 sec.
TA of each primer was optimized to amplify apparent PCR products in
Japanese C. rufocanus after calculating with the formula: 69.3+0.41 x (% of GC
content) —650/(primer length) (Mazars eft al. 1991). When amplification failed
in species other than Japanese C. rufocanus, lower annealing temperature by
10°C, z.e., TA—10, was adopted so as to allow for mismatches in the primer
sequence in the subsequent trials.
The PCR products were electrophoresed in a 3% agarose gel and an 8%
non-denatured polyacrylamide gel in order to examine the results of amplifica-
tion and allelic variation. When amplification in a species did not result in any
products, or showed only a smearing pattern, under the above PCR conditions,
the result was categorized as “not amplified”. If all individuals examined
showed a single band only, such a species was categorized as “monomorphic”.
If two bands of similar size and amount were apparent in one or more individ-
uals, then the species was categorized as “polymorphic”.
RESULTS AND DISCUSSION
Of seven microsatellite primer sets used, one provided apparent PCR
products in all twelve species examined (MSCRB-5, Table 2). Three sets
(MSCRBs-2, -4 and -6) gave products in all but one species. The remaining sets
(MSCRBs-1, 3 and 7) failed to amplify any products in several species (See
Table 2). When amplification was performed with the primer set for MSCRB-
3 under the lower annealing temperature, ladder-like band patterns were
observed from low to high molecular weight regions. Despite the many spuri-
ous bands, we categorized them as “amplified” if the ladder included an
apparent band(s) of the molecular size similar to other microtines’ products.
Non-amplification occurred mostly in Microtus, although no apparent product
was amplified with the MSCRBs-1 and -7 primers in either C. rutilus or C.
glareolus. In all Eothenomys species, products were obtained from all seven
primer sets under higher or lower annealing temperature (Table 2).
Non-amplification of microsatellite loci may occur as a result of nucleotide
sequence variation (e.g., base substitution, deletion and/or addition) within the
priming site for PCR amplification. Therefore, the observed non-
amplifications could be due to variation within the priming sequences.
Furthermore, in the present study, no PCR products were observed in five of ten
Ishibashi et al. Cross-species amplification of microsatellite DNA in microtines 9
Scandinavian C. rufocanus at MSCRB-5 (Table 2). Since allelic variation at
the locus is very small in Japanese C. vufocanus (Ishibashi et al. 1995), these five
individuals may be homozygous for a non-amplifying (null) allele with sequence
variations in the priming site. Although such null alleles were not detected in
microtines oher than the Scandinavian C. vufocanus, it is clearly important to
pay attention to the possible presence of null alleles especially when using
heterologous microsatellite primers (Paetkau and Strobeck 1995, Pemberton et
al. 1995).
Despite the allelic variation in most amplified loci in each species, interpre-
tation must be made with some caution. In the present study, “polymorphic”
and “monomorphic” species are arbitrarily defined on the basis of the number
of alleles (bands) in the limited number of DNA samples examined (Table 2).
For C. rufocanus, C. glareolus, C. rutilus and M. oeconomus from Norway, and
C. rutilus from Japan, the DNA samples used were extracted from laboratory-
bred individuals (Table 2). These animals might have lost heterozygosities at
some loci by chance during laboratory breeding. “The observed monomorphic
band patterns at several loci may not, therefore, indicate the real situation in
natural populations.
The present study, though preliminary in nature, demonstrates that most
PCR primer sets for C. vufocanus microsatellites are useful for detecting allelic
variations in related microtines, especially in Clethrionomys and Eothenomys
species. Given the small sample size and the non-systematic collection, further
examinations are required to clarify the presence of null alleles and of allelic
variation in each population or species of interest.
Acknowledgments : We are grateful to Dr. H. Suzuki for generously providing
DNA and Drs. N.C. Stenseth, H. Henntonen and K. Takahashi for kindly pro-
viding tissue samples. Particular thanks go to Professor Hisashi Abe for
critically reviewing the manuscript.
REFERENCES
Abe, H., N. Ishii, Y. Kaneko, K. Maeda, S. Miura and M. Yoneda. 1994. A Pictorial Guide to the
Mammals of Japan. Tokai University Press, Tokyo, pp. 195 (in Japanese).
Blouin, M.S., M. Parsons, V. Lacaille and S. Lotz. 1996. Use of microsatellite loci to classify individ-
uals by relatedness. Mol. Ecol. 5: 393—401.
Burke, T., W. E. Rainey and T. J. White. 1992. Molecular variation and ecological problems. Jn (R.
J. Berry, T. J. Crawford and G.M. Hewitt, eds.) Genes in Ecology. pp. 229—254. Blackwell
Scientific Publications, Oxford.
Coltman, D. W., W. D. Bowen and J. M. Wright. 1996. PCR primers for harbour seal (Phoca vitulina
concolour) microsatellites amplify polymorphic loci in other pinniped species. Mol. Ecol. 5:
GIL WMOS
Corbet, G. B. and J. E. Hill. 1991. A World List of Mammalian Species. 3rd ed. Oxford University
Press, Oxford, 243 pp.
Ishibashi, Y.,T. Saitoh, S. Abe and M. C. Yoshida. 1995. Polymorphic microsatellite DNA markers in
the grey red-backed vole Clethrionomys rufocanus bedfordiae. Mol. Ecol. 4:127—128.
Ishibashi, Y., T. Saitoh, S. Abe and M. C. Yoshida. 1996. Null microsatellite alleles due to nucleotide
10 Mammal Study 22: 1997
sequence variation in the grey-sided vole Clethrionomys rufocanus. Mol. Ecol. 5:589—590.
Ishibashi, Y., T. Saitoh, S. Abe and M. C. Yoshida. 1997. Sex-related spatial kin structure in a spring
population of grey-sided voles Clethrionomys rufocanus as revealed by mitochondrial and
microsatellite DNA analyses. Mol. Ecol. 6:63—71.
Kayser, M., H. Ritter, F. Bercovitch, M. Mrug, L. Roewer and P. Niirnberg. 1996. Identification of
highly polymorphic microsatellites in the rhesus macaque Macaca mulatta by cross-species
amplification. Mol. Ecol. 5: 157—159.
Lade, J. A., N.D. Murray, C.A.Marks and N.A. Robinson. 1996. Microsatellite differentiation
between Phillip Island and mainland Australian populations of the red fox Vulpes vulpes.
MOE IeOlo Se Gil.
Litt, M. and J. A. Luty. 1989. A hypervariable microsatellite revealed in vitro amplification of a
dinucleotide repeat within the cardiac muscle actin gene. Am. J. Hum. Genet. 44 : 397—401.
Mazars, G. -R., C. Moyret, P. Jeanteur and C. -G. Theillet. 1991. Direct sequencing by thermal asym-
metric PCR. Nuc. Acids Res. 19 : 4783.
McDonald, D. B. and W.K. Potts. 1994. Cooperative display and relatedness among males in a
lek-making bird. Science 266 : 1030—1032.
Morin, P. A., J. J. Moore, R. Chakraborty, L. Jin, J. Goodall and D. S. Woodruff. 1994a. Kin selection,
social structure, gene flow, and the evolution of chimpanzees. Science 265: 1193—1201.
Morin, P. A., J. Wallis, J. J. Moore and D. S. Woodruff. 1994b. Paternity exclusion in a community of
wild chimpanzees using hypervariable simple sequence repeats. Mol. Ecol. 3 : 469—478.
Paetkau, D., W. Calvert, I. Stirling and C. Strobeck. 1995. Microsatellite analysis of population
structure in Canadian polar bears. Mol. Ecol. 4:347—354.
Paetkau, D. and C. Strobeck. 1995. The molecular basis and evolutionary history of a microsatellite
null allele in bears. Mol. Ecol. 4:519—520.
Pemberton, J. M., J. Slate, D. R. Bancroft and J. A. Barrett. 1995. Nonamplifying alleles at micro-
satellite loci: a caution for parentage and population studies. Mol. Ecol. 4:249—252.
Queller, D.C., J. E. Strassmann and C. R. Hughes. 1993. Microsatellites and kinship. Trends Ecol.
Evol. 8: 285—288.
Sambrook, J., E. F. Fritsch and T. Maniatis. 1989. Molecular cloning: a Laboratory Manual. 2nd
ed. 9.16—9.17. Cold Spring Harbor Laboratory Press, New York.
Schlotterer, C., B. Amos and D. Tautz. 1991. Conservation of polymorphic simple sequence loci in
cetacean species. Nature 354 :63—65.
Sillero-Zubiri, C., D. Gottelli and D. W. Macdonald. 1996. Male philopatry, extra-pack copulations
and inbreeding avoidance in Ethiopian wolves (Canis simensis). Behav. Ecol. Sociobiol. 38:
SL = SA),
Taberlet, P. and L. Fumagalli. 1996. Owl pellets as a source of DNA for genetic studies of small
mammals. Mol. Ecol. 5:301—305.
Tautz, D. 1989. Hypervariability of simple sequences as a general source for polymorphic DNA
markers. Nuc. Acids Res. 17 : 6463—6471.
Tikel, D., D. Blair and H. D. Marsh. 1996. Marine mammal faeces as a source of DNA. Mol. Ecol.
5 244.57,
Valsecchi, E. and W. Amos. 1996. Microsatellite markers for the study of cetacean populations.
Mol cole srslinliaa 50:
Washio, K. 1992. Genetic identification of nonhuman primates using tandem-repetitive DNA
sequences. Jn (R.D. Martin, A. F. Dixson and E. J. Wickings, eds.) Paternity in Primates:
Genetic Tests and Theories. Implications of Human DNA Fingerprinting. pp. 53—62. Kar-
ger, Basel.
Weber, J. L. and P. E. May. 1989. Abundant class of human DNA polymorphisms which can be typed
using the polymerase chain reaction. Am. J. Hum. Genet. 44 : 388—396.
(accepted 10 March 1997)
Mammal Study 22: 11-26 (1997)
© the Mammalogical Society of Japan
Laboratory experiments on spatial use and aggression
in three sympatric species of shrew in Hokkaido,
Japan
Satoshi OHDACHI
Institute of Low Temperature Science, Hokkaido University, Sapporo O60, Japan
Fax. +81-11-706-7142, e-mail. ohdachi@bio. hokudai. ac. jp
Abstract. Aggression and the use of vertical and horizontal
space in the presence of con- or hetero-specific individuals were
investigated in laboratory for Sovex unguiculatus, S. caecutiens,
and S. gracillimus in Hokkaido, Japan. S. unguiculatus frequently
used the below floor strata of experimental cages or subterranean
burrows as their main area of activity, whereas S. caecutiens and
S. gracillimus mainly used the cage floor or the ground surface.
The presence of con- or hetero-specific individuals led to no
changes in any of the three species in the use of space, or in
behavioral patterns (active/inactive ; underground/resting/ mov-
ing on the ground surface). When two individual shrews were
introduced into two interconnected cages, they tended to remain in
separate cages, with the exception of S. gracillimus with a con-
specific. Dominance rank was highest in S. unguzculatus, interme-
diate in S. caecutiens, and lowest in S. gracillimus. S. caecutiens
attacked S. gracillimus most frequently and S. gracillimus received
attacks from S. caecutiens most frequently. The implication of
this research is that severe interference competition may occur in
the field between S. caecutiens and S. gracillimus.
Key words: coexistence, interference competition, niche shift, surface activity,
underground activity.
Sorex unguiculatus, S. caecutiens, and S. gracillimus are three common species
of shrew occurring throughout Hokkaido. When S. caecutiens and S. gracil-
limus occur together, they are never the two most abundant species (Ohdachi
and Maekawa 1990a, Ohdachi 1995a). Ohdachi (1995b) confirmed that S.
caecutiens-and S. gracillimus share a greater similarity in their diets than do
either of these species and S. unguiculatus. These findings indicate that inter-
specific competition is likely to be more severe between S. caecutiens and S.
gracillimus. Further, S. unguiculatus is a much stronger burrower than either
of the other two species (Ohdachi 1995c). It is suspected, therefore, that severe
interference for space exists between S. caecutiens and S. gracillimus.
There is the potential for a niche shift by one species, when in the presence
of the other, that could influence the outcome of competition. If both species
exhibit interference competition, but neither of them changes any of its niche
12 Mammal Study 22: 1997
dimensions, then the physically superior individual or species may exclude the
inferior individual or species from good habitat or a good position (e.g., Hardin
1960, Schoener 1975, Werner and Hall 1976, Holbrook 1979, Parker and Suther-
land 1986, Alatalo and Moreno 1987, Arthur 1987). In such cases, aggressive
behavior and physical superiority are essential keys for guild formation, and
thus make it interesting to investigate whether individuals change their use of
space (or niche) in the presence of other individuals.
For cryptic species whose life histories are poorly known, such as the
shrews of Hokkaido, it is difficult to carry out extensive field studies of space
use and interactions. Ohdachi (1992) described the home ranges of sympatric
shrews in Hokkaido, but was only able to present limited information about
interspecific interactions because of the difficulties in observing them directly.
Therefore, the alternative means of investigating direct interactions in the
laboratory was chosen for this study. Although the reality of simulated
situations, particularly in the scaling of time and space, is questionable (Bennett
1990), the results obtained from laboratory experiments can, nevertheless,
complement those from field studies (Diamond 1986, Hairston 1989, Keddy
1989).
This paper serves to describe: (1) interspecific differences in the use of
space, (2) interspecific interactions such as aggressive behavior, and (3) the
impact of the presence of another individual on the use of activity space and on
behavioral patterns, in S. unguiculatus, S. caecutiens, and S. gracillimus in
Hokkaido. For these purposes, two different laboratory experiments were
conducted.
MATERIALS AND METHODS
1. Experiment 1
The first experiment was designed mainly to examine the effects of the
presence of con- or hetero-specific individuals on vertical space use. Animals
used in this experiment were nine S. unguiculatus (5 young males, 4 young
females), eight S. caecutiens (1 adult male, 4 young males, 3 young females), and
five S. gracillimus (3 young males, 2 young females), which were captured in
Yufutsu Moor (Tomakomai-shi) during 14-18 June 1992 and in a wind-shelter
belt near the Teshio Experimental Forest of Hokkaido University (Horonobe-
cho) during 25 June to 27 August 1992. Basically, sexually immature individ-
uals were used in experiments in order to lessen the potential effect of sexual
behavior on space use. Shrews were kept under a 16-hr light and 8-hr dark
photoperiodic cycle at 20+2°C. The light intensity was maintained at 1420 lux
during the light period and at 12 lux during the dark period (as measured at the
center of laboratory floor ; See Ohdachi 1994, 1995c for details). Each experi-
ment was conducted throughout the 8-hr dark period, from 11 October 1992 to
6 January 1993.
Each observation cage contained 20 levels and the floor surface, and was
fitted with two staircases (Fig. 1). Each of the boards separating the levels
Ohdachi, Spatial use and aggression of shrews is
Tae
= Water Black ccryic board iim a.
@ Food
Transparent acrylic board
Artificial turf
Fig. 1. The experimental device for Experiment 1. Black boards were removed just before
an experimental session.
was covered on both sides with artificial turf so that shrews were always in
physical contact with this surface while moving about between levels. Pieces
of tissue paper, which simulated ground litter, were located on the cage floor.
Trays of the mixed paste diet and water were located as shown in Fig. 1.
Black acrylic boards were attached in front of transparent cage walls, so as to
exclude light before observation periods.
Either one or two animals were released simultaneously onto the cage floor
thirty minutes before the onset of the dark period. The black masking boards
were gently removed immediately after the light was turned off. The location
and behavior of each shrew were then recorded every fifteen minutes using a
weak red spot-light. After finishing an experimental session, the animals were
removed and the cages were washed with ethanol and kitchen detergent and
then dried out.
The vertical location of a shrew was assigned to one of five categories :
surface level (0), levels 1-5, 6-10, 11-15, and 16-20. Utilization of each level by
an individual was obtained by averaging the percent frequencies for the level
among several experimental sessions under the same experimental treatment.
Seventy experimental sessions were used for analysis.
The dominance relationship between two individuals was defined as fol-
lows: the “loser” was the individual which avoided, escaped, or fled from its
“opponent” when two animals encountered or fought, while the opponent under
these circumstances was a “winner”. If the number of wins and losses obser-
ved were the same, the two animals were judged to be “even”. When no direct
contact was observed, this was defined as “no match”.
2. Experiment 2
The second experiment was designed to investigate aggressive behavior
14 Mammal Study 22: 1997
and the effect of the presence of con- or hetero-specific individuals on the use
of space use (especially horizontal use) and behavioral patterns. Animals used
in this experiment included ten S. unguiculatus (1 adult female, 5 young males,
4 young females), three S. caecutiens (2 young male and 1 young female), and
five S. gracillimus (2 adult females, 1 young male, and 2 young females), which
were captured in wind-shelter belts near the Teshio Experimental Forest of
Hokkaido University during 6-22 August 1993, and one adult female S.
caecutiens that was captured in Yufutsu Moor in July 1992. Laboratory condi-
tions were the same as in Experiment 1. Each experiment was conducted
throughout the dark period, from 30 August to 24 November 1993.
Two animais were released separately into experimental cages (Fig. 2) one
day before an experiment, with both sides of the connecting tube being closed
by rubber plugs. The rubber plugs were removed five minutes before the onset
of the dark period. Asa control experiment, an empty cage was connected to
a cage where a single shrew was introduced. The first cage into which a shrew
was introduced, prior to the cages being connected for the experiment, is
hereafter referred to as the “home” cage, while the other is referred to as the
“away cage.
Shrew behavior was recorded using a video camera recorder (in the twi-
light vision mode) throughout the dark period, and sampled every 5 minutes
while replaying the video tapes. Behavior was ascribed to one of three cate-
gories: “underground activity” (shrews were underground or digging), “in
Video camera
Fig. 2. The experimental device for Experiment 2. A connecting tube is plugged until an
experimental session is started. Note that the bottom of a nest box was open to the ground
surface.
Ohdachi, Spatial use and aggression of shrews 15
action on the ground” (shrews were in nest boxes or resting on the ground
surface), and “moving on the ground” (shrews were walking or running on the
ground surface, or whirling exercise wheels). Other behaviors, such as eating,
drinking, or self-grooming, were usually too brief to be recorded by the 5-
minute-interval sampling method. Behavior below ground and in nest boxes
could not be observed in this experiment. Because S. unguiculatus usually
constructed burrows in its “home” cage and some entrances of the burrows
opened under its nest box, it was impossible to distinguish “underground
activity” and “inaction on the ground” when it was in its nest box. According
to preliminary observations, however, S. unguiculatus usually entered burrows
under its nest box instead of staying on the ground surface when in its nest box.
Therefore, unless it was possible to verify that the shrew did not enter a
burrow, the case in which S. unguiculatus was in a nest box was classified as
“underground activity”. Preliminary observations revealed that S. caecutiens
and S. gracillimus usually stayed on the ground surface under the nest box of S.
unguiculatus, and that they were usually inactive there. Thus, when S.
caecutiens or S. gracillimus was in the “away” nest box of S. unguzculatus, this
was classified as “inaction on the ground”, except when they obviously entered
burrows under the nest box.
The frequency of each behavioral category for an individual was obtained
by averaging the observation frequencies of the category across several experi-
mental sessions under the same experimental treatment. Sixty-two experimen-
tal sessions (496-hour observation in total) were used for the analysis.
The number of attacks and the dominance relationship between individuals
were determined by continuous scanning of the video tape throughout the 8-hr
experimental session (complete observation). Attacking behavior includes
chasing, biting body or tail, and wrestling. Attacks interrupted for more than
10 seconds was counted separately. The criteria for “win”, “lose’, and “no
match” were the same as in Experiment 1. In this experiment, however, “even”
was defined as follows: frequent counterattacks were observed or an individ-
ual did not escape from the opponent even when it was attacked often.
RESULTS
1. Experiment 1
Sorex unguiculatus was more subterrestrial than either S. caecutiens or S.
gracillimus. S. caecutiens used the surface level significantly more frequently
than S. unguiculatus during its active phase (ANOVA with arcsine transforma-
tion by Scheffe’s method, w=0.05), but utilization of the other levels did not
differ significantly between these two species (Fig. 3). S. gracillimus appeared
to frequently use the surface level as did S. caecutiens, although its surface
activity was not statistically different from that of either S. unguzculatus or S.
caecutiens (Fig. 3).
Vertical space use did not differ significantly between the experimental
treatments in each of the three species (Fig. 3). The dominance relation also
16 Mammal Study 22: 1997
A. S. unguiculatus
Alone With S. u.
Active
With S. c.
1-5}
Active 6,
0
Bact 1-5
es
& 6-10
Sleep 11-15
Mean percent frequency (%)
Fig. 3. Vertical spatial use of shrews when they were alone and with con- or hetero-specific
individuals (mean percent frequency). The same bold letters (a, b) indicate non-significant
difference in mean percent frequency for the floor surface (0) between species when shrews
were “alone” (a=0.05, ANOVA, arcsine transformation, Scheffe’s method; the sequential
Bonferroni correction among levels, Rice 1989). There was significant difference neither
among species for the other levels when alone nor among experimental treatments for each
level within species.
Ohdachi, Spatial use and aggression of shrews IL,
Table 1. The ratios of “active” and “rest & sleep” phases in three shrew species observed in
Experiment 1 (mean percent frequency+SD). Mean percentages in the “alone” column
differed significantly between any two of the three species (a =0.05, ANOVA, arcsine trans-
formation, Scheffe’s method). The different letters indicate significant differences. The
mean percentages did not differ significantly among the experimntal treatments within
species.
With
Experimental Alone San Se S. g.
treatment
S. unguiculatus a
Active 30.22 10.9 300 / 225, 5 89) 2aEW 38 ai alse If 5 Al
Rest and Sleep 67 .0 OS 60.8 58.6
(n) (8) (8) (8) (9)
S. caecutiens b
Active (0.2212. I (3.22 7,,9 65.522 25.0 68.6+8.2
Rest and Sleep 29.4 Om StS) 31,4!
(7) (7) (8) (8) (8)
S. gracillimus ©
Active i), Oaet0) 4 (0) Hae l2, 2! NaSaeOy 7 HS O22 2
Rest and Sleep 50.0 3925 49.2 44.2
(7) (4) (4) (4) (5)
had no apparent effect on vertical space use; there were no significant differ-
ences for almost all comparisons.
The percentages of active and non-active phases did not differ significantly
between the exrimental treatments (alone and with con- or hetero-specific
individuals) in any of the three species (ANOVA with arcsine transformation by
Scheffe’s method, a=0.05, Table 1). Interspecific differences in activity when
animals were “alone” were, however, significant. S. caecutiens was most
active, S. unguiculatus was least active, and S. gracillimus was intermediate
between them. Dominance relationships between two individuals (win, even,
lose, or no match) also had no effect on activities of shrews.
2. Experiment 2
The use of “home” or “away” cage did not differ significantly among
species when shrews were “alone” (ANOVA, @=0.05). S. unguiculatus, how-
ever, tended to stay in its “home” cage more than either of the other two species
(Table 2). The experimental treatments (alone and with con- or hetero-specific
individuals) also had no effect on the use of “home” and “away” cages for any
of the three species (Table 2). The dominance relationships tended not to
influence the use of either the “home” or “away” cage in the three species ;
there were no significant differences for almost all comparisons.
When two individuals were introduced into two interconnected cages, they
tended to stay in separate cages (Table 3). The mean percentage of time spent
in a single cage or separate cages did not differ significantly among the
experimental treatments.
18 Mammal Study 22: 1997
Table 2. The utilization of “home” and “away” cages by three shrew species observed in
Experiment 2 (mean percent frequency+ SD). The mean percentages differed significantly
neither between the experimental treatments within species nor between species when shrews
were “alone” (a#=0.05, ANOVA, arcsine transformation, Scheffe’s method).
With
Experimental Alone SOUL SG Sais
treatment
S. unguiculatus
Home Orie 728) <3 TOE 9E= 2045 6447 = 36e5 F229 1
Away DE) 8 Baye Jt Rios AS)
(7) (10) (10) (10) (10)
S. caecutiens
Home 503 (esi 9 52). Osta O6 30:3 sel 6 AD Gate 232
Away 49.3 48.0 Oe 1 50.4
(7) (4) (4) (4) (4)
S. gracillimus
Home HO oaeZ9).(/ 68.0+7.9 48.2+29.4 AS 2 == Ono
Away a5}. 5) 8 ll) RS Sls
(n) (4) (4) (5) (4)
S. unguiculatus remained underground or dug soil significantly more fre
quently (@=0.05) than did either S. caecutiens or S. gracillimus when they were
in their “home” cages (Fig. 4). The mean frequencies of the three behavioral
categories, however, did not differ significantly among the three species when
they were in “away” cages (Fig. 4).
S. unguiculatus was “active underground” significantly more frequently in
its “home” cage than it was in the “away” cage under each of the experimental
Table 3. Occupation of cages by two shrews in Experiment 2 (mean percent frequency + SD
of staying in the same cage and separate cages). The means did not differ significantly
between any comparisons (a=0.05, ANOVA, arcsine transformation, Scheffe’s method). 7:
number of experimental sessions examined.
With
S. caecutiens
S. unguiculatus S. gracillimus
S. unguiculatus
Same 35), ae IIS) 9) 35) ocd bff) 24225-1438
Different 64.1 64.4 (Date
(n) (5) (10) (10)
S. caecutiens
Same = 33.9+19.6 382420
Different = 66.1 66.3
(n) (5) (9)
S. gracillimus
Same = = HA aoe Oat
Different = = AD LZ
(n) (4)
Ohdachi, Spatial use and aggression of shrews 9
A. S. unguiculatus B. S. caecutiens
60
<
°
3
o
p>
Oo
pe)
oO
oOo
With S.u. With S.c.
With S.u. With S.c. With S.g.
a 3
(o>)
Oo
Mean frequency (%)
Mean frequency
[o)
Away
ho
oO
20
40 40
C. S. gracillimus
60
Home Underground
activity
ie)
[o)
Inaction on
the ground
(2) (2)
Mean frequency
20 Moving on
the ground
Away
40
Fig.4. The effects of con-or hetero-specific individuals on the behavior of shrews (mean
percent frequency). The same letters indicate non-significant difference in mean frequency
of each behavior category among the experimental treatments and between “home” and
“away” cages within experimental treatment (@a#=0.05, ANOVA, Scheffe’s method). In S.
caecutiens and S. gracillimus, any significant difference in behavioral category was not found
among the experimental treatments nor between “home” and “away” cages.
treatments (Fig. 4-A). In contrast, the mean frequency of each behavior in S.
caecutiens and S. gracillimus did not differ significantly between the “home”
and “away” cage situations (Fig. 4-B, C). The experimental treatments (alone
and with con- or hetero-specific individuals) also had no effect on the behavi-
oral patterns for any of the three species (Fig. 4).
The relationship between the mean frequencies of the behavioral categ-
ories and the dominance relation was not fully analyzed because of small
sample size. However, behavioral patterns appeared not to be affected by the
dominance relationship.
3. Dominance relationships and attacks
Among the three species, S. unguiculatus was most dominant and S. gvacil-
limus was most submissive in terms of physical superiority. S. unguiculatus
was seldom defeated by S. caecutiens and never defeated by S. gracillimus
(Table 4). Furthermore, “no match” was the major result between conspecific
individuals of S. unguiculatus in Experiment 2, but this result might be an
artifact of the observation method that underground behaviors could not be
observed. S. caecutiens beat S. gracillimus in most combats.
S. unguiculatus showed no significant difference in the number of attacks
Mammal Study 22: 1997
Table 4. Dominance relations between two con- or hetero-specific individuals
in Experiments 1 and 2 (numbers of individuals of four kinds of the relation).
Results of different experimental sessions for an individual were treated as
diffrent counts.
Opponent
Spd See SY
Experiment 1
S. unguiculatus win 4 6 6
even 4 4 1
lose 4 0) 0
no match 0 2 3
S. caecutiens win 0 5 4
even 4 4 2
lose 6 5 1
no match 2 ) 2
S. gracillimus win 0 1 2
even il 2 4
lose 6 4 2
no match 3 2 0
Experiment 2
S. unguiculatus win il 6 8
even 0 IL 0
lose 1 1 0
no match 8 2 2,
S. caecutiens win 1 5 i
even i 0) 0
lose 6 5 0)
no match 2 0) Z
S. gracillimus win ) 0 4
even 0 0 0
lose 8 tt 4
no match 2 2 0)
Table 5. Mean numbers of attacks (+SD) between two individuals in
Experiment 2. The same letters indicate non-significant difference (a=
0.05, Mann-Whitney’s U-test, the sequential Bonnferroni correction, Rice
1989). The first letters before comma indicate the results of between-
columm comparisons and the second letters are those of between-rows.
Numbers parentheses are those of observations examined.
Against
See Sie 5.423
S. unguiculatus
Oe Sac), 7 ee Qari 5 62 98
(2)a, a (8)a,a (8)a, a
S. caecutiens
heQael 4 6.4+8.9 214 = 6.6
(8)a, a (10)a, a (7)b, b
S. gracillimus
0.0+0.0 OM6== 085 0.9+1.4
(8)a, a bya (8) ab, a
Ohdachi, Spatial use and aggression of shrews 21
against other individuals (Table 5). S. caecutiens attacked S. gracillimus sig-
nificantly more frequently than it did S. unguiculatus or other S. caecutiens. S.
gracillimus attacked other individuals less frequently than did either of the
other two species. S. gvacillimus was attacked more often by S. caecutiens
than by S. unguiculatus or by conspecifics (Table 5)
DISCUSSION
S. unguiculatus was frequently active underground, whereas S. caecutiens
mainly used the ground surface (Figs.3 and 4). S. gracillimus showed an
intermediate vertical use of space in Experiment 1, but it was primarily a
ground-surface dweller (Fig. 4) in Experiment 2, which was deemed to simulate
natural conditions more realistically than Experiment 1.
The interspecific differences in use of space were consistent with those in
burrowing habits (Ohdachi 1995c) and in dietary constituents (Abe 1968, Inoue
and Maekawa 1990, Ohdachi 1995b): S. caecutiens and S. gracillimus, which are
poor burrowers and mainly eat small epigeal arthropods, showed more surface
activity than did S. unguiculatus, which was a superior burrower and a heavy
consumer of earthworms.
The presence of a con- or hetero-specific individual or their dominance
relationships affected neither the space utilization nor the mean frequencies of
behaviors (active/inactive and underground/resting/ground surface activity) in
each of the three shrew species. S. unguiculatus was intrinsically different in
its use of space (especially vertically) from S. caecutiens and S. gracillimus. It
is, therefore, likely that direct interaction or interference over space is less
frequent between S. unguiculatus and either of S. caecutiens or S. gracillimus
than between the latter two species.
A dominance order among the three species was evident (Table 4) and
seemed to correspond with the shrews’ body size. The strongest S. un-
guiculatus weighs on average approximately twice as much as the second-
ranked S. caecutiens, and S. caecutiens is 1.5 times as heavy as the weakest S.
gracillimus (Ohdachi and Maekawa 1990b). The correlation between fighting
ability and body size has also been reported from some other insectivorous or
carnivorous vertebrates (e.g., Persson 1985, Alatalo and Moreno 1987, Dickman
1988, Erlinge and Sandell 1988, Ducey et al.1994, Nakano and Furukawa-
Tanaka 1994).
Each of the three shrew species exhibited antagonistic behavior whenever
two con- or hetero-specific individuals encountered, although S. gvacillimus
were least likely to attack. It may have been this tendency that led them to
remain in whichever cage was not occupied by its opponent (Table 3). Many
other soricine species also show antagonism against con- or hetero-specific
individuals (Crowcroft 1957, Olsen 1969, Hawes 1977, Martin 1981, Barnard and
Brown 1982, Churchfield 1990, Ellenbroek 1990, Dickman 1991, Ellenbroek and
Hamburger 1991, Krushinska and Rychlik 1993). However, some species, such
as Neomys anomalus and Cryptotis parva, are tolerant towards conspecifics
UD Mammal Study 22: 1997
(Broadbooks 1952, Conaway 1958, Mock 1982, Krushinska and Pucek 1989,
Krushinska and Rychlik 1993). Krushinska and Pucek (1989) reported that
acquaintance reactions, such as warning and nasal contact, were observed in WN.
anomalus when two individuals met. In their study, shrews gradually avoided
direct conflict by learning their place of the dominance rank. In the present
study, such acquaintance behaviors were not observed; shrews suddenly
attacked other individuals (or were attacked) throughout experiments. The
lack of acquaintance behavior in the present study might have resulted from the
brevity of experiments which might have led to their intolerance of other
individuals.
Although S. unguiculatus was strongest of the three species (Table 4), it
attacked other two species less frequently (Table 5). In the present study,
attacks could only be observed among animals on the ground surface, which
might thus underestimate the attacking frequency of S. unguiculatus. Under
natural conditions, however, attacks by S. unguiculatus against S. caecutiens
and S. gvacillimus are also probably rare, because the latter two species use
subterranean space less frequently and presumably rarely encounter S. un-
guiculatus.
Soricids usually establish intraspecific territories or exclusive home
ranges, especially among individuals of the same sex (Ingles 1961, Shillito 1963,
Buckner 1966, 1969, Croin-Michielsen 1966, Platt 1976, Hawes 1977, Pernetta
1977, Inoue 1988, 1991, Ohdachi 1992, Ivanter et a/. 1994, Moraleva and Telitzina
1994, Stockley et al.1994). Such territoriality seems to be maintained by
aggressive behavior and odor marking (Crowcroft 1957, Hawes 1976). Two
types of interspecific spatial relationships are known among soricine shrews.
In the first type, territories overlap between species, as between S. avaneus and
S. minutus (Croin-Michielsen 1966, Pernetta 1977, Ellenbroek 1980). In the
second type, there is interspecific territoriality as between S. czmeveus and S.
vagrans (Spencer and Pettus 1966) and between S. vagrans and S. obscurus
(Hawes 1977). In Hokkaido, S. unguiculatus and either of S. gracillimus or S.
caecutiens appear to have overlapped territories (Ohdachi 1992). The occur-
rence of overlapped territories might be explained by the interspecific differ-
ence in vertical space use: S. unguiculatus appears only rarely to encounter
either S. gracillimus or S. caecutiens in the field. In contrast, inferring from the
results of the present study (Figs. 3 and 4), it is plausible that S. caecutiens and
S. gracillimus maintain interspecific territories when in symtopy, because both
species are ground-surface dwellers and they do not shift their space of activity
even when they co-habituate.
S. caecutiens tenaciously attacks S. gracillimus, and the latter seldom beats
S. caecutiens. The similarity in space use and the physical inferiority of S.
gracillimus could lead to its exclusion from habitats where S. caecutiens occurs.
Moreover, recipients of aggressive behavior may experience reduced fitness in
general (King 1973). This could partly explain the relative abundances of the
two species in a given habitat (Ohdachi and Maekawa 1990a): S. caecutiens and
S. gracillimus do not occur together as the first and second most abundant
Ohdachi, Spatial use and aggression of shrews 23
species. However, if S. caecutiens were to always exclude S. gracillimus, then
S. gracillimus would be unable to occur in Hokkaido. In reality, S. gvacillimus
outnumbers S. caecutiens and S. unguiculatus in some habitats (Ohdachi and
Maekawa 1990a). This might be attributed to interspecific differences in
habitat preference. S. gvacillimus is the most abundant species in moor and
uplands, especially, in northern Hokkaido, whereas S. caecutiens tends to
outnumber other species in habitats with sandy- or volcanic ash-soils (Ohdachi
and Maekawa 1990a), which implies that each species prefers particular envi-
ronments. Furthermore, competitive (interference) capabilities may vary in
relation to such environmental variables as temperature, humidity, or soil type,
and the result of competition depends on environmental conditions. Such
phenomena are known in fish (Dunson and Travis 1991, De Staso and Rahel
1994), planktons (Hessen et al. 1995), and beetles (Park 1954). Also, the distri-
bution pattern of soricids in Hokkaido is probably determined by a combina-
tion of both competitive ability and environmental conditions. In order to
understand community organization or distribution pattern of the shrews in
Hokkaido, further investigations of the effect of environmental conditions on
competitive ability are recommended.
Acknowledgments : I would like to express my deep gratitude to: H. Abe, M. J.
Toda, S. F. Mawatari, T. Ohgushi, and T. P. Craig for reviewing earlier drafts
of this paper, K. Ishigaki, K. Sasa, and other staff members of the Experimental
Forests of Hokkaido University for supporting the field work, T. Segawa, S.
Nakatsubo, and H. Ishii for making the equipment for the experiments, students
of the Institute of Low Temperature Science and the Laboratory of Applied
Zoology, Hokkaido University, who provided assistance with laboratory exper-
iments, and also S. Nakano, who referred me to some important research
papers.
REFERENCES
Abe, H. 1968. Classification and biology of Japanese Insectivora (Mammalia) II. Biological aspects.
J. Fac. Agr., Hokkaido Univ. 55 : 429—458.
Alatalo, R. V.and J. Moreno. 1987. Body size, interspecific interactions, and use of foraging sites in
tits (Paridae). Ecology 65:1773—1777.
Arthur, W. 1987. The Niche in Competition and Evolution. John Wiely and Sons, Chichester, 175
pp.
Barnard, C. J.and C. A. J. Brown. 1982. The effects of prior residence, competitive ability and food
availability on the outcome of interactions between shrews (Sovex avaneus L.). Behav. Ecol.
and Sociobiol. 10 : 307—312.
Bennett, W. A. 1990. Scale of investigation and the detection of competition: an example from the
house sparrow and house finch introductions in North America. Am. Nat. 135 : 725—747.
Broadbooks, H. E. 1952. Nest and behavior of a short-tailed shrew, Cvyptotis parva. J. Mammal. 33:
Dl 7}.
Buckner, C. H. 1966. Populations and ecological relations of shrews in tamarack bogs of southeast-
ern Manitoba. J. Mammal. 47 : 181—194.
Buckner, C. H. 1969. Some aspects of the population ecology of the common shrew, Sorex araneus,
24 Mammal Study 22: 1997
near Oxford, England. J. Mammal. 50 : 326—332.
Churchfield, S. 1990. The Natural History of Shrews. A & C Black., London, 178 pp.
Conaway, C. H. 1958. Maintenance, reproduction and growth of the least shrew in captivity. J.
Mammal. 39 : 507-512.
Croin-Michielsen, N. 1966. Intraspecific and interspecific competition in the shrews Sovex araneus L.
and S. minutus L. Arch. Néerland. Zool. 18 :73—174.
Crowcroft, P. 1957. The Life of the Shrew. Max Reinhardt, London, 166 pp.
De Staso, J., III, and F. J. Rahel. 1994. Influence of water temperature on competitive interactions
between juvenile brook trout and Colorado river cutthroat trout in a laboratory stream.
Trans. Am. Fish. Soc. 123 : 289—297.
Diamond, J. M. 1986. Overview: laboratory experiments, field experiments, and natural experi-
ments. Jn (J. M. Diamond and T. J. Case, eds.) Community Ecology. pp.3—22. Harper &
Row, New York.
Dickman, C. R. 1988. Body size, prey size, and community structure in insectivorous mammals.
Ecology 69 : 569—580.
Dickman, C. R. 1991. Mechanisms of competition among insectivorous mammals. Oecologia 85:
AG4— 471.
Ducey, P.K., K.Schramm and N.Cambry. 1994. Interspecific aggression between the sympatric
salamanders, Ambystoma maculatum and Plethodon cinereus. Amer. Midl. Natur. 131 :320—
329.
Dunson, W. A. and J. Travis. 1991. The role of abiotic factors in community organization. Am.
Nat. 138 : 1067—1091.
Ellenbroek, F. J. M. 1980. Interspecific competition in the shrews Sovex avaneus and Sorex minutus
(Soricidae, Insectivora) : a population study of the Irish pygmy shrew. J. Zool., London 192:
119 136:
Ellenbroek, F. J. M. 1990. An Experimental Analysis of Interspecific Competition in the Shrews
Sorex avaneus L.and S. minutus L. (Soricidae, Insectivora). H.Gianotten, Tilburg, 125 pp.
Ellenbroek, F. J. M.and J. Hamburger. 1991. Interspecific interactions between the shrews Sorex
araneus L.and S. minutus L.(Soricidae, Insectivora) and the use of habitat: a laboratory
study. Netherl. J. Zool. 41 : 32—62.
Erlinge, S.and M. Sandell. 1988. Coexistence of stoat, Mustela erminea, and weasel, M. nivalis :
social dominance, scent communication, and reciprocal distribution. Oikos 53 : 242—246.
Hardin, G. 1960. The competitive exclusion principle. Science 131 : 1292—1297.
Hairston, N.G., Sr. 1989. Ecological Experiments. Purpose, Design, and Execution. Cambridge
University Press, Cambridge, 370 pp.
Hawes, M.L. 1976. Odor as a possible isolating mechanism in sympatric species of shrews (Sorex
vagrans and Sorex obscurus). J. Mammal. 57 : 404—406.
Hawes, M. L. 1977. Home range, territoriality, and ecological separation in sympatric shrews, Sorex
vagrans and Sorex obscurus. J. Mammal. 58 : 354—367.
Hessen, D.O., B. A. Faafeng and T. Anderson. 1995. Competition or niche segregation between
Holopedium and Daphnia: empirical light on abiotic key parameters. Hydrobiol. 307 : 253—
261.
Holbrook, S.J. 1979. Habitat utilization, competitive interactions, and coexistence of three species
of cicetine rodents in east-central Arizona. Ecology 60: 758—769.
Ingles, L.G. 1961. Home range and habitats of the wandering shrew. J. Mammal. 42: 455—462.
Inoue, T. 1988. Territory establishment of young big-clawed shrew, Sorex unguiculatus (Dobson)
(Insectivora, Soricidae). Res. Popul. Ecol. 30: 83—93.
Inoue, T. 1991. Sex difference in spatial distribution of the big-clawed shrew Sovex unguiculatus.
Acta Theriol. 36 : 229-237.
Inoue, T. and K. Maekawa. 1990. Difference in diets between two species of soricine shrews, Sorex
unguiculatus and S. caecutiens. Acta Theriol. 35 : 253—260.
Ivanter, E. V., T. Ivanter and A. M. Makarow. 1994. The territorial and demographic structures of
a common shrews population. Jn (J.F. Merritt, G.L.Kirkland Jr.and R.K. Rose, eds.)
Advances in the Biology of Shrews. pp.89—96. Carnegie Museum of Natural History,
Ohdachi, Spatial use and aggression of shrews a5)
Pittsburgh.
Keddy, P. A. 1989. Competition. Chapman and Hall, London, 202 pp.
King, J. A. 1973. The ecology of aggressive behavior. Ann. Rev. Ecol. Syst. 4: 117—138.
Krushinska, N. L. and Z. Pucek. 1989. Ethological study of sympatric species of European water
shrews. Acta Theriol. 34 : 269—285.
Krushinska, N.L.and L. Rychlik. 1993. Intra- and interspecific antagonistic behaviour in two
sympatric species of water shrews: Neomys fodiens and N. anomalus. J. Ethol.11:11—21.
Martin, I.G. 1981. Tolerance of conspecifics by short-tailed shrews (Blarina brevicauda) in simulated
natural conditions. Am. Midl. Nat. 106 : 206—208.
Mock, O. B. 1982. The least shrew (Cryptotis parva) as a laboratory animal. Lab. Anim. Sci. 32:
lr 9!
Moraleva, N. and A. Telitzina. 1994. Territoriality in juveniles of the common shrew (Sorex avaneus)
in prepeak and peak years of population. Jn (J. F. Merritt, G. L. Kirkland Jr. and R. K. Rose,
eds.) Advances in the Biology of Shrews. pp.67—76. Carnegie Museum of Natural History,
Pittsburgh.
Nakano, S.and T. Furukawa-Tanaka. 1994. Intra- and interspecific dominance hierarchies and
variation in foraging tactics of two species of stream-dwelling chars. Ecol. Res. 9:9—20.
Ohdachi, S. 1992. Home ranges of sympatric soricine shrews in Hokkaido, Japan. Acta Theriol.
3391 SOk
Ohdachi, S. 1994. Total activity rhythms of three soricine species in Hokkaido. J. Mamm. Soc.
Japan 19: 89—99.
Ohdachi, S. 1995a. Comparative Ecology and Ethology of Sympatric Soricine Shrews in Hokkaido:
A Special Reference to Their Interspecific Interactions. Ph. D. Dissertation at the Graduate
School of Science, Hokkaido University, 116 pp.
Ohdachi, S. 1995b. Diets and abundances of three sympatric shrew species in northern Hokkaido. J.
Mammal. Soc. Japan 20 : 69—83.
Ohdachi, S. 1995c. Burrowing habits and earthworm preference of three species of Sorex in
Hokkaido. J. Mammal. Soc. Japan 20 : 85—88.
Ohdachi, S. and K. Maekawa. 1990a. Geographic distribution and relative abundance of four species
of soricine shrews in Hokkaido, Japan. Acta Theriol. 35 : 261 —267.
Ohdachi, S. and K. Maekawa. 1990b. Relative age, body weight, and reproductive condition in three
species of Sovex (Soricidae; Mammalia) in Hokkaido. Res. Bull. Coll. Exp. For., Fac. Agr.,
Hokkaido Univ. 47 : 535—546.
Olsen, R. W. 1969. Agonistic behavior of the short-tailed shrew (Blarina brevicauda). J. Mammal.
502 494— 500:
Park, T. 1954. Experimental studies of interspecies competition. II]. Temperature, humidity, and
competition in two species of Tribolium. Physiol. Zool. 27 : 177—229.
Parker, G. A. and W. J. Sutherland. 1986. Ideal free distributions when individuals differ in competi-
tive ability : phenotype-limited ideal free models. Anim. Behav. 34 : 1222—1242.
Pernetta, J.C. 1977. Population ecology of British shrews in grassland. Acta Theriol. 22 : 279—296.
Persson, L. 1985. Asymmetrical competition: are larger animals competitively superior? Am. Nat.
126 : 261 —266.
Platt, W.J. 1976. The social organization and territoriality of short-tailed shrew (Blarina
brevicauda) population in old-field habitats. Anim. Behav. 24 : 305—318.
Rice, W. R. 1989. Analyzing tables of statistical tests. Evolution 43 : 223—225.
Schoener, T. W. 1975. Presence and absence of habitat shift in some widespread lizard species.
Ecol. Monogr. 45 : 233—259.
Shillito (Babington), J. F. 1963. Observations on the range and movements of a woodland population
of the common shrew Sorex avaneus L. Proc. Zool. Soc., London 140 :533—546.
Spencer, A. W.and D. Pettus. 1966. Habitat preference of five species of long-tailed shrews.
Ecology 47 : 677—683.
Stockley, P., J. B. Searle, D. W. Macdonald and C. S. Jones. 1994. Alternative reproductive tactics in
male common shrews: relationships between mate-searching behaviour, sperm production,
and reproductive success as revealed by DNA fingerprinting. Behav. Ecol. Sociobiol. 34:
26 Mammal Study 22: 1997
(leamion
Werner, E. E. and D. J. Hall. 1976. Niche shifts in sunfishes : experimental evidence and significance.
Science 191 : 404—406.
(accepted 26 July 1997)
Mammal Study 22: 27-38 (1997)
© the Mammalogical Society of Japan
The impact of forestry on the small rodent community
of Hokkaido, Japan
Takashi SAITOH! and Atsushi NAKATSU?
Hokkaido Research Centre, Forestry and Forest Products Research Institute, Hitsujigaoka 7,
Toyohira, Sapporo O62, Japan
Fax. +81-11-851-4167, ‘e-mail. bedford @ffpri-hkd. affrc. go. jp
?e-mail. nakatsua @ffpri-hkd. affrc. go. jp
Abstract. The structure of small rodent communities, in both
natural forests and young plantations, in the Asahikawa region of
Hokkaido, Japan, in relation to the effects of long-term and large-
scaled forestry, was analyzed using census data spanning the 31
years from 1962 to 1992. Rodent communities in both natural
forests and plantations consisted largely of four species: Cleth-
rionomys rufocanus, C. rutilus, Apodemus argenteus, and A.
speciosus. Clethrionomys rufocanus was found to be dominant in
both habitats, however the relative abundance of species differed
significantly between habitats. Although the dominancy of C.
rufocanus was most obvious in forestry plantations, the proportion
it contributed to the community decreased during the 1980s.
Conversely, Apodemus species have increased in both habitats
over the same period. Rodent species diversity has increased in
the last decade. The decline in the proportion of C. rufocanus has
occurred in parallel with the decrease in the area of land under
forestry plantation, which is the preferred habitat for C. rufocanus.
These findings indicate that monocultural habitats, such as for-
estry plantations, may support super dominant species such as C.
rufocanus, which results in an impoverished rodent community, in
terms of species diversity.
Key words: Apodemus, Clethrionomys, forest structure, species diversity.
Intensive silvicultural practices including site preparation, removal of poten-
tially competing species, replacement of naturally occurring diversity with
single species, and extensive use of herbicides, fertilizer sand pesticides, trans-
form natural ecosystems into a timber production system. Monotonous for-
estry plantation is, in other words, an artificially transformed, and greatly
simplified habitat for animals. The faunas of such artificial forests have been
intensively investigated for comparison with those of natural forests, and the
effects of the introduction of monoculture on faunas have been widely discus-
sed. Most previous studies have, however, been of a short-term nature, and on
a limited spatial scale.
Bird densities and species diversity are, for example, generally lower in
plantations, especially in young plantations, than in natural forests (Fujimaki
28 Mammal Study 22: 1997
1970, Ishigaki and Matsuoka 1972, Ishigaki et a/. 1973, Kobayashi and Fujimaki
1985, Yui and Suzuki 1987; see also Murai and Higuchi 1988 for a review).
Small mammal faunas also differ between natural and planted forests. Even
when the species composition remains similar, the dominancy of the predomi-
nant species, for example, is enhanced in forestry plantations (Ota et al. 1977,
see also Ota 1984 for a review). Increases in the abundance of specific verteb-
rate species have also been observed on areas of forest clear-cuts (Hansson
1994). Thus, a forest managed for maximum timber yield may be best regard-
ed as analogous, in ecosystem terms, to a monocultured wheat field (Meffe and
Carrol 1994). If the scale of operation was extended, so that the landscape
became thoroughly transformed over several decades, then the effects of the
plantation would be likely to become profound. Little is known, however,
about such effects, because study on them requires wide-ranging long-termed
investigation.
In the 1950s, the Japanese Forestry Agency investigated a policy to trans-
form natural forests into more productive plantations. As a consequence of
this policy, considerable areas of natural forests were clear-cut and transfor-
med into single species, largely coniferous, plantations. In Hokkaido, Japan’s
northernmost island, this policy was implemented faithfully and extensively.
During the peak period, more than one percent of natural forests were cut and
transformed into coniferous plantations each year.
Because young plantations were frequently damaged by the grey-sided
vole, Clethrionomys rufocanus Sundevall, the Forestry Agency has, since 1954,
carried out censuses of small rodents, for management purposes, in forests all
over Hokkaido. That census data have proven invaluable. It has enabled us
to describe, in this paper, changes in the structure of small rodent communities,
in both natural forests and young plantations in Hokkaido over three decades
from 1962 to 1992, and to analyze the effects of long-term, large-scaled planta-
tions on small rodent communities.
MATERIALS AND METHODS
1. Study area and census methods
Since 1954 the Forestry Agency has carried out censuses of rodent popula-
tions at approximately 1,000 sampling locations all over the 78,073 km? island
of Hokkaido (41°24’-45°31’N, 139°50’-145°49’E). The forests under Forestry
Agency Management cover 28,300 km? (21,500 km? of natural forests, and 6,800
km? of plantations). In 1990, these forests were managed by 81 District Offices,
which were subdivided into Ranger Offices. The censuses were carried out by
each individual Ranger Office. The data analyzed for this paper come from
8,034 km’ of northern Hokkaido (corresponding to about 10% of the island’s
total area) under the supervision of the Asahikawa Sub-regional Office. Our
study areas included 22 District Offices, which consisted of 113 Ranger Offices
in 1990. Most of the natural forests in this area are classified as “pan mixed
forests” with needle and broad-leaved trees, in what is regarded as a transition
Saitoh and Nakatsu, Impact of forestry on small rodent communities 29
zone between the temperate and boreal zones (Tatewaki 1958). The dominant
tree genera here are: Abies, Acer, Betula, Picea and Quercus (Tatewaki 1958).
Trapping was carried out three times a year, in spring (May or June),
summer (July or August) and autumn (September or October). Ranger Offices
set 50 snap traps, at 10 m intervals on 0.5 ha (50 x 100 m) grids, over either three
or five consecutive nights. Since rodent abundance in Hokkaido usually
reaches its peak in autumn, and because autumn populations are known to
reflect accurately annual variation in populations (Saitoh 1987), we used
autumn census data in our analyses.
Four rodent species, C. vufocanus, C. rutilus (Pallas), Apodemus speciosus
(Temminck), and A. avgenteus (Temminck) were recorded during the censuses.
C. vex Imaizumi, A. peninsulae (Thomas), and several species of shrew, Sovex
spp., also occur in the region and may have been caught occasionally. These
less common species were, however, not reported officially.
Each Ranger Office censused 2-6 separate sites. Census grids were usually
located in selected habitats (young plantations, and natural forests neighbour-
ing plantations) which together constituted a unit. Census sites were some-
times relocated within the area of a given Ranger Office, and methods have
changed over the period of study. From 1962 to 1976, for example, traps were
set for five nights, whereas from 1977 to 1992 a three-night trapping scheme was
employed. To make these two data sets compatible for time-series analyses,
the data from the first 15 years were transformed to three-night equivalents
(z.é., 150 trap nights), using the regression of the three-night (y) on the five-night
(x) captures (vy =0.68066x + 0.18127, 7?=0.935).
For the purposes of this study, rodent abundance is defined as the number
of individuals caught per 150-trap-nights. Species diversity and species ratios
were calculated based on the data from the four main rodent species. The
Shannon-Wiener function (index of evenness, /’) was used as an index for
species diversity (Krebs 1989). As data for 1970 and 1974 have been lost
(except for on C. rufocanus), values have been calculated excluding the data
from these two years. Moving averages, for each three year period, were used
to smooth annual variation. For the calculation of moving averages, for
periods including the years 1962, 1970, 1974, and 1992, values were obtained
from the data for the associated two years.
2. Forest management
Forest planting follows several silvicultural procedures. For this paper
we focused on the most drastic method of transforming a natural system into
an artificial one; that is young plantations grown on clear-cuts. After clear-
ance of natural forest, weeds are removed from the clear-cut, then larch, Larix
kaempferi (Lambert) or fir, Abzes sachalinensis Fr. Schmidt seedlings are plant-
ed densely. Because weeds grow thickly in young plantations and may sup-
press the growth of tree seedlings, the weeds are cut every summer until
between five and nine years after tree planting. Censuses were carried out in
such young plantations until ten years after planting.
30 Mammal Study 22: 1997
3. The voles and mice
The grey-sided vole, Chlethrionomys. rufocanus, is common in both open
fields and in natural forests and plantations in Hokkaido. This species is well
known for exhibiting a wide spectrum of population dynamics ranging from
stable to cyclic (Saitoh 1987, Bjérnstad et al. 1996, Stenseth et al. 1996, Saitoh
et al. 1997). This small (30-40 g), short-tailed (around 40% of head and body)
rodent is more folivorous than other Clethrionomys species (Hansson 1985).
This feeding habit is particularly prevalent in Hokkaido, possibly due to the
absence of Microtus spp. ‘This is consistent with its wider habitat preference
from open fields to natural forests in Hokkaido. During winter, C. rufocanus
eats mainly leaves and shoots of bamboo grass, and some shrub/tree bark.
During summer it eats various forbs and grasses, and in autumn, acorns are
eaten to some extent (Ota 1984).
The red-backed vole, C. rutilus, is a short-tailed, forest-dwelling rodent.
Its body shape is similar to that of C. vufocanus, though at 20-30 g, it is smaller.
Although C. rutilus is essentially granivorous (Hansson 1985), it also eats, to
some extent, insects year around (Ota 1984). Its abundance is usually low in
Hokkaido, though it sometimes dominates in mature coniferous forests (Ota
1984).
The Japanese wood mouse, A. avgenteus, is endemic to Japan (though
ecologically equivalent to A. sylvaticus of Eurasia). It is small, weighing just
15-20 g, and has a relatively long tail which is longer than its body length. At
a weight of 40-60g, A. speciosus, another Japanese endemic mouse, is the
largest of the four species analyzed here. Its tail is relatively short (77-99% of
body length) for a mouse-shaped rodent. These two Apodemus species are
both largely granivorous, though they also eat a considerable amount of insects
(Ota 1984). The larger species A. speciosus prefers larger seeds such as acorns,
walnuts, or pine nuts, whereas A. arvgenteus eats smaller seeds and berries.
The main habitats of these two species include various forest types. The
two species are usually dominant in natural forests, though A. speciosus is also
found in open fields.
RESULTS
1. Species composition
The total of 223,663 rodents were trapped during the 31 year study period ;
122,653 of these were from 6,438 census grids in natural forests, and 101,010 were
from 5,222 grids in young plantations. The average number per trapping grid
in the two types of forests were very similar: 19.1 for natural forests and 19.3
for plantations.
The proportion of Clethrionomys rufocanus to the total number of rodents
captured, exceeded 50% in both natural forests and plantations (Fig. 1).
Although the order of dominance (C. rufocanus >A. argenteus > A. speciosus >
C. rutilus) was the same in natural forests and in plantations, relative propor-
tions of each species differed significantly between them (G-test, Gag;= 449.3,
Saitoh and Nakatsu, Impact of forestry on small rodent communities 31
57.5% 0.7% 25.6% 16.2%
Plantation C. rufocanus A. argenteus
(101,010)
C. rutilus A. speciosus
Natural F. C. rufocanus
(122,653)
0 20 40 60 80 100
Proportion of species (%)
Fig. 1. The proportion of rodent species in natural forests and plantations in the Asahikawa
region, Hokkaido, Japan. Figures in parentheses indicate the total number of rodents caught
during the 31 year census.
p<0.001, Sokal and Rolf 1995). The dominancy of C. rufocanus was parti-
cularly obvious in plantations. Because C. vutilus was very uncommon, our
main analyses are of the other three species.
2. Variation in species abundance
Rodent abundance fluctuated greatly from year to year, particularly at two
to four year intervals, both in natural forests and in plantations (Figs. 2a, 2b).
This pattern may be led by the demographic features of the dominant species,
Clethrionomys rufocanus. Basic statistics of population dynamics are given in
Table 1. Note that values indicating variability (7.e., CV, s-value, and Max/
Min ratios) were moderated owing to averaging the abundance of rodents on
more than 100 census grids.
The relative proportion of C. rufocanus was correlated with its abundance,
whereas this relationship was not found in other species, with the exception of
A. speciosus in plantations (Table 2). These vague relationships among
Apodemus species, attributed to the positive correlation in abundance with C.
rufocanus, which was most influential on the proportions of the various species
(Table 3). Even when the abundance of an Apodemus species increased, it still
did not represent a large proportion of the community because C. rufocanus was
always even more abundant. The abundances of the three main species were
generally correlated with each other in both natural forests and plantations
(Table 3).
37 Mammal Study 22: 1997
Table 1. Basic statistics for rodent abundance. Data on C. rutilus was eliminated
because of its scarcity. Note that values indicating variability (z.e., CV, Max/Min
ratio and s-value) were moderated owing to averaged figures.
C. rufocanus A. argenteus A. speciosus
Natural forests
Average 64g SEG Br Oh)
CV 2%) DIN 41.30 62.20
Max. 19.28 IQ Zl 10.40
Min. 1.49 Ley 0.67
Max./Min. 12.95 8.16 42
s-value 0.29 (0), Zul 0.28
Plantations
Average 10.69 4.87 Selah
CV (%) 53.30 44.10 62.40
Max. DRL, 10.92 9.80
Min. Theeul 1.14 0.63
Max./Min. ea 9.59 1555
s-value 0.31 0222 0.29
Table 2. Relationships between abundance and proportion in the three species are
given using Kendall rank-order correlation coefficient t (7=29). Figures in parenth-
eses are probabilities of a Type I error for Kendall’s r.
C. rufocanus A. argenteus A. speciosus
Natural forest ().468 0.094 SAY
(0.000) (0.476) (0.099)
Plantations 0.429 0.244 OEZT-
(0.001) (0.063) (0.037)
Species proportions were, however, negatively correlated between C.
rufocanus and the two podemus species, whereas a positive relatonship was
found between the two Apodemus species (Table 3). Positive correlations
between the two Apodemus species, both in abundance and species proportion,
indicate that competition between them is probably not severe. Species prop-
ortions fluctuted from year to year with some clear patterns revealed by
moving averages (Figs. 2a, 2b). C. rufocanus seemed to have gradually lost its
dominancy in both natural forests and plantations since the 1980s (Fig. 3a, 3b).
In contrant to the decline in C. rufocanus, Apodemus species contributed a
steadily increasing proportion of the community in the later years of the study.
3. Species diversity
Species diversity values in natural forests fluctuated around 0.7 during the
1960s and early 1970s, increased fro the late 1970s to the early 1980s, and
thereafter attained relative stability at 0.8. The change in species diversity in
plantations exhibited a very similar pattern to that in natural forests, although
33
Saitoh and Nakatsu, Impact of forestry on small rodent communities
a. Natural forests
Abundance
1962 1967 1972 1977 1982 1987 1992
Year
b. Plantations
Abundance
Year
Fig. 2. Fluctuation of rodent abundance in: a. natural forests and b. new plantations.
Abundance is shown as the number of rodents caught per 150-trap night. Lozenge: the total
number, solid circle: C. rufocanus, triangle: A. argenteus, square: A. speciosus, and open
circle: C. rutilus.
34 Mammal Study 22: 1997
a. Natural forests
C. rufocanus
A. argenteus
Species %
| a. -
Ca > -B- P .
| a- a i |
C. rutilus
1962 1967 1972 1977 1982 1987 1992
Year
b - Plantations
C. rufocanus
es
N
5 A. argenteus
oO
(a Va
N
é 5 Pew |
ae K
L a. Hi
pt etae on,
4 C. rutilus
1962 1967 1972 1977 1982 1987 1992
Year
Fig. 3. Changes in rodent species ratios in: a. natural forests, and b. new plantations.
Species proportions are shown with moving averages for each three year period. Solid
circle: C. rufocanus, triangle: A. argenteus, square: A. speciosus, open circle: C. rutilus.
Saitoh and Nakatsu, Impact of forestry on small rodent communities 30
Table 3. Relationships of abundance and proportion between the three species of
rodents (C. vufocanus [Cr], A. argenteus |Aa], and A. speciosus [As ]) in the two types of
forests are given using Kendall rank-order correlation coefficient rt (z=29). Figures in
parentheses are probabilities of a Type I error for Kendall’s rz. Upper matrix for
natural forests, lower matrix for plantations.
Abundance Proportion
OP Aa As OF Aa As
Cy = 0.301 0.281 = = Wey) — (0.668
(0.022) (0.032) (0.000) (0.000)
Aa O22 = 0.655 —= ert == 0.387
(0.091) (0.000) (0.000) (0.003)
As 0.266 0.640 a —(0.699 0.478 re
(0.043) (0.000) (0.000) (0.000)
the species diversity in plantations was almost always lower than that in
natural forests (Fig. 4, Wilcoxon signed-ranks test, Z=—4.249, p<0.0001).
Species diversity in natural forests during the latest ten years averaged 0.8,
which was significantly higher than during the first ten years (0.7, Random
permutation test, )=0.001). A similar significant pattern was also observed in
plantations, where species diversity averaged 0.6 in the first decade, and 0.8 in
the latest (Random permutation test, /=0.0012).
4. Species diversity and forestry
Extensive forest planting took place during the 1960s and early 1970s in
Hokkaido. More than one percent of natural forests (more than 7,000 ha) were
felled, and coniferous seedlings were planted on the clear-cuts within a year.
Since the 1970s, however, planting effort has decreased (Fig. 4). The pattern of
planting has been closely followed by the proportion of the small rodent
community contributed by C. rufocanus (Fig. 3). The proportion of C.
rufocanus was highly correlated with the area of new plantations (Kendall’s r=
0.897, 6<0.001 for natural forests ; r=0.566, )<0.001 for plantations).
DISCUSSION
The gray-sided vole, C. rufocanus, was found to be the most abundant small
rodent in both natural forests and plantations (Fig. 1). Its dominancy was most
obvious in plantations. The young plantations, where the censuses were
carried out, were open and herb-dense habitats and the preferred habitat of C.
rufocanus in Hokkaido (Ota 1984). Thus, the dominancy of C. rufocanus in
plantations is consistent with previous studies (Ota et al. 1977, Ota 1984). The
present results, indicating that C. rufocanus contributed over 50% of small
rodent communities even in natural forests, should, however, be noted. Previ-
ous studies have indicated that either A. argenteus, or A. speciosus is usually
36 Mammal Study 22: 1997
100
Plantation area
J' in natural forest
60
Species diversity (J' )
Plantation area (x 100 ha)
20
” 1962 1967 1972 1977 1982 1987 1992
Year
Fig. 4. Changes in rodent species diversity and in the area of new plantations. The
Shannon- Wiener function (index of evenness, J’) was used as an index for species diversity.
Species diversity is shown with moving averages for each three year period. Circle: species
diversity in natural forests, triangle: species diversity in plantations, square: new plantation
area.
dominant in mature natural forests, even though C. rufocanus is also common
there (Ota et al. 1977, Ota 1984). The extensive areas of plantation contiguous
with the natural forests studied here may have led to the increased proportion
of C. rufocanus in natural forests.
The prominent dominancy of C. rufocanus caused species diversity to be
low during the 1960s and early 1970s (Figs. 3, 4). Thereafter, as the proportion
of C. rufocanus decreased, species diversity increased. These changes were
consistent with changes in forestry planting effort. These findings suggest
that monocultural habitats, such as forestry plantations, may support a super
dominant species (in this case C. rufocanus), which suppresses species diversity
in the rodent community.
The censuses were carried out continuously on the same types of habitats
(on young plantations and on natural forests neighbouring plantations) through-
out the study period. Thus the decrease in the relative proportion of C.
rufocanus was not caused by environmental changes on census grids. The
present results should, therefore, reflect changes in rodent communities in more
extensive areas than just on census grids; thereby indicating that long-term,
extensive forestry practices may simplify the rodent community not merely in
the plantations themselves but also in the natural forests surrounding large
scale plantations.
Nakatsu (1988, 1992) has also reported changes in species proportion based
Saitoh and Nakatsu, Impact of forestry on small rodent communities Sit
on the same census data that we analyzed; he did not analyze the data as a
time-series, but his data set, however, covered all regions of Hokkaido.
Although Nakatsu (1988, 1992) also found a significant reduction in the propor-
tion of C. rufocanus in the Asahikawa region, he did not find such a reduction
in either Kitami or Obihiro regions, where planting efforts were also decreasing
during the 1980s.
A clear relationship between rodent communities and forestry plantations
was revealed in this study. We do not think that this relationship is super-
ficial, and believe that extensive forestry planting may simplify the rodent
community on a large scale. The present analyses are not robust enough,
however, to prove this, because different types of rodent population fluctua-
tions were pooled in this study (see Bjérnstad et al. 1996), and because this
study tells nothing about the regional differences in species proportion that
Nakatsu (1988, 1992) observed. To resolve these problems more detailed
analyses are required.
Dedication: We dedicate this paper with great appreciation to Professor
Hisashi Abe, on his retirement from Hokkaido University in 1997. His work
has been a great inspiration to us.
Acknowledgements: We are indebted to: the Japanese Forestry Agency for
providing the material analysed here, Shigeru Matsuoka and Noritomo Kawaji
for their kind help in gathering related references, Hisashi Abe for his invalu-
able comments on our manuscript, and Mark Brazil for improving the English.
REFERENCES
Bjgrnstad, O. N., S. Champely, N.C. Stenseth and T. Saitoh. 1996. Cyclicity and stability of grey-
sided voles, Clethrionomys rufocanus, of Hokkaido: spectral and principal components ana-
lyses. Phil. Trans. R. Soc. Lond. B 351 : 867—875.
Fujimaki, Y. 1970. An avifaunal study in different types of forests in the central part of Hokkaido,
Japan. Bull. Hokkaido For. Exp. Stn. 8: 42—51 (in Japanese with English abstract).
Hansson, L. 1985. Clethrionomys food: genetic, specific and regional characteristics. Ann. Zool.
Fenn. 22:315—318:
Hansson, L. 1994. Vertebrate distributions relative to clearcut edges in a boreal forest landscape.
Landsc. Ecol. 9: 105—111.
Ishigaki, K. and S. Matsuoka. 1972. Birds in the Tomakomai experiment forest of Hokkaido
University No.1. Species and diversity in a temperate broad-leaved forest and conifer
plantations in summer. Res. Bull. Col. Exp. For. Col. Agr. Hokkaido Univ. 29:43—54 (in
Japanese with English abstract).
Ishigaki, K., S. Matsuoka and I. Ogawa. 1973. Birds in the Tomakomai experiment forest of
Hokkaido University No.2. Species and relative abundance in a temperate broad-leaved
forest and conifer plantations in winter. Res. Bull. Col. Exp. For. Col. Agr. Hokkaido Univ.
30 :55—68 (in Japanese with English abstract).
Kobayashi, S. and Y. Fujimaki. 1985. Breeding bird communities in a deciduous broad-leaved wood
and a larch plantation. Tori 34:57—63 (in Japanese with English abstract).
Krebs, C. J. 1989. Ecological Methodology. Harper Collins, New York, 654 pp.
Meffe, G. K. and C.R. Carrol. 1994. Principles of Conservation Biology. Sinauer Associates, Inc.
Sunderland, 600 pp.
38 Mammal Study 22: 1997
Murai, H. and H. Higuchi. 1988. Factors affecting bird species diversity in Japanese forests. Strix
7:83—100 (in Japanese with English abstract).
Nakatsu, A. 1988. Changes in the composition of wild murid rodents captured in Asahikawa
Regional Forest Sub-Office area. Trans. Meeting. Hokkaido Branch. Jap. For. Soc. 36: 134—
136 (in Japanese).
Nakatsu, A. 1992. The present status and issues of vole damage to forests accompanied with the
changes in plantation condition, especially in the national forests of Hokkaido. Forest Pests
41:9—12 (in Japanese).
Ota, K. (ed.) 1984. Study on Wild Murid Rodents in Hokkaido. Hokkaido University Press,
Sapporo, 400 pp (in Japanese).
Ota, K., H. Abe, T. Kobayashi, Y. Fujimaki, S. Higuchi, B. Igarashi, T. Kuwahata, M. Maeda, M.
Ueda and T. Takayasu. 1977. A synecological study of murid rodents. Res. Bull. College
Exp. For. College Agr. Hokkaido Univ. 34: 119—160 (in Japanese with English abstract).
Saitoh, T. 1987. A time series and geographical analysis of population dynamics of the red-backed
vole in Hokkaido, Japan. Oececologia. 73 : 382 —388.
Saitoh T., N.C. Stenseth and O. N. Bjgrnstad. 1997. Density dependence in fluctuating grey-sided
vole populations. J. Anim. Ecol. 66: 14—24.
Sokal, R. R. and F. J. Rolf. 1995. Biometry, 3rd ed. W.H. Freeman and Company, New York, 887
pp.
Stenseth, N.C, O. N. Bjgrnstad and T. Saitoh. 1996. A gradient from stable to cyclic populations of
Clethrionomys rufocanus in Hokkaido, Japan. Proc. Roy. Soc. Lond. B 263: 1117-1126.
Tatewaki, M. 1958. Forest ecology of the islands of the north pacific ocean. J. Fac. Agr.
Hokkaido Univ. 50: 371—472.
Yui, M. and Y. Suzuki. 1987. The analyses of structure of the woodland bird communities in Japan
IV. Density, species diversity and diversity of breeding community in various forest types. J.
Yamashina Inst. Ornith. 19:13—27 (in Japanese with English abstract).
(accepted 29 January 1997)
Mammal Study 22: 39-44 (1997)
© the Mammalogical Society of Japan
Short Communication
Growth of eye lens weight and age estimation in the
northern red-backed vole, Clethrionomys rutilus
Kenichi TAKAHASHI and Kei SATOH
Hokkaido Institute of Public Health, N19 W12 Kita-ku, Sapporo O60, Japan
Fax. +81-11-736-9476, e-mail. takaken@iph. pref. hokkaido. jp
Age determination is a basic requirement when analyzing the ecological events
affecting wild animals. Several useful methods for age determination have
been reported for small rodents (see Pucek and Lowe 1975). Tooth wear
patterns and the molar root ratio have often been used to assess the ages of
Japanese rodents (Abe 1976, Fujimaki et a@/. 1976, Fujimaki 1977, Hikida and
Murakami 1980). Furthermore, since Lord (1959) proposed a method of age
determination using the eye lens weight (ELW) in cottontail rabbits, Lepus
americanus, it has become well-known that ELW can also be employed as an
age criterion in various species of Rodentia (Ostbye and Semb-Johansson 1970,
Gourley and Jannett 1975, Hagen et al. 1980, Thomas and Bellis 1980, Ando and
Shiraishi 1997 for the subfamily Microtinae, and Berry and Truslove 1968,
Adamczewska-Andrzejewska 1973, Yabe 1979, Okamoto 1980, Takada 1982,
Hardy et al. 1983, Takada 1996 for the subfamily Murinae). It is considered
that the ELW method of age estimation is more accurate than any other
technique relying on body or skull measurements (Pucek and Lowe 1975).
Moreover, this method has the advantage that it can be used for species which
have rootless molars such as Eothenomys smithi (Ando and Shiraishi 1997).
The growth of the molar roots of the northern red-backed vole, Cleth-
rionomys rutilus was examined as an indicator of absolute age by Tupikova et
al. (1968), and the relationship between lens weight and age was analyzed using
Specimens captured in the field (Askaner and Hansson 1967), however, no
previous data on the growth patterns of eye lens from known-age individuals
have been reported for this species.
An accurate method for age determination is of value not only for ecologi-
cal studies of C. rutilus itself, but also for analysis of the transmission pattern
of a zoonosis in a natural population. The latter is of particular significance
because C. vutilus is one of the favorable intermediate hosts of Echinococcus
multilocularis, a parasitic organism causing the serious disease alveolar
echinococcosis in humans, which has been found in Hokkaido, Japan (Takaha-
shi and Nakata 1995).
The purpose of the study described here, therefore, was to establish an age
estimation equation by analyzing the relationship between the growth in eye
lens weight and age in a population of known-age laboratory-reared northern
40) Mammal Study 22: 1997
red-backed voles.
MATERIALS AND METHODS
A total of 197 voles (91 males and 106 females) from a laboratory colony
originating from wild voles captured in Sapporo, Hokkaido were used in this
study. The laboratory colony was maintained under regulated conditions at a
temperature of 23-25°C a 12 hour light and 12 hour dark photoperiod and fed a
commercial diet (CMF, Oriental Yeast Co. Ltd.). Voles were reared individ-
ually in mouse cages except for during breeding. Male voles ranged in age
from 15 to 596 days, and females from 15 to 581 days. Voles were killed with
ethyl ether, their eyes were dissected out and fixed in 10% formalin at room
temperature for at least four weeks, then the optic lenses were excised and
washed with distilled water. Lenses were dried in an oven at 80°C for 24 hours
and immediately weighed to the nearest 0.01 mg on a microbalance (Mettler,
AT201).
RESULTS AND DISCUSSION
Lens weight was found to increase rapidly up to about day 50 and then the
growth rate decreased gradually in both males and females (Fig. 1), as has also
been noted for Lemmus lemmus (Ostbye and Semb-Johansson 1970). In this
study, ages were selected non-randomly and measured without error. For this
reason, in the regression analysis of this data, age is the independent variable
and lens weight the dependent variable with lens weight regressed on age
(Hagen et al.1980). Ages were logarithmically transformed, because the
growth pattern of lens weight was found to be curvilinear in C. rutilus (Fig. 1).
8
3 8
— 7 £ .
3 e° © e $ ¢ e
E 6] oc cides ad
®@ acs dey Ts
‘ °y, ee e
a 5 we 3
2 ging
3 4 .
= Female
2
re
(ey)
Oo
S
0 100 200 300 400 500 600 700 0 100 200 300 400 500 600 700
Age in days
Fig. 1 Growth of the eye lens weight in 91 male and 106 female northern red-backed voles,
Clethrionomys rutilus.
Age estimation in Clethrionomys rutilus 4]
Female
Y=-1.322+2.939X
r2 =0.908
Weight s of paired eye lenses (mg)
yb oO PP UW OD N @
yb © PB HT OD NI Oo
10 100 1000
days (log)
Fig.2 Relationship between log-transformed ages and eye lens weight in the northern
red-backed vole, Clethrionomys rutilus.
Moreover, array variance must be of equal magnitude along the length of the
line (homoscedasticity) in the regression analysis (Dapson 1980), and homo-
scedasticity was confirmed with the graphs showing residuals plotted against
Y; (the Y value on the line X;) for both sexes. The simple linear regression
relationship (Y =a+ bX) between X (age in days after logarithmic transform-
ation) and Y (lens weight) was applied (Fig. 2). Regression equations from our
data from C. rutilus were:
CD a— eds 3 000X. (72 —029355 p< 0e001) ton males
Qe —— 1h 322--2 .939X 1(72=0. 908) p< 0.001) for females
where Y =weight of paired lenses in mg, X =logiox, and x=age in days.
There were no significant differences in regression slopes between males
and females (F-test, Foa;=0.24, Fo.05(1,193) = 3.89, D> 0.05) (Table 1). Age was
predicted inversely from either equation (1) or (2), and predicted age was given
by the equation:
K=10°¥ +1.433)/3.000 for males
K=]10°Y +1322) /2.939 for females
The equation of the 95% confidence limits (L) for the inverse prediction is
given as follows:
Table 1. Statistics on the regression lines between the age and eye lens weight in the
northern red-backed vole, Clethrionomys rutilus.
Sex n a b Y ax iY S yx SSx t
Male 91 SASS OOO M ORI OVe= 25004 = a45760) OnS82a20 O38 BIE98 7
Female 106 32, 2839 0.953 Aol A.V Wee4o Aileos) ess
nm: number of samples, a: Y intercept, 0: slope, 7: correlation coefficient, X : mean of X,
Y : mean of Y, Syx: standard error of estimate, SSx : sum of squared deviations of X, t:
Sitidentsses) (aj0— a2) P0105):
42 Mammal Study 22: 1997
PER yh Y) +t) s9) ee a)? +K(444)|
mM nN
where X =the mean of X, Y =the mean of Y, K =b?—#?S,?, t=Student’s ¢ (d.
fi=n—2, p=0.05), S,=the standard error of the regression coefficient, S?yx=
the residual mean square, SSx =the sum of squared deviations of X, m=sample
size, and m=the number of individuals upon which predictions will be based.
Here, when m=0°, L indicates the confidence limits of the mean prediction for
the population. On the other hand, when m=1, L indicates the confidence
limits of the individual prediction (Dapson 1980, Sokal and Rohlf 1981).
When estimating the ages of individual animals, Dapson (1980) pointed out
the importance of presenting the 95% confidence limits, as the confidence
interval indicates the accuracy of an estimate of age for each specimen, and the
confidence interval for the individual prediction is generally broader than that
for the population. This certainly proved to be the case in C. rutilus (Tables
2 and 3). In this study, broader ranges in the 95% confidence interval were
observed among older animals because of the wide variance of lens weight and
the decrease in the growth rate in these older animals (Fig. 1).
Askaner and Hansson (1967) examined the relation between ELW and
molar root length of wild-caught C. rutilus, and pointed out the usefulness of
the ELW method for aging individuals of this species. The present study
provides, for the first time, an equation for age estimation based on ELWs of
known-age voles. Tupikova ef al. (1968) developed an age determination
Table 2. Predicted ages and confidence limits (95 %) for the mean and individual predictions
at given lens weights in the male northern red-backed vole, Clethrionomys rutilus.
Lens weight Predicted Mean predictions Individual predictions
(mg) age in days Lower age limit Upper age limit Lower age limit Upper age limit
5 9 8 UL 5 Mi)
De) 20 18 2 11 Si
315 44 40) 48 24 79
45 95 89 101 58 il
55 205 191 219 114 369
O.5 442 402 487 245 799
Table 3. Predicted ages and confidence limits (95 %) for the mean and individual predictions
at given lens weights in the female northern red-backed vole, Clethrionomys rutilus.
Lens weight Predicted Mean predictions Individual predictions
(mg) age in days [Lower age limit Upper age limit Lower age limit Upper age limit
1,5 9 d 10 4 18
ee) 19 17 22, 10 38
345 43 39 47 22 83
4.5 94 88 100 48 182
55 205 191 221 105 400
6.5 451 406 002 230 883
Age estimation in Clethrionomys rutilus 43
method for C. rutilus using the length of the root and the height of the crown
of M?, however, since the neck of M? in this species is not formed until three
months old, the ages of young voles under two months old cannot be predicted
by this method. The present results show that the ELW technique is capable
of estimating age in this species, especially in younger voles. For application
of this technique to field studies, however, we must pay attention to the wide
confidence interval in older voles.
Acknowledgments : We wish to express our cordial thanks to Professor
Hisashi Abe of Hokkaido University for his valuable advice on this manuscript,
and we dedicate this paper to him in celebration of his retirement from
Hokkaido University. We are also extremely grateful to Dr. Takashi Saitoh
of Hokkaido Research Center, Forestry and Forest Products Research Institute
and Dr. Akiro Ando of Shimane Prefectural Shimane Women’s College for their
kind comments and encouragement during this study.
REFERENCES
Abe, H. 1976. Age determination of Clethrionomys rufocanus bedfordiae (Thomas). Jap. J. Ecol. 26:
221—227 (in Japanese with English synopsis).
Adamczewska-Andrzejewska, K. 1973. Growth, variations and age criteria in Apodemus agrarius
(Pallas, 1771). Acta Theriol. 18,19 : 353—394.
Ando, A. and S. Shiraishi. 1997. Age determination in the Smith’s red-backed vole Eothenomys smithiz,
using optic lens weight. Mammal Study 22:xx—xx.
Askaner, T. and L. Hansson. 1967. The eye lens as an age indicator in small rodents. Oikos 18: 151—
1533
Berry, R. J.and G. M. Truslove. 1980. Age and eye lens weight in the house mouse. J. Zool., Lond.
ae ZAi— 252.
Dapson, R. W. 1980. Guidelines for statistical usage in age-estimation technics. J. Wildl. Manage.
44: 541—548.
Fujimaki, Y., S. Mizushima and H. Dewa. 1976. Age determination in two species of Apodemus. Jap.
Je col. 26 : 19= 23:
Fujimaki, Y. 1977. Age determination, growth and development in Apodemus argenteus. Mammal.
SOino 4: 2029.
Gourley, R.S. and F. J. Jannett. 1975. Pine and montane vole age estimates from eye lens weights. J.
Wildl. Manage. 39 : 550—556.
Hardy, A. R., R. J. Quy and L. W. Huson. 1983. Estimation of age in the Norway rat (Rattus norvegicus
Berkenhout) from the weight of the eye lens. J. Appl. Ecol. 20:97—102.
Hagen, A., N.C. Stenseth, E. Ostbye and H. J. Skar. 1980. The eye lens as an indicator in the root vole.
Acta Theriol. 25 : 39—50.
Hikida, T.and O. Murakami. 1980. Age determination of the Japanese wood mouse, Apodemus
speciosus. Jap. J. Ecol. 30:109—116 (in Japanese with English synopsis).
Lord, R.D. 1959. The lens as an indicator of age in cottontail rabbits. J. wildl. Manage. 23 : 350—360.
Ostbye E. and A. Semb-Johansson. 1970. The eye lens as an age indicator in the Norwegian lemming
(Lemmus lemmus (L.)). Nytt. Mag. Zool. 18 : 239—243.
Okamoto, K. 1980. Age determination by eye lens weight in the Norway rat. Jap. J. Sanit. Zool. 31:
193—200 (in Japanese with English summary).
Pucek, Z. and Lowe. V. P. W. 1975. Age criteria in small mammals. Jv (F. B. Golley, K. Petrusewicz
and L. Ryskowski, eds.) Small Mammals: Their Productivity and Population Dynamics. pp.
59—72. Cambridge University Press, Cambridge.
44 Mammal Study 22: 1997
Sokal, R. R. and F. J. Rohlf. 1981. Biometry (2nd ed.). W. H. Freeman, New York. 859pp.
Takada, Y. 1982. Life history of small mammals in fallow fields. 2. The eye lens weight as an age
indicator in the feral house mouse, Mus musculs molossinus. Seichou (J. Growth) 21:1—7 (in
Japanese with English summary).
Takada, Y. 1996. Eye lens weight as an age indicator in the harvest mouse, Micromys minutus and
age structure of wild populations. J. Mammal. Soc. Japan 36: 45—52.
Takahashi, K. and K. Nakata. 1995. Note on the first occurrence of larval Echinococcus multilocularis
in Clethrionomys vex in Hokkaido, Japan. J. Helminthol. 69 : 265—266.
Thomas, R.E. and E. D. Bellis. 1980. An eye-lens weight curve for determining age in Microtus
pennsylvanicus. J. Mammal. 61 : 561—563.
Tupikova, N.V., G. A.Sidorova and E. A. Konovalova. 1968. A method of age determination in
Clethrionomys. Acta Theriol. 13 :99—115.
Yabe,T. 1979. Eye lens weight as an age indicator in the Norway rat. J. Mammal.Soc. Japan 8:
HB),
(accepted 24 October 1997)
Mammal Study 22: 45-52 (1997)
© the Mammalogical Society of Japan
Age determination in the Smith’s red-backed vole,
EKothenomys smithii, using optic lens weight
Akiro ANDO! and Satoshi SHIRAISHI?
‘Department of Food Science, Shimane Prefectural Shimane Women’s College, Matsue 690, Japan
Fax. ta 81'-852-21-8150
2Zoological Laboratory, Faculty of Agriculture, Kyushu University 46-06, Fukuoka 812-81, Japan
Abstract. A technique for age determination based on the dry
weight of the optic lens was tested in Smith’s red-backed vole,
Eothenomys smithi. The model equation W=a+t+bdlog,A (W:
lens weight in mg, A: age in days, @ and b: parameters to be
estimated from data) was applied to our data from 65 known-age
laboratory-reared voles. As a result, the predicted age in days
(A) at a_ given lens weight (W) could be calculated from the
equation A=10'" *1419)/2131 For example, an individual with a lens
weighing 3.22 mg was estimated as having a predicted age of 150
days, and the 95% confidence interval at 150 days was calculated
to be 17 days (142-159 days, or 11.3% of the predicted age) for the
mean prediction and 144 days (94-238 days, or 96.0% of the predict-
ed age) for the individual prediction. Lens weight can, it appears,
provide the best age criterion at present, particularly in rodents
with rootless molars such as E. smithiz.
Key words: age determination, EKothenomys smithiz, lens weight, Microtinae,
red-backed vole. i
Information concerning age is a very important aspect of ecological studies of
wild animals. Many methods for age estimation have been proposed and used
in various mammalian species (see Morris 1972 for review). Among the
various methods available, the lens weight technique has been evaluated as a
useful and powerful technique in small to medium-sized mammals, such as
rodents (Hagen et al.1980 for Microtus oeconomus, Okamoto 1980 for Rattus
norvegicus, Tanikawa 1993 for Rattus rvattus, Takada 1982a for Mus musculus
molossinus, Takada 1982b for Apodemus speciosus), and lagomorphs (Load 1959
for Sylvilagus floridanus, Dudzinski and Mykytowycz 1961 for Oryctolagus
cuniculus, Connolly et al. 1969 for Lepus californicus, Bothma et al. 1972 for S.
floridanus, Hearn and Mercer 1988 for Lepus arcticus, Ando et al. 1992 for Lepus
brachyurus).
Smith’s red-backed vole, Eothenomys smithii, of the subfamily Microtinae,
is endemic to Japan, where it occurs widely in forested areas of Kyushu,
Shikoku, and western and central Honshu (Kaneko 1992). In contrast to the
Japanese gray red-backed vole, Clethrionomys rufocanus bedfordiae (Abe 1976)
and the large Japanese field mouse A. speciosus (Hikida and Murakami 1980),
46 Mammal Study 22: 1997
neither the molar root ratio, nor the molar wear pattern, can be employed as an
age criterion in FE. smithiz, since its molars are rootless and grow persistently.
No information has been available on age estimation in E. smithiz. For the
experiment described here, age was estimated for individual E. smithiz, based
on the optic lens weight of known-age individuals, using statistical treatments
recommended by Dapson (1980).
MATERIALS AND METHODS
1. Lenses
The Eothenomys smithit used for this study were obtained from a labora-
tory colony which originated from wild voles live-trapped on Mt. Wakasugi in
Fukuoka Prefecture, northern Kyushu. The colony was maintained under
controlled conditions, 7.e., temperatures of 15-20 °C and photoperiods of 12-13
hr light: 12-11 hr dark (Ando et al.1988). A total of 65 voles (33 males, 32
females) ranging in age from 20 to 600 days were killed with ethyl ether. Both
right and left eyes were dissected out and placed individually in 10% formalin
for two to three weeks, then the optic lenses were carefully removed. After
being rinsed with distilled water, the lenses were dried at 80 °C for two days and
weighed to the nearest 0.01 mg on an analytic balance (Mettler AE-100). The
combined dry weight of both right and left lenses of each individual vole was
used for statistical analysis (Table 1).
Table 1. The combined lens weight of the right and left eyes in 65 known-age Smith’s
red-backed voles, Eothenomys smithit.
Age Lens weight Age Lens weight Age Lens weight
(days) (mg) (days) (mg) (days) (mg)
20 1eZ9 140 334116) 259 Sar)
20 LoS? 140 3) core) ZOD) 3.80
20 SH 142 2.98 255 3.60
aD Lea 160 D5 /49 258 3.94
a7, 1.92 160 3.08 282 3.80
BY 1.84 160 3) 5 AS) 282 3.90
38 Loos 160 2.85 282 3.80
43 eyes) 160 3 Jha! 300 aecill
44 Dent 176 3.48 300 4.18
44 7) 50) 180 ZZ, 300 4.03
44 eM 180 3.80 350 wy DL
50 Df 180 B sO 350 4025
50 2.06 180 SAS 400 4.00
60 Zijiy MO) 200 3.44 468 bbe
70 1 S$) 200 BLAS) 900 4.60
80 Zea0, 200 3.00 990 4.00
100 2.61 200 D2) 990 AR,
105 3) 5 A! 200 3.36 600 4.40
120 2.69 200 Oe 600 Aa,
120 2.92 214 3.50 600 4.44
140 S02 236 3.43 600 AaAN
140 3.36 250 3.78
Age determination in a red-backed vole A7
2. Statistical procedure
The mathematical model for the relationship between lens weight (W) and
age in days (A) pioneered by Hagen e¢ a/. (1980) and Takada (1982a, 1982b) was
used for this study, 7.é.,
WV = GOO“! (1)
where a and 0 are parameters to be estimated from the data set. Here, when
we define W=Y and log,A=X in this model, the equation (1) could be Y =
a+ bX, thereby, making linear regression analysis available for the relation-
ship between Y (lens weight) and X (age in days after logarithmic transforma-
tion). In the regression analysis, data of X and Y should exhibit homoscedas-
ticity (Dapson 1980, Zar 1984), which we confirmed for our data in accordance
with Zar’s (1984) procedure.
The linear regression equation Y =a+6X refers to the regression of Y
(the dependent variable) on X (the independent variable). When estimating
age using dry lens weight, the lens weight (W) should be regressed on age (A)
(Ishii 1975, Hagen et al. 1980, Zar 1984). Therefore, a predicted age X, fora
given lens weight Y, and the confidence limits of X; should be calculated on the
basis of the procedure known as inverse prediction (Dapson 1980, Zar 1984).
Using this procedure, the predicted X; at a given Y; is given by the equation
a Neo)
Aisi pw
and the confidence limit L (L,, the upper limit; L,, the lower limit) is calculated
from the equation
ibe eT, pGG=s4) iy 2 (Y,—Y)? ik it
pk sey Sol KG tT)
where X =the mean of X, Y =the mean of Y, K =6?— ??s,?, s,=the standard
error of the regression coefficient, S}x=the residual mean square, SSx=the
sum of squared deviations of X, t=Student’s ¢t (df=n-2, p=0.05), and n=
sample size (Dapson 1980, Zar 1984). When m=co, L indicates the confidence
limits of the mean prediction for the population, and when m=1, L represents
the confidence limits of the individual prediction (Dapson 1980). For the
purposes of this study, X and L have been logarithmically transformed, so that
10*: gives the predicted age in days and 10” gives its confidence limits.
In this study, data from both males and females were combined for the
regression analysis since no significant difference was detected in the slope and
elevation of the regression line between males and females. As for the figure
showing the regression line with 95% confidence limits (see Fig. 1), we followed
the presentation of Hagen ef a/. (1980). Although lens weight was regressed on
age, we used the ordinate for the independent variable (age) and the abscissa for
the dependent variable (lens weight) because the age was predicted by inverse
prediction.
48 Mammal! Study 22: 1997
RESULTS AND DISCUSSION
The regression line and its 95% confidence limits for the individual predict-
ion are shown in Fig.l. The linear regression equation from our data in
Eothenomys smithit was proved to be
W =—1.4154+2.131 logy.A
and therefore a predicted age in days (A) for a given lens weight in mg (W) was
given by the equation
A — ] QW +1.415)/2.131
The slope and Y intercept of the regression line, and statistics necessary for
calculating the confidence limit are presented in Table 2. Table 2 also
includes comparable information from the root vole, Microtus oeconomus
(Hagen et al. 1980), the feral house mouse, M. m. molossinus (Takada 1982a)
and the large Japanese field mouse, Apodemus speciosus (Takada 1982b).
days
2000
1000
®
™ 100
<
10
1 2 3 4 5
Lens weight
Fig. 1. The relationship between the dry weight of the optic lenses (both the right and left
lenses combined) and age in days in 65 known-age Smith’s red-backed voles, Eothenomys
smithii. The solid line indicates the regression line, and broken lines its 95% confidence
limits for the individual prediction based on inverse prediction. Note that the vertical axis
was used for the independent (age) variable, and horizontal axis for the dependent (lens
weight) variable, although lens weight was regressed on age.
Age determination in a red-backed vole 49
Table 2. Statistics required for calculating the predicted ages and 95 % cofidence limits of
the Smith’s red-backed vole, Eothenomys smithii, the root vole, Microtus oeconomus, the feral
house mouse, Mus musculus molossinus, and the large Japanese field mouse, Apodemus
speciosus.
species n a b ry x 7 Syx Syx/Y SSx t
E. smithit 6oy lr415 Zee Of ey Zee sie2zo SObZISeeOPOCGORMOS20h 21-998
This study
M. oeconomun SI SE 41S) Oss ILS S08 OO 0.0400 2.886 2.045
Hagen et al. (1980)
M. m. molossinus (Beek else OL 916) 1 994 Me >eZ8ile e856. 020600 102608 12994
Takada (1982a)
A. speciosus 1A (Aelita) 98S a Ms orewl4 2625) s0nSOre 005495) 1230 2179
Takada (1982b)
n: sample size,a: Y intercept, b: slope, 7: correlation coefficient, X : mean of X, Y : meanof Y,
Syx : standard error of estimate, SSx: sum of squared deviations of X, ¢: Student’s ¢ (da f=n—2,
p=0.05).
Dapson (1980) and Zar (1984) both recommended the presentation of Syx/ Y
(the standard error of estimate (Syx) divided by the mean of Y (Y)), as an
indicator for assessing the fitness of the regression and the accuracy of the
technique. Smaller values of Syx/Y indicate better fitness of the regression.
The value of Syx/Y for E. smithii (0.0660) is very close to that for M. m.
molossinus (0.0677) (Takada 1982a), but larger than the values for either /.
oeconomus (0.0400) (Hagen et al. 1980) or A. speciosus (0.0549) (Takada 1982b).
When studies, which have used the regression analysis for age estimation, are
compared (e.g., those on M. oeconomus [Hagen et al. 1980], M. m. molossinus
[Takada 1982a], A. sbeciosus [Takada 1982b], S. floridanus [Load 1959], L.
californicus [Connolly et al.1969], L. arcticus [Hearn and Mercer 1988] and L.
brachyurus | Ando et al.1992]), Syx/Y is found to range from 0.0400 to 0.0823
(calculated by us). It is accordingly inferred that when the regression line fits
the data well, Syx/ Y may be smaller than ca. 0.083 in small to medium-sized
mammals such as rodents and lagomorphs. Since the value for E. smzthiz
(0.0660) falls within the middle of this range, it can be said that our data from
FE. smithi fit the model equation (1) well.
Confidence intervals also indicate the accuracy of estimates derived from
an age determination technique (Dapson 1980). Table 3 shows the predicted
age (A) ata given lens weight (W), its 95% confidence limits for the mean
prediction and that for the individual prediction in E. smithiz. The 95% confi-
dence interval for the mean prediction at the mean of X (z.e., X =2.1769, the
predicted age of 150 days) was calculated to be 17 days, occupying 11.3% of the
predicted age (150 days). Similar figures have also been obtained for /.
oeconomus (8.0%, Hagen et al. 1980), for M. m. molossinus (10%, Takada 1982a)
and for A. speciosus (15%, Takada 1982b). In E. smithiz, the 95% confidence
interval (144 days) for the individual prediction, at the mean of X, occupied
96.0 % of the predicted age (150 days). The corresponding figure for M.
oeconomus is 48 % (Hagen et al. 1980), for M. m. molossinus 83 % (Takada
50 Mammal Study 22: 1997
Table 3. 95 percent confidence limits of predicted ages (A) for the Smith’s red-backed vole,
Eothenomys smithit.
; Mean predictions Individual predictions
Lens weight Age Ss
W (mg) A (days) Lower age Upper age Lower age Upper age
limit (days) limit (days) limit (days) limit (days)
36 20 iy 23 12 Sy
1608 30 Dil 33 19 48
2.20 50 46 54 31 80
Day? 70 66 77 45 114
2.85 100 94 106 63 159
S22 150 142 159 94 238
3.49 200 189 ALS 126 318
3.86 300 280 323 189 479
4.04 365 338 397 230 584
4.13 400 369 437 Za 641
AOS) 500 466 563 320 820
4.50 600 044 669 376 967
1982a) and for A. speciosus 55% (Takada 1982b). The 95% confidence interval
for E. smithit was similar for the mean prediction, but was slightly broader for
the individual prediction, when compared with the three other species.
Although the confidence limits are influenced by various factors, such as
sample size, the degree of dispersion of data, the mean of X and so on, increas-
ing the sample size may be one possible way to improve the accuracy of age
estimation of FE. smithiz.
The combined dry weights of both right and left lenses from 52 wild E.
smithii captured on Mt. Wakasugi ranged from 1.95 to 4.49 mg (Ando unpub-
lished data). From the equations defined above, a vole with a maximum lens
weight of 4.49 mg would be estimated to be 591 days old, with the 95% confi-
dence limits giving a range of 371 to 952 days for the individual prediction.
About 80% of the voles (41/52) possessed lenses weighing below 4.04 mg indicat-
ing 365 days of a predicted age. Although there have been some field studies
on population dynamics of E. smithi (Tanaka 1964, Igarashi 1980), no informa-
tion has been available on the longevity of individuals in the wild, for instance,
based on the capture-recapture method. Judging from the existence of voles
with lenses weighing over 4.04 mg, it would appear, however, that some individ-
uals in the wild could survive for over one year. In the laboratory, E. smithi
has been known to live for more than three years (Ando et a/. 1988). Field
studies, in combination with the lens weight technique, are necessary in order
to confirm the usefulness of the technique, especially in older voles.
Researchers on rodents have typically used wear of the tooth surface, and
the length or the ratio of molar roots to determine age (Abe 1976 for Cleth-
rionomys rufocanus bedfordiae, Hikida and Murakami 1980 for Apodemus
speciosus, Alibhai 1980 for Clethrionomys glareolus). These methods, however,
Age determination in a red-backed vole ol
can only be employed in rodents which have rooted molars, and Takada (1982a,
1982b) has already demonstrated that even in M. m. molossinus and A. speciosus
which have rooted molars, the lens weight technique may be more reliable than
the technique depending on the tooth wear. It should be emphasized, therefore,
that the lens weight technique provides the best criterion for assessing age at
present, particularly in rodents with rootless molars such as E. smithiz.
Acknowledgments: We wish to thank Professor Yoshihira Yamamoto,
Shimane Prefectural Shimame Women’s College for his encouragement and
Associate Professor Caroline E. Kano, Shimane Prefectural Shimame Women’s
College for her kindly checking an English draft. We are also grateful to
anonymous referees and Mark A. Brazil for valuable comments on the final
manuscript.
REFERENCES
Abe, H. 1976. Age determination of Clethrionomys rufocanus bedfordiae (Thomas). Jap. J. Ecol. 26:
221—227 (in Japanese with English synopsis).
Alibhai, S. K. 1980. An X-ray technique for ageing Bank voles (Clethrionomys glareolus) using the
first mandibular molar. J. Zool., Lond. 191 : 418—423.
Ando, A., S. Shiraishi and T. A. Uchida. 1988. Reproduction in a laboratory colony of the Smith’s
red-backed vole, Eothenomys smithit. J. Mammal. Soc. Japan 13: 11—20.
Ando, A., F. Yamada, A. Taniguchi and S. Shiraishi. 1992. Age determination by the eye lens
weight in the Japanese Hare, Lepus brachyurus brachyurus and its application to two local
populations. Sci. Bull. Fac. Agr., Kyushu Univ. 46:169—175 (in Japanese with English sum-
mary).
Bothma, J. P., J.G. Teer and C. E. Gates. 1972. Growth and age determination of the cottontail in
South Texas. J. Wildl. Manage. 36: 1209—1221.
Connolly, G. E., M. L. Dudzinski and W. M. Longhurst. 1969. The eye lens as an indicator of age in
the black-tailed jack rabbit. J. Wildl. Manage. 33: 159—164.
Dapson, R. W. 1980. Guidelines for statistical usage in age-estimation technics. J. Wildl. Manage.
44: 541—548.
Dudzinski, M. L. and R. Mykytowycz. 1961. The eye lens as an indicator of age in the wild rabbit
in Australia. CSIRO Wildl. Res. 6: 156—159.
Hagen, A., N.C. Stenseth, E. Ostbye and H.-J.Skar. 1980. The eye lens as an indicator in the root
vole. Acta Theriol. 25: 39—50.
Hearn, B. J.and W.E. Mercer. 1988. Eye-lens weight as an indicator of age in Newfoundland arctic
hares. Wildl. Soc. Bull. 16 : 426—429.
Hikida, T.and O. Murakami. 1980. Age determination of the Japanese wood mouse, Apodemus
speciosus. Jap. J. Ecol. 30:109—116 (in Japanese with English synopsis).
Igarashi, Y. 1980. Studies on the population fluctuation of the Smith’s red-backed vole, Eothenomys
smithi (Thomas), in young plantations of Sugi and Hinoki in the central highlands of Shikoku.
Bull. For. & For. Prod. Res. Inst. (311): 45—64 (in Japanese with English summary).
Ishii, S. 1975. Introduction of Statistics in Biology. Baifukan Publ. Co., Tokyo, 288pp (in Japanese).
Kaneko, Y. 1992. Mammals of Japan. 17. Eothenomys smithii (Smith’s red-backed vole). Honyurui
Kagaku [Mammalian Science] 32 :39—54 (in Japanese).
Load, R. D., 1959. The lens as an indicator of age in cottontail rabbits. J. Wildl. Mamage. 23 : 350—
360.
Morris, P. 1972. A review of mammalian age determination methods. Mammal. Rev. 2: 69—104.
Okamoto, K. 1980. Age determination by eye lens weight in the Norway rat. Jap. J. Sanit. Zool. 31:
57 Mammal Study 22: 1997
193—200 (in Japanese with English summary).
Takada, Y. 1982a. Life history of small mammals in fallow fields. 2. The eye lens weight as an age
indicator in the feral house mouse, Mus musculus molossinus. Seichou [J. Growth] 21:1—7
(in Japanese with English summary).
Takada, Y. 1982b. Life history of small mammals in fallow fields. 4. The eye lens weight as an age
indicator in the large Japanese field mouse, Apodemus speciosus. Seichou [J. Growth] 21: 8—
11 (in Japanese with English summary).
Tanaka, R. 1964. Population dynamics of the Smith’s red-backed vole in highlands of Shikoku.
Res. Popul. Ecol. 6 :54—66.
Tanikawa, T. 1993. An eye-lens weight curve for determing age in black rats, Rattus rattus. J.
Mammal. Soc. Japan 18: 49—51.
Zar, J. H. 1984. Biostatistical Analysis. 2nd ed. Prentice-Hall, Englewood Cliffs, N. J., 718pp.
(accepted 26 March 1997)
Mammal Study 22: 53-70 (1997)
© the Mammalogical Society of Japan
Postnatal growth, development and ultrasonic
vocalization,of young Japanese field voles,
Microtus montebelli
Yuko YOSHINAGA, Wakako OHNO and Satoshi SHIRAISHI
Zoological Laboratory, Faculty of Agriculture, Kyushu University, Fukuoka 812-81, Japan
Fax. +81-92-642-2804, e-mail. yyoshi @ agr. kyushu-u. ac. jp
Abstract. Both postnatal growth and development of Japanese
field voles, Microtus montebelli, were observed in a laboratory
colony. Details of the developmental aspects of the life-history of
this species are described focusing on behavioral development
including ultrasonic vocalization, sexual dimorphism and the use
of sigmoidal models of growth patterns. One purpose of the study
was to provide a reliable basis for age-estimation of a wild popula-
tion prior to conducting field investigations. The overall pattern
of development of M. montebelli was similar to that of other
Microtus species, particularly in their relatively rapid develop-
ment. Young M. montebelli were found to vocalize intensively at
an ultrasonic frequency of approximately 25 kHz until their eyes
opened. The Gompertz equation was selected from three non-
linear growth models (Gompertz, logistic and von Bertalanffy), as
it best described the curves of body mass increase and of four
external lengths, and it best estimated maximum growth rates
derived from the Gompertz equations fitted to actual rates during
a linear growth phase. These features of the Gompertz equation
seemed to be useful for analyzing growth patterns of wild voles.
After 30 days, growth curves for each morphometric parameter
diverged sexually, thus, weight-classes used for age estimation
should differ between the sexes.
Key words: growth curve, Microtus montebelli, postnatal development, sexual
dimorphism, ultrasonic vocalization.
Microtus voles grow relatively rapidly when compared with other muroid
rodents (Zullinger et al. 1984, Dewsbury 1990), although they appear to show
considerable interspecific variation in rates of postnatal development even
under similar laboratory conditions (Nadeau 1985, Innes and Millar 1994). It is
suggested that among Microtus species, some aspects of interspecific variation
in postnatal development correlate with their type of social organization, 7.e.,
monogamous species tend to develop physically and behaviorally more slowly
than polygamous species (Kleiman 1977, McGuire and Novak 1984, 1986,
Dewsbury 1990). To make such a correlation clear, data on development as
well as on mating systems are required from a substantial number of animals
from within a restricted taxonomic group, yet from a group that shows a
54 Mammal Study 22: 1997
diversity of ecological adaptations. The genus Microtus offers an excellent
opportunity for this.
Physical development, growth and the reproductive patterns of the
Japanese, field vole, M@. montebelli, are well documented (Shiraishi 1969, Miyao
1974, Obara 1975, Kudo and Oki 1982). Since variability in these character-
istics may exist among local populations of a given species, it is necessary to
collect all such data from voles from a single targeted population. Further-
more, for M. montebelli little information has been reported on the subjects of
fitting sigmoidal models to growth patterns on the appearance of sexual
dimorphism, behavioral development or on ultrasonic vocalization by infants.
The latter is of particular interest given that interspecific variation in ultra-
sonic vocalization has recently been the focus of correlations with social
systems (B. H. Blake personal communication).
Field researchers often assign captured voles to age-classes (typically
juvenile, subadult and adult) on the basis of their weight when caught. As
voles from different localities may differ in body size (Bondrup-Nielsen and Ims
1990), it is important to confirm how old the voles in each age-class are on the
basis of the weights of known-age voles from the same study population.
Moreover, this may be an effective mean of making more detailed age-
estimation and growth analyses by restoring original growth curves from
sporadic field data. With this aim in mind, it is important to test statistically
the effectiveness of fit of growth models using known-age samples.
Our primary aim, therefore, in writing this paper is to describe the details
of the developmental aspects of MW. montebelli, focusing on fitting various
models to growth patterns, and to describe the appearance of sexual dimorph-
ism and behavioral development including ultrasonic vocalization, as compo-
nents of the species’ life-history. Our secondary aim is to provide a reliable
basis for age-estimation of a vole population at our study site prior to conduct-
ing field investigations.
MATERIALS AND METHODS
The captive breeding colony of voles used in this study was derived from
wild-caught M. montebelli from a meadow on the northern rim of Mt. Aso,
Kumamoto Prefecture, Japan. Pairs of voles were housed in stainless steel
cages (2025 x43cm) with chambers containing straw and cotton wool as
nesting material. The growth patterns of their infants (7.e., of first generation
laboratory-born voles) were observed. The room in which the colony was
housed was maintained at 22+2°C with a 14 hour light and 10 hour dark
photoperiod (the lights were switched on each day at 08: 00). A commercial
herbivore diet (ZF, Oriental Yeast, Tokyo) and water were provided ad libitum
with an occasional supplement of sweet potato. Newborn voles were left with
their parents from birth (day 0) until 20 days old, when they were removed and
housed together with their litter mates until approximately 60 days old.
Thereafter, males and females were housed separately.
Yoshinaga et al., Postnatal growth of Japanese field voles 55)
Fourteen male and 14 female M. montebelli from seven litters were observ-
ed closely from birth until day 20. Each infant was removed from its natal
nest, placed on to a 50 cm diameter glass tray and its behaviour was monitored
for two minutes each day using an 8-mm video recorder (CCD-V800, Sony,
Tokyo) connected to a Mini-2 bat detector (Ultra Sound Advice, London, UK)
set to 25kHz. This frequency was selected as the frequency at which infant
vocalizations were most easily detected, after preliminary tests made at inter-
vals of 5kHz. Because ultrasonic vocalizations were likely to change in their
duration over time in the preliminary tests, we noted whether vocalizations
were sustained for more than one minute (continuous vocalization) or not
(discontinuous vocalization), that is more than half of the two minute observ-
ation periods. Physical development was also observed, and obvious changes
in the eyes, ears, digits, incisors and pelage were recorded individually.
Ten males and 10 females from five litters were used as subjects for
measurements of five variables. These were: body length (from snout tip to
anus), tail length (from anus to tail tip), hind foot length (without claw), ear
length and body mass. These measurements were made every second day
from day 0 to day 20, every 5days to day 50, then every 10 days to day 150.
Weight was measured to the nearest 0.01 g on an electronic balance (PJ3000,
Mettler, Switzerland), and length was measured to the nearest 0.1mm with a
ruler or vernier callipers. To compensate for the reduction in sample size
caused by deaths before weaning, additional growth data were obtained after
day 20 from another litter consisting of one male and four females.
Growth curves were fitted with non-linear regression models using iter-
ative least squares (Zullinger et a/.1984). Three sigmoidal equations were
used in this study :
the Gompertz equation,
WAG) =A xX oper
the logistic equation,
VE ct) VA ie a alten
and the von Bertalanffy equation,
Vi) VAL ect / 3) coe anlee 3
where M(t) =mass (g) or length (mm) at age t, A=asymptotic value, K =
growth rate constant (day~'), and / =age (days) at the inflection point (Ricklefs
1967).
The abilities of these three equations to fit the growth data were compared
in relation to: correlation coefficients, coefficients of variation in estimated
parameters (A, K, and J), and the residual sum of squares. To compare rates
of early growth between males and females, we also calculated simple linear
regression equations for mass and lengths over a linear growth phase. A
linear growth phase was defined as a period when mass or length increased
relatively constantly each day. Sexual differences reflected by regression
56 Mammal Study 22: 1997
equations were tested using the ¢-test following Zar (1984). Maximum growth
rates at inflection points (WGRe) were estimated from the parameters of the
best fit equations (Ricklefs 1967), and were compared with the observed
maximum increases of mass and length per day (WGRo) and the regression
coefficients (6), in order to evaluate the usefulness of growth parameters
estimated by curve fitting. The formulae for MGRz were as follows:
for the Gompertz equation,
MGR:e=K XAX1/e
for the logistic equation,
MGR:=K XAX1/2
and for the von Bertalanffy equation,
MGR:r=K XAX8/27
The statistical significance of differences between the sexes was tested
using an unpaired two-tailed t-test for the age at which developmental events
occurred. All statistical analyses follow Zar (1984). Means are expressed
plus or minus one standard deviation.
RESULTS
1. Physical development
Neonates were essentially naked, but with short pale hairs and pigment-
ation just detectable on their backs. Neonates had attached digits, folded ear
pinnae and eyelids and lacked erupted teeth. As they grew, their hair gradually
became denser, their ear pinnae unfolded (day 2.50.6), their digits separated,
their incisors erupted and their auditory meatus (day 7.30.6) and their eyes
(day 8.3+0.9) opened. Each event occurred within a range of 1-3 days, and no
sexual differences were observed (¢ values ranged from 0.20 to 2.05, all p >0.05).
In females, teats became noticeable at day 1.7+1.1. To identify the order of
digit separation, digits were numbered one to five from the innermost digit, the
first digits in the fore foot were, however, invisible externally.
The outermost digits separated first with digits 4-5 in the fore foot separat-
ing on day 3.90.7, and digits 4-5 in the hind foot separating on day 4.8£0.7,
n=28), then the innermost digits separated, digits 2-3 in the fore foot on day
5.60.7, and digits 1-2 in the hind foot on day 5.10.9), and finally the remain-
ing digits became separated (3-4 on the fore foot on day 6.80.6 and 2-3 on the
hind foot on day 7.40.8 and 3-4 on the hind foot on day 7.40.8). Each fore
foot digit separated significantly earlier than its hind foot homologue (¢ values
ranged from 2.86 to 8.63, p<0.01). The lower incisors (day 5.60.6) erupted
before the upper incisors (day 5.90.7) in every individual. All individuals
completed their external development by day 10, by which time their eyes had
opened and their juvenile pelage was complete (day 9.60.7). Pups ingested
solid food from day 9 or 10 onwards (day 9.30.5, m=28) and this did not differ
Yoshinaga et al., Postnatal growth of Japanese field voles Di
between males and females (t=0.39, p=0.699).
2. Behavioral development
Nine activities were distinguishable during the daily two minute observ-
ation periods. These were: resting, rolling over, pivoting, crawling, walking
unsteadily, normal walking, moving backwards, grooming and standing up.
Of these nine, the last three were relatively capricious and their developmental
stages were not so clear. Rolling over, pivoting, crawling and unsteady
walking were specific to younger voles, and mobility developed in this order
(Fig. la, b). Neonates were entirely immobile. They were unsteady even
while resting and 70% of them rolled over.
a
100
80
605
40
Percentage
unsteadily
walk
normally
Percentage
vocalize
continuously
over 1 min
vocalize
discontinuously
Percentage
Age (days)
Fig. 1. Behavioral development of infant Japanese field voles for the first 20 days (n=28).
Each column indicates the percentage of individuals which showed behaviors specific to a
younger stage, a) rolling over and pivoting, b) moving forward, c) ultrasonic vocalizations
during the two minute observation.
58 Mammal Study 22: 1997
The age at which each activity commenced or disappeared ranged from
3-10 days, and this did not differ between the sexes (¢ values ranged from 0.19
to 0.83, p>0.4). After day 14, all individuals were able to walk normally, and
by this age they were adult-like in all their activities.
3. Ultrasonic vocalization
Ultrasonic vocalizations at around 25 kHz were first emitted as early as
day 0.50.9 (days 0-3). Continuous vocalization was recorded for 65% of all
neonates (Fig. 1c). Young voles emitted ultrasound especially when they were
rolling over, and most individuals (75-96% of examinations) vocalized until day
8, when their eyes opened. Continuous vocalizing was last recorded on day
5.142.1 (days 0-8). After day 9, all vocalizing became discontinuous and fewer
than 50% of young voles vocalized at 25 kHz, although some pups continued to
vocalize until day 14 (day 10.3 + 2.1 on average). It was clear, therefore, that
the incidence and duration of ultrasonic vocalizations among neonates changed
once their eyes had opened.
4. Growth curves
The body size of neonate males and females was similar. Neonate males
weighed 2.99+0.38 g (n=10) and neonate females (x=10) weighed 2.83+0.44 g
({=0.87, p=0.394), body lengths were 38.5+2.3 mm for males and 37.7+2.9 mm
for females (f=0.69, p=0.502), tail lengths were 8.4+0.7 mm and 8.6+0.9 mm
({=0.78, p=0.448), and hind foot lengths were 6.6£0.5mm and 6.4+0.4 mm
respectively (f=0.91, p=0.375).
Body mass increased almost continuously from birth for the first 90 days
for males, and for the first 60 days for females (Fig. 2, upper graph). For the
first 30 days the growth curves of male and female body mass did not differ
(Fig. 2), however the slopes of male (0.74 g/day, 7?=0.995, F =2145.9, p=0.0001)
and female (0.69 g/day, r?=0.996, F =2646.1, p=0.0001) regression lines differed
significantly (t=2.27, p=0.034). Thereafter, growth rates of males were gener-
ally greater than those of females (Fig. 2, lower graph) and the growth curves
of males and females continued to diverge (Fig. 2, upper graph).
Male and female body length increased linearly for the first 14 days (Fig.
3, lower graph) with the slopes of male and female regression lines not differing
significantly (t=0.54, p=0.600). The common regression coefficient was 2.9
mm/day (v?=0.995, F =2888.2, p=0.0001). Similarly, increases in tail length
over the first 20 days (t=0.56, p=0.585, Fig. 4, lower graph) in hind foot length
over the first 10 days (t=0.48, p=0.646, Fig. 5, lower graph) and in ear length
over the first 14 days (t=0.93, p=0.369, Fig. 6, lower graph) were all judged to
be linear with regression line slopes that did not differ between males and
females. The common regression coefficients for males and females, of tail,
hind foot and ear lengths were 1.4 mm/day (7v?=0.995, F = 4383.7, p=0.0001), 0.9
mm/day (7?=0.995, F =1929.5, p=0.0001) and 0.5 mm/day (7?=0.989, F =1215.0,
p=0.0001), respectively. Thus, it was apparent that during the linear growth
phases, differences in body, tail, hind foot and ear lengths between malen and
Yoshinaga et al., Postnatal growth of Japanese field voles 59
50
40
30 . A 0 ) 0 e
20 Yi
Body mass (g)
107 —o— Female
0 30 60 90 120 150
Growth rate (g/day)
©
BS
0 | 30 60 90 120 150
Age (days)
Fig. 2. Gompertz plots for postnatal mean body mass (upper graph) and growth rates per day
(lower graph) against age in the Japanese field vole. Actual data points are represented by
solid circles (male, »=10) and open circles (female, n=10). Vertical bars indicate + 1 SD.
Growth parameters are found in Table 1.
60 Mammal Study 22: 1997
—e— Male
40 —o— Female
Body length (mm)
0 | 30 60 90 120 150
©
aS
=a,
(
0 hoa ee
Growth rate (mm/day)
0 30 60 wr): 120 150
Age (days)
Fig. 3. Gompertz plots for postnatal mean body length (upper graph) and growth rates per
day (lower graph) against age in the Japanese field vole. Actual data points are represented
by solid circles (male, ~=10) and open circles (female, m=10). Vertical bars indicate + 1
SD. Growth parameters are found in Table 1.
Yoshinaga et al., Postnatal growth of Japanese field voles 61
50
ee ee SR
Bay) 80: ie
= y)
E 4
ww 30 4
< (e
~ °
0) f
c N
& 20 ff —e— Male
= Nis —o— Female
fm t )
104%
0
0 30 60 90 120 150
2
> 1.5 | :
0 ‘ata
=~ O e
=
E 1 v e
. \
= 0.5
: <, |
ex O - Ja e =
2 0 ao RGA
1) :
-0.5
0 30 60 90 120 150
Age (days)
Fig. 4. Gompertz plots for postnatal mean tail length (upper graph) and growth rates per day
(lower graph) against age in the Japanese field vole. Actual data points are represented by
solid circles (male, »=10) and open circles (female, ~=10). Vertical bars indicate + 1 SD.
Growth parameters are found in Table 1.
62 Mammal Study 22: 1997
20
-«~ ifr"
E fy
E 15
al ces
ol
0) e
{eas
®@ 107
rs) ; —e— Male
© f —o— Female
O
e°*
a
0 S
0 30 60 90 120 150
1.4
1.2
=
eS
Growth rate (mm/day)
©
roy)
0.2 : t
0 et, —- e 0 f {>> SO < Se
-0.2 i
0 30 60 90 120 150
Age (days)
Fig. 5. Gompertz plots for postnatal mean hind foot length (upper graph) and growth rates
per day (lower graph) against age in the Japanese field vole. Actual data points are
represented by solid circles (male, m=10) and open circles (female, ~=10). Vertical bars
indicate + 1 SD. Growth parameters are found in Table 1.
Yoshinaga et al., Postnatal growth of Japanese field voles 63
Ear length (mm)
0 30 60 90 120 150
Growth rate (mm/day)
0 30 60 90 120 150
Age (days)
Fig.6. Gompertz plots for postnatal mean ear length (upper graph) and growth rates per day
(lower graph) against age in the Japanese field vole. Actula data points are represented by
solid circles (male, m=10) and open circles (female, 7=10). Vertical bars indicate + 1 SD.
Growth parameters are found in Table 1.
64 Mammal Study 22: 1997
females were not detectable, however at about day 30 the growth curves of all
lengths diverged sexually (Figs. 3-6, upper graphs).
Although body mass showed considerable variation (Fig. 2, upper graph),
we were able to assign individual voles to one of three age-classes on the basis
of body mass (Fig. 7). Among males, 85% of individuals which weighed 15-25
g (n=33) were younger than 30 days, 94% of individuals which weighed 25-35
g (n=51) were 30 to 90 days old, and 69% of individuals weighing over 35 g (n=
86) were more than 90 days old (Fig. 7). Among females, which were lighter
than males, 93% of those weighing 15-20 g (7=28) were less than 30 days old,
61% of those weighing 20-30 g (7=93) were 30-90 days old, and 67% of those
weighing over 30 g (v=39) were more than 90 days old (Fig. 7).
100 a. Male
80
rb)
do)
& 60
|
®
© 40
i)
a.
20 Yy
15-20 20-25 25-30 30-35 35-40 over 40
b. Female
100
80
®
od)
S 60
Cc
@o
© 40
cab)
a.
0715-20 20-25 25-30 30-
Body mass (g)
Fig. 7. The relationship between weight-classes and age-classes. Each colums indicates the
percentage of individuals under 30 days (ff), 30-60 days ([ |), 60-90 days (4) over 90 days
of age ({_]) in a) males and b) females in each weight class at intervals of 5 g.
Yoshinaga et al., Postnatal growth of Japanese field voles 65
5. Models for postnatal growth
Data on postnatal growth were evaluated based on three non-linear models
(Gompertz, logistic and von Bertalanffy equations, parameter estimates for the
best fit equations are summarized in Table 1). The predicted values had
correlation coefficients over 0.99 in all cases (Table 1). Because of these high
correlations, it was difficult to distinguish graphically among the three models,
however, after deriving an equation based on each growth model, we chose the
Gompertz equation on the basis of the statistical characteristics of the parame-
ter estimates.
For all three models, the model showing the lowest residual sum of squares
varied with each parameter, for example, the von Bertalanffy equation was
Table 1. Growth parameters in the Japanese field vole, M. montebelli, derived from the
Gompertz, logistic and von Bertalanffy equations.
Asymptote Growth rate constant —_ Inflection point
Residual Coefficient Coefficient Coefficient
sum of of variation Estimate of variation Estimate of variation
Model Sex squares yr _ Estimate* (%) (days”') (%) (days) (%)
Body mass Gompertz M 2.0293) 10N998e 43230 ee ORSS LO SO04O3 NEE OE SS 18.3 2.39
F 20.36.50: 9965 30nI2 = S02 02065555 74289 S5 3.80
Logistic M Sallie Osos AZAR) ZO Oey es Belt! Dilea 0 3.14
F 30 407 408993" 297 10 IE 2 0209538" Os07 15 3.84
von Bertalanffy M On W989) 23073 ace! OUBEYA Salil! 13.9 BAG)
F 1733202996 S0833N 089%, W0E05625) 44.49 8.4 4.64
Body length Gompertz M 84.84 0.998 118.60 0.52 0.0621 3.40 0.8 41.76
F 73.84 0.997 109.43 0.49 0.0759 3.48 0.4 5S
Logitic Mise 17430995 salln90 en ORi2 0K0783 5 4288 6.7 6.56
PAD SOI OLE MOS O259 YY OsC SC aay DES 6.40
von Bertalanffy M OLAS OE S98 Ise S0r ety 0n0n69> 2-90 =1°7 SES
F Obe85" OE998 109266" 0247 = 2020695a° 3228 =e 19.50
Tail length Gompertz M U8) O83 40.60) 0.68 OnOsts- S205 6.4 3.36
F Isicove WON — 489 | Oe W029 Aer 5.6 3.44
Logistic M ZTARGATM ORO S a= AG 28 = 0262 ee OEIZ8Ze" = 3.8 10.9 2.48
F LOSSS 0998 ASRS ass ee ORISSA) Mgr a4 9.6 DJA |
von Bertalanffy M SSE ORS OS RAG GSae 02 5oO) Se ORORMZe Bel 4.1 5.60
F IG305 O88 48.58" — Ose0 VOSS > "E27 3.6 6.18
Hind foot length Gompertz M 20 OR99Sn 1 ORAG eam 0229) Oe 546 9 2250 0.9 13.95
F est O83 = MSOF. Wes¥e 9 OMe se = Aatsill 0.9 14.02
Logistic M L589 OO - IO4Z0> = Mesh Ons — Bars 3.4 3.61
F V8 OSES MS Ol Ss OA) “OLA ILS Boe 2.38
von Gertalanffy M 4h} O98 I9.49 O83 Osan 2.7 =() 77 (gol
F WS OSO AUS a), ESS) We bY S385) =a (vlna GUA
Ear length Gompertz M IEOZ. OVS Wace) — Oa Wsilbyisy 215s} do) 3.89
F 2.0 O885 WO68 Oss “OsNeZo 5.0? Ro) 4.42
Logistic M 0.87 O08 Mee» O44 O.7IE) B383 8.2 1.81
F Lik} Os99G" — MOD). — Ose Ws2E0I 415 8.0 e183
von Bertalanffy M ZH Veo = Me OSI. SOIC, B83 Apa 6.24
F D1 O9Oil Ws — Oe Mae 58% 4.2 6.75
*Weight in g and length in mm.
66 Mammal Study 22: 1997
lowest for body mass and length, the Gompertz equation was lowest for tail
length, the logistic equation was lowest for ear length, and the Gompertz and
logistic equations were lowest for male and female hind foot length, respective-
ly (Table 1). The coefficients of variation (a measure of the variation that
each parameter exhibits, and the reliability of each parameter without affecting
the overall predictive capability of the model) for the estimates of growth
parameters of asymptotic values (A) and growth rate constants (K) were
consistently less, when derived from the model yielding the lowest residual sum
of squares (Table 1). When considering inflection points J, the lowest coeffic-
ient of variation was obtained from the logistic equation for all measurements
except for body mass. For each approximation where the logistic or von
Bertalanffy equation resulted in the lowest residual sum of squares, and the
lowest coefficient of variation in A and K, the next best approximation was
always provided by the Gompertz model. For these two criteria, the logistic
equation provided the worst approximation for body mass and length of the
three models, while the von Bertalanffy equation provided the worst approxi-
mation of hind foot and ear lengths. Thus the Gompertz model was chosen as
the best compromise for approximating all growth curves for M. montebellt,
since even those measures best fit by either the logistic or von Bertalanffy
models also fitted reasonably well with the Gompertz model. The lines in the
upper graphs of Figs. 2-6, portray growth curves predicted by Gompertz equa-
tions.
When comparing the estimated maximum growth rates (WGRe) derived
from fitted Gompertz, logistic and von Bertalanffy equations, a consistent
pattern was found in the relative magnitudes of their values (Table 2). The
MGRe value was greatest with the logistic equation and least with the von
Bertalanffy equation. Since MGRze values derived from the logistic equation
were consistently greater than either the observed maximum growth rates
Table 2. Comparisons among observed maximum growth rates (WGRo) estimated maxi-
mum growth rates derived from three sigmoidal models (M/GRe) and regression coefficients
during linear growth phases (0) in five measurements.
MGReE
Measure Sex MGRo b Gompertz’ _ logistic’ von Bertalanffy*
Body mass (g/day) M 0.94 0.74 0.74 145 (51
F 0.98 0.69 ORG 1.42 0.51
Body length (mm/day) M 3.83 DS Do Hk 4.62 2.00
F 35 M9) “Atak 3.06 5) A 2220
Tail length (mm/day) M 1.89 1.36 eit 2.84 Oi
F 1.89 1.38 159 2.98 eels
Hind foot length (mm/day) M 1 23 0.94 Ul 1.91 0.82
F 110 0.92 1.16 2.00 0.85
Ear length (mm/day) M 0.76 0.52 0.62 WS 0.44
F 0.76 0.55 0.67 1.26 0.47
‘MGRe=K XAX1/e, *? MGRe=K XAX1/2, * MGRe=K X AX8/27
Yoshinaga et al., Postnatal growth of Japanese field voles 67
(MGR o) or the slopes of regression lines during the linear growth phase (0),
those values were considered likely to overestimate growth rates during rapid
growth phases (Table 2). Conversely, MGRe values from the von Bertalanffy
equation were consistently lower than either MGRo or b values. MGRz values
obtained from the Gompertz equation were closest to MGRo and bd values of
these three equations in most cases. Thus, the Gompertz equation was again
selected as the best model for approximating the growth rates of M. montebelli.
When comparing the estimated maximum growth rates (MGR -«) from fitted
Gompertz equations and observed maximum growth rates (WGRo) and regres-
sion coefficients (6), MGRo values were higher than the other two values in
almost all cases. MGRe tended to approximate 06, which reflects average
growth rates during the linear growth phase (Table 2). Observed growth rates
fluctuated considerably even when growth seemed to be more linear (Figs. 2-6,
lower graphs), so it is suggested that WGRz« values derived from the Gompertz
equation are a good indication of average growth rates during linear growth
phases.
DISCUSSION
The overall patterns of physical and behavioral development of the
Japanese field vole, VM. montebelli, fall within the ranges exhibited by other
Microtus species (Pepin and Baron 1978, Nadeau 1985). The growth rate of
mass, 0.7 g/day, calculated as the slope of simple regression line places this
species within a group with moderate growth rates among the 15 other species
of Microtus reviewed by Innes and Millar (1994). Innes and Millar (1994) also
found, however, significant positive correlations among Microtus species
between female weight and certain other traits, such as litter size, neonate
weight and growth rate to weaning. Thus, interspecific comparisons of
growth rates should be made after growth rates have been standardized by
female weights.
When standardized growth rates (weight increase per day as a percentage
of female weight) are compared among 13 Microtus species, M. montebelli (2.33
% per day, this study) ranks as the second most rapidly growing species (others
range from 0.94% to 3.14% per day, calculated from Innes and Millar’s [1994]
data). Although few data relating to postnatal development are available for
comparison with this study, the age at which eyes open has been reported for
a number of Microtus species, and is used as an index of maturation (Dewsbury
1990). The eyes of M. montebelli open earlier (day 8.3) than in either /.
ochrogaster, M. pinetorum, M. montanus or M. pennsylvanicus (days 9.1-11.7,
Dewsbury 1990). Thus, it seems that M. montebelli belongs to a rapidly
developing sub-group of Microtus species. Kleiman (1977) considered that a
long period of maturation for young voles was a characteristic of monogamy,
suggesting, therefore, that the rapid growth pattern of young M. montebelli may
be related to non-monogamous traits.
According to Glucksmann (1974), sexually dimorphic animals are unlikely
68 Mammal Study 22: 1997
to exhibit sexual differences until puberty. Young M. montebelli certainly
showed no sexual differences in physical development (completed by day 10), or
in the processes of behavioral development (completed by day 14), and until
about day 30, the growth curves of body mass and of four external measure-
ments were indistinguishable between males and females. After 30 days the
growth curves of males and females diverged clearly, and males became larger
than females. Even during the linear growth phase, rates of growth of body
mass differed sexually, although other measurements did not.
A reasonable explanation for male-biased sexual dimorphism among
microtine voles has been made only in relation to types of mating systems
(Heske and Ostfeld 1990, Boonstra et al. 1993). Through interspecific compari-
sons among Muicrotus species, the ratios of male to female body masses fall
roughly into three groups corresponding to their mating systems: 1.0 for
monogamous species, 1.2 for promiscuous species and 1.3 for polygynous
species (Yoshinaga et al.1997b). Thus, the apparent male-biased sexual
dimorphism in M. montebelli seems to indicate that they may be polygynous.
Observations appear to support this in as much as during the breeding season,
resident male wild M. montebelli maintain intra-sexual exclusive home ranges
which overlap with those of several females (Yoshinaga unpublished data).
There appear to be, however, several discrepancies in previous reports on the
correlation between degrees of sexual dimorphism and mating systems in
microtine species (Dewsbury et al. 1980, Boonstra et al. 1993, Ostfeld and Heske
1993), indicating that more detailed and more reliable data on development and
mating systems among voles are necessary in order to discuss more effectively
underlying theories explaining such correlations.
For age-estimation in the field, voles could be assigned to three age-classes,
1.€., juveniles (voles younger than 30 days), subadults (30 to 90 days) and adults
(older than 90 days), on the basis of growth in body mass data from the labora-
tory colony. Since M. montebelli is sexually dimorphic, weight criteria for
each age-class should differ between males and females. For males, for exam-
ple, voles weighing 15-25 g should be considered juvenile, those weighing 25-35
g should be considered subadult, and those weighing over 35 g adults, whereas
for females, the weight criteria for each age-class should be 5 g lighter than in
males. These age-weight classes should be applicable for field studies of M.
montebelli in our region.
Moreover, more detailed age-estimation and growth analyses may be
effectively achieved by restoring original growth curves from sporadic field
data. During most field studies, rates of weight increase are only available
between consecutive captures. Since growth curves of many mammals are
sigmoid (Zullinger et al. 1984), the relationship between weight and weight
increase should theoretically follow a differentiated sigmoidal equation. For
modeling growth patterns of M. montebelli, the Gompertz equation was selected
from three sigmoidal models tested statistically in this study. The differentiat-
ed Gompertz equation has also been demonstrated to fit a data set of weights
and weight increases collected from wild voles (Yoshinaga et al. 1997a).
Yoshinaga et al., Postnatal growth of Japanese field voles 69
Restored growth curves of wild voles have asymptotic weights which differ
according to the month of birth (Yoshinaga eft al. 1997a), thus it may be of great
value to use the generated growth curves for age-estimation of captured voles.
Acknowledgments : The comments and criticisms of Dr. T. Mori, of the Kyushu
University were helpful during the preparation of the manuscript, and the
manuscript was further improved by comments from Dr. B. Chisholm of the
University of British Columbia. Dr. M. Brazil kindly improved the English of
the final manuscript.
REFERENCES
Bondrup- Nielsen, S. and R. A. Ims. 1990. Reversed sexual size dimorphism in microtines: are females
larger than males or are males smaller than females? Evol. Ecol. 4: 261—272.
Boonstra, R., B.S. Gilbert and C. J. Krebs. 1993. Mating systems and sexual dimorphism in mass in
microtines. J. Mammal. 74 : 224—229.
Dewsbury, D. A. 1990. Individual attributes generate contrasting degrees of sociality in voles. Jn (R.
H. Tamarin, R.S. Ostfeld, S.R. Pugh and G. Bujalska, eds.) Social Systems and Population
Cycles in Voles. pp. 1—10. Birkhauser, Basel, Switzerland.
Dewsbury, D. A., D. J. Baumgardner, R. L. Evans and D.G. Webster. 1980. Sexual dimorphism for
body mass in 13 taxa of muroid rodents under laboratory conditions. J. Mammal. 61: 146—
149.
Glucksmann, A. 1974. Sexual dimorphism in mammals. Biol. Rev. 49 : 423—475.
Heske, E. J. and R. S. Ostfeld. 1990. Sexual dimorphism in size, relative size of testis, and mating
systems in north American voles. J. Mammal. 71:510—519.
Innes, D.G.L.and J.S. Millar. 1994. Life histories of Clethrionomys and Maicrotus (Microtinae).
Mammal Rev. 24 : 179—207.
Kleiman, D.G.1977. Monogamy in mammals. Quart. Rev. Biol. 52 :39—69.
Kudo, H.and Y.Oki. 1982. Breeding and rearing of Japanese field voles (Microtus montebelli
Milne-Edwards) and Hungarian voles (Microtus arvalis Pallas) as new herbivorous laboratory
animal species. Exp. Anim. 31:175—183 (in Japanese with English summary).
McGuire, B. and M. Novak. 1984. A comparison of maternal behaviour in the meadow vole (Microtus
pennsylvanicus), prairie vole (M. ochrogaster) and pine vole (M. Pinetorum). Anim. Behav. 32:
Ie = joel
McGuire, B. and M. Novak. 1986. Parental care and its relationship to social organization in the
montane vole (Microtus montanus). J. Mammal. 67 :305—311.
Miyao, T.1974. Ecological niche and growth~- synthesis of the specific characters in Microtus
montebelli.- J. Growth 13:61—71 (in Japanese).
Nadeau, J. H. 1985. Ontogeny. Jv (R. H. Tamarin, ed.) Biology of New World Microtus. pp. 254—285.
Sp. Publ. No. 8. Amer. Soc. Mammal.
Obara, I. 1975. Growth and development of Microtus montebelli. J. Mammal. Soc. Japan 6: 107—114
(in Japanese with English summary).
Ostfeld, R. S. and E. J. Heske. 1993. Sexual dimorphism and mating systems in voles. J. Mammal. 74:
7) = ORor
Pepin, F. and G. Baron. 1978. Development postnatal de l’activité motrice chez Microtus penn-
sylvanicus. Can. J. Zool. 56 : 1092—1102.
Ricklefs, R. E. 1967. A graphical method of fitting equations to growth curves. Ecology 48 : 978—
983.
Shiraishi, S. 1969. Growth and development of the Japanese field vole, Microtus montebelli. Trans.
80th Mtg. Jpn. For. Soc. 259—260 (in Japanese).
Yoshinaga, Y., T.Okayama, T. Mori and S. Shiraishi. 1997a. Estimation of seasonally changing
70 Mammal Study 22: 1997
growth curves in wild Japanese field voles, Microtus montebelli. J. Fac. Agr., Kyushu Univ.
Al : 189—196.
Yoshinaga, Y., T. Okayama, W. Ohno and S. Shiraishi. 1997b. Growth, development, and reproduc-
tive patterns in the Japanese field vole, Microtus montebelli. J. Mammal. 78 : 830—838.
Zar, J. H. 1984. Biostatistical Analysis. Prentice-Hall, Inc., Englewood Cliffs, New Jersey, 718 pp.
Zullinger, E. M., R. E. Ricklefs, K. H. Redford and G. M. Mace. 1984. Fitting sigmoidal equations to
mammalian growth curves. J. Mammal. 65 : 607—636.
(accepted 9 September 1997)
Mammal Study 22: 71-80 (1997)
© the Mammalogical Society of Japan
Acquisition of food begging behavior by red foxes in
the Shiretoko National Park, Hokkaido, Japan
Hideharu TSUKADA
Regional Sciences, Faculty of Letters, Hokkaido University, N1IO W7 Kita-ku, Sapporo O60, Japan
(Present address : Laboratory of Parasitology, Graduate School of Veterinary Medicine, Hokkaido
University, NI8 W9 Kita-ku, Sapporo O60, Japan)
Fax, +81-11-717-7569, e-mail. tsuka @ vetmed. hokudai. ac. jp
Abstract. In order to solve traffic problems and to understand
possible epidemic risks resulting from the feeding of wild red
foxes, Vulpes vulpes, the acquisition of food begging behavior by
foxes in the Shiretoko National Park, Hokkaido, Japan was
studied. Foxes were individually identified and their behavior
was observed from June to October each year from 1992 to 1994.
The locations of family territories and denning sites were estab-
lished, and the degree of their tolerance to humans was investigat-
ed, and the relevancy of these factors in food begging behavior
was examined. The development of food begging behavior
among individuals less than one year old was strongly correlated
(p <0.01) with their dens being within 20 m of the road edge. Most
juveniles which were not born in dens near the roadside showed no
food begging behavior and most individuals more than one year
old, which had not previously shown such behavior did not acquire
it at all, strongly suggesting that food begging behavior was
predominantly acquired by juveniles denning near roads. Thus,
preventing foxes from denning near roads should be an effective
means to obstruct the acquisition of begging behavior.
Key words: food begging behavior, tolerance to humans, Shiretoko National
Park, Vulpes vulpes schrenckt.
Feeding wildlife is considered to be an undesirable recreation, which not only
has considerable impact on wildlife (Nature Conservation Society of Japan
1978), but may also lead to risks for humans. Injuries to people have been
caused for example by grizzly, Ursus arctos, and black bears, U. americanus
(McCullough 1982, Robinson and Bolen 1989, Herrero and Fleck 1990, Wright
1992) in North America and by Japanese monkeys, Macaca fuscata (Wada 1989)
in Japan, and Japanese monkeys have caused damage to crops as a result of
feeding (Nature Conservation Society of Japan 1978, Wada 1989).
In the Shiretoko National Park (SNP), many red foxes, Vulpes vulpes
schrencki, have been fed by park visitors since 1970 (Tsukada 1994, Watanabe
and Tsukada 1996). The foxes have appeared on the road through the SNP
during the daytime, some of them even lying down in the center of the road in
order to stop vehicles and to obtain food from the drivers and passengers.
iz, Mammal Study 22: 1997
Some traffic accidents have occurred as a result of this behavior, when drivers
have dodged foxes on the road. Traffic jams have also occurred in the SNP
when vehicles have parked haphazardly to feed the foxes on the road during the
peak visitor period of the summer vacation.
Some foxes in the SNP have become tame enough to be fed by hand by
visitors who, by doing so, unwittingly run the risk of infection, because red
foxes in Hokkaido are a definitive host of Echinococcus multilocularis which
causes alveolar hydatid disease in humans (Yamashita 1978). Humans become
infected accidentally by ingestion of the parasite’s eggs deposited in fox feces
(Yamashita 1978). Kondo et al. (1986) found that between 10% and 60% of the
foxes in eastern Hokkaido were infected with this parasite. Coproantigen
detection of fox feces (Nonaka et al.1996) has confirmed the presence of
echinococcus infection among some foxes inhabiting the SNP (Nonaka in
prep.). When dogs are infected by Echinococcus multilocularis, various body
surfaces, particularly of the anal area, the claws, femora and nose are typically
contaminated with echinococcus eggs (Yamashita 1978), and this pattern is
believed likely in infected foxes. As a consequence, direct physical contact
with infected foxes begging for human food may, therefore, increase the risk of
the transmission of this disease.
Although prohibiting park visitors from feeding wild foxes would help
resolve these problems, there is no legal foundation for such a prohibition. In
reality, it is very difficult to stop visitors to the SNP from tossing feeding foxes
by hand, even where signs prohibiting the feeding of wild animals have been set
up. Controlling the food begging behavior of red foxes is the obvious alterna-
tive, however previous studies have not attempted to clarify the conditions
under which foxes come to be fed by people (Aoi ef al. 1988).
In this paper, a study analyzing how foxes come to be fed by people is
described, and means for controlling fox behavior are suggested.
MATERIALS AND METHODS
1. Study area
The field study was carried out in the Shiretoko National Park (SNP) (44°
06’N, 145° 03’E) in the eastern part of the northern Japanese island of Hokkaido.
Every year 1.5 million tourists visit the SNP. An intensive investigation was
conducted along the approximately 20 km of main road which crosses the SNP.
Half of the length of the road is paved and about 7.5m wide, while the other
half is narrow (5m wide) and unpaved (Fig. 1). The whole road is closed
throughout winter, from November to May, because of deep snow.
2. Observation of food begging behavior
The food begging behavior of foxes was defined as: 1) appearing on or
alongside the road during the daytime when people might visit, and 2) staying
in positions where drivers or passengers could notice them.
Forty-three foxes (18 males and 25 females) begging for food along the road
Tsukada, Red fox food begging behavior 73
~~ Sea Shore
— Paved wide road (about 7.5m wide)
Unpaved narrow road (about 5m wide)
[__] Terriotry of each fox family
Fig. 1. Distribution of fox family territories in Shiretoko National Park. Territories II, IV,
V, VI, VII and VIII are drawn on the basis of 95% Minimum Convex Polygons (MCP) of all
locations of radio-collared females in reproductive condition from May to August 1993.
Territory III is drawn by 95% MCP of all locations of a radio-collared male from May to
August 1994. Territory I is roughly drawn from many sightings of its residents.
were captured either by using handmade blow darts, or padded foothold traps
(Victor Soft Catch, Wood Stream Co.), and fitted with individually identifiable
colored ear tags (Allflex 25, Allflex New Zealand Ltd.). Standard mor-
phometrics such as body weight, body length and hind leg length were recorded.
Individuals were assigned to one of three age classes (less than one year old, one
year old, and more than one year old) which were determined by the annual
attrition of incisors (Harris 1978). Because female foxes are capable of breed-
ing at 10 months of age (Ables 1975), animals less than one year old were
considered to be juveniles, and those one or more years old were adults.
Whether pups were being reared by females was evaluated by the development
of their nipples from May to July in 1992-1994.
Foxes which could not be captured but which were observed begging
several times were identified by unique features such as pelage characteristics
and scars, and by the location at which they appeared.
Observations of foxes begging were made from a car while driving along
the main road through the SNP during the period from June to October in 1993
and 1994. Trips were conducted every two hours from 07 : 00 to 17: 00 for two
days each month, with additional trips made at random. Observations in 1992
were only conducted at random. The number of days of observation each
month varied from seven to 21 (Table 2).
3. Identification of fox families :
As in other areas, related adult foxes in the Shiretoko National Park
usually shared common territories (Macdonald 1981, 1983, Murder 1985, Poulle
et al. 1994, Tsukada 1997). Therefore, foxes appearing along the same sec-
tions of the SNP road were judged to share the same territories, while foxes
74 Mammal Study 22: 1997
appearing at several widely dispersed locations were regarded as itinerants
without territories. When there was at least one female in reproductive
condition among members sharing a territory, the group was defined as a
“reproductive family”. The size of a reproductive family was counted in each
territory during the years of the study.
Fox dens were searched for by tracking in the snow during the winters of
1992 and 1993. As some reproductive families built their dens near the road,
signs of these den sites were searched for along the “roadside”, that is within
20 m of each shoulder of the road during the period from May to August when
the dens are usually occupied and used for pup-rearing.
4. The Degree of tolerance to humans
To evaluate the degree of tolerance to humans, each fox was approached
and the distance at which the fox began to flee was recorded (Table 1). The
investigation was conducted more than once for each animal between June and
October 1994. Mean scores were calculated for each animal and used as an
index of the degree of their tolerance towards humans.
Table 1. The scores and criteria of degrees of tolerance to humans in foxes.
Scores Criteria
Fox begins to flee ;
when a vehicle approaches
when the researcher alights from the vehicle at > 5m
when the researcher approaches to a distance > 5m
when the researcher approaches to a distance > 3 and <5m
when the researcher approaches to a distance > 1 and < 3m
Dm oO FP WW DL FF
when the researcher approaches to a distance < 1m or does not flee
RESULTS
Fifty foxes were observed begging for food from people during the study
period. Twenty-eight of these (12 males and 16 females) were adults, six (2
males and 4 females) were juveniles at first but later became adults and 22 (sex
unknown) were juveniles. Eight territories were confirmed by radio-tracking
(Table 2), four territories (I-IV) were located along the wide paved section of
the SNP road, while the other four (V-VIII) were located along the narrow
unpaved section (Fig.1). The locations and sizes of these territories were
essentially stable during the years 1992-1994.
The number of adult foxes observed begging, and the time they spent
begging each year varied among the various territories. In territories I, II and
III, the maximum number of adults observed begging was two, whereas in
territory Vl it was three; and in- IV, V; Vilvand VUE it was tourn ihe
maximum number of adults begging in each territory and in each year was
significantly higher in territories along the narrow unpaved section of the SNP
Tsukada, Red fox food begging behavior 15
road than in territories along the wide paved section (U-test, p<0.01). In
territories I and II, adults continued begging until August, while in territories
IV-VIII, adults continued the behavior until October (Table 2). The total
number of adults begging decreased during September and October each year.
Some adults such as the breeding males in territories I and VI and a breeding
female in territory III were not observed begging during the study period, even
though other members in the same territories were (Table 2). These foxes and
a breeding male in territory II in 1994 were observed to avoid all humans.
Juveniles from a total of 11 reproductive families were observed begging
for food (Table 3). The reproductive families with at least one juvenile beg-
ging shared one important feature in common in the selection of their den sites,
Table 2. Identified foxes which showed food begging behavior each month from 1992 to 1994.
Solid circles and triangles indicate adult and juveniles begging human food, respectively.
Open circles and triangles indicate adult and juvenile foxes, which did not beg human food,
respectively. Figures under months are observation days in 1992, 1993 and 1994 from left to
right.
Territory Fox code Sex Jun Jul Aug Sep Oct
lanl Bs Zaks 2G Ds 235 20 e224 IW, a8
I Fu F C2 O31 cO1 80s Oo O1OF MONON On HOVOn@
II Hi M @ @ ee ee @©n@ O@
Ne F @o@e@e@0e0e08 000000 O00
Ill Mo M e@o@e@e@ 060608 06080 OO O®
IV No M e@o@e@ @080@ @080@ @@0O 68 ®@
Ki F e@o@e@ @0060@8 @00@ @8@0 6808
Th F OOee co0@0 0088 O00 O00
V Na M @oe@ee eee Ox x ) OO ®@ @@o
Oi F eee eee eee eee @o
le M & 6 e@ ® ®
aet F eee @008 080 e@ @ ee
Oeb M A @ A ®@ A A A
VI Se F @o@e0 6000800800808 08080
Sks F A @ A ®@ A @ A
Vil Hy M @o@e@ 600 e0ee0@0oe@e@0 @8@0
Ga F eee eee eee Oe@ @@o
Gak F A@@ A@@ A®@®@ ISO") A ®@®@
Gdk F A @ A @ A @ A ®@ AO
Vill Ka M @ @ e@ @ @o OO @ O@O
Nea F Oe ®@ O@e@ O@e@ ©C..O..© @@o
On F O@OdO O@o eee © @O:O @oo
Or F O@O O@od @@o O@O OO @
Ty F O@O°O O@O @@o © ©7© @oo
Itinerant Si M CFO © O'O'O *" Or OO"? "O1O%O" 19 OO
Ma M ClO OOF O©(O* 1 OO" OjnnrOs@nOni © -©O"O
M M OChOFO— O° O-O YVO'OtOs HOLOvO M48 © ©
76 Mammal Study 22: 1997
Table 3. Correlationship of begging human food by juvenile foxes with the shift of their dens
toward the roadside (20 m or less from road shoulders). Begging food by one or more
juveniles in each reproductive family is indicated as “+”. Den shift toward the roadside of
the main road in the national park is indicated as “+”, and the earliest date of confirmation
for the den shift is shown in parentheses.
Reproductive family
I II Ill IV
Begging Roadsideden Begging Roadsideden Begging Roadsideden Begging Roadside den
1992 = = no reproduction _ + (6 Aug) = =
1993 “IF + (17 July) = = _ = 5F + (20 July)
1994 + + (22 June) = = — = oo + (12 July)
V VI VII Vill
Begging Roadsideden Begging Roadsideden Begging Roadsideden Begging Roadside den
1992 sF + (29 May) z = =F + (3 July) rt >
1993 te +(9 June) 4 + (24 June) + + (23 June) = =
1994 + — — — = + (29 June) = =
that is, 10 out of these 11 families moved their dens to the roadside during June
and July (Table 3). Conversely, 11 out of the 12 reproductive families which
did not move their dens to the roadside also had no juvenile which begged
(Table 3). Therefore, whether a juvenile showed food begging behavior or not
was significantly correlated with whether its family moved their den to the
roadside or not (Fisher’s exact probability test, ><0.01). However, the number
of families wherein at least one juvenile begged did not differ significantly
between the territories along the wide paved road and those along the narrow
unpaved section (Fisher’s exact probably test, p >0.05).
The degree of tolerance towards humans was measured among 21 adult
foxes. The mean score, 3.66 (range: 1.4-5.9, SE : 1.20) did not differ between
age classes, sexes or the reproductive conditions of females (U-test, p >0.05 ;
Tables 2 and 4). The foxes in the territories along the narrow unpaved section
of the SNP road, however, showed a significantly higher degree of tolerance to
humans than those in the territories along the wide paved section (p<0.01).
The most highly tolerant foxes lay down in the center of the road in order to
Table 4. The degree of tolerance to humans among adult foxes which
showed food begging behavior in 1994 comparing age, sex, reproductive
condition of females and the road-type in territories.
Fox categories nm Mean Se U-test
One year old a 62 0.37
More than | year old IO BachD 0.29 p>0.05
Adult male 6335 0.34
Adult female Ie Sons 06350 9 pe 0805
Female in reproductive condition KO SaAld 0.42
Female in non-reproductive condition ete Cedi 0.56 p>0.05
Wide paved road t PeN2 54 0.38
Narrow unpaved road 4 P4672 Ob23 a5 SPOR Oil
Tsukada, Red fox food begging behavior 17
stop vehicles and were willing to be fed by hand.
Only two adults began begging halfway through the study period. One of
these was the male “Ka” in territory VIII, which first began begging for food
in May 1993. Even on first contact, “Ka” did not flee, moreover, he approa-
ched the survey vehicle even though he had not previously taken food from
visitors there. “Ka” was thereafter observed frequently even at night, and
showed a high degree of tolerance with a score of 4.5. The other was the adult
female “Th”, which first began begging in April 1993. Her behavior was
unique in that she began by fleeing as a vehicle approached, but then stayed
within sight of the driver and waited to be fed. “Th” was less tolerant of
humans in 1993 and this tendency did not change in 1994. Her degree of
tolerance towards humans was the lowest scored (1.4) during this study.
DISCUSSION
There was a strong correlation between the acquisition of begging behav-
ior among juveniles and denning near the road. This correlation could be
accounted for partly by the fact that juveniles usually confine their activities to
the area around their den until July, after which they are taken on exploratory
trips by adults (Henry 1986, personal observations). None of the juveniles
denning away from the roadside, however, began begging even when they were
able to move around the whole of their parent’s range during September and
October (personal observations). This strongly supports the belief that den-
ning near the road is an important contributory factor in the acquisition of
begging behavior among juveniles. The numerous opportunities for interact-
ing with people along the road near their den, and for contact with adults
already showing begging behavior might facilitate the learning of the same
habit among juveniles.
Some adults were not observed begging at any time during the study
period, even though other individuals living in the same territories were.
Furthermore, only two adults commenced begging during the study period.
However, one of the two, the adult male “Ka” was considered to have already
acquired the begging habit somewhere else before settling in territory VIII in
spring 1993, because he was observed begging when he could not have had any
opportunities to learn the behavior in the territory. The other individual “Th”
began begging in April 1993, but differed from other foxes in that she was
extremely intolerant of people. It appears, therefore, that acquiring the beg-
ging habit is difficult for adult foxes.
The degree of tolerance to humans and the duration of begging among
adults differed among territories. Seasonal variation in begging behavior
among red foxes in the SNP depends on the availability of its major natural
food items (Tsukada and Nonaka 1996). It is assumed, therefore, that the
differences in begging behavior observed among adults were related to the
availability of natural foods in each territory. Indeed, each territory was
located in a slightly different habitat, which would lead to differences in the
78 Mammal Study 22: 1997
available food items among neighboring territories (Macdonald 1981).
Adults in the territories along the narrow unpaved section of the SNP road
showed a high degree of tolerance to people. Two possible reasons for this
should be considered. Firstly, that highly tolerant foxes choose territories
along this section of the road, or join a family with such a territory. Secondly,
that environmental conditions along this section of the road encourage foxes to
be more tolerant. |
A fox family is usually composed of a matrilineal kinship group (Mac-
donald 1983). Hence, migration of adult females between families does not
occur. In fact, only adult males migrated into certain family territories in the
study area (unpubl. data). Furthermore, the locations of the territories chang-
ed little over three years (Tsukada 1997), and had probably not changed over a
longer period (Watanabe and Tsukada 1996). Therefore, the first possible
reason is unacceptable. On the narrow unpaved section of the road, the view
is blocked by numerous roadside trees and blind corners. Under these condi-
tions begging foxes must endure the closer approach of vehicles and people here
than on the wider paved section. Furthermore, the narrow shoulders of the
unpaved section prevents foxes from taking food from visitors at a distance.
Hence, foxes in territories along this section would become more tolerant than
those in territories along the wider paved section. A similar effect of road
structure where they usually forage on tolerance to people has also been
observed among Japanese macaques (Sugiura et al. 1993).
In conclusion, begging is a behavior readily acquired by juvenile foxes
denning near roads, but is not typically acquired by adults. Environmental
factors, such as road type did not affect acquisition of begging behavior, but the
degree of tolerance to people among adults did. Therefore, the most effective
means of controlling begging by red foxes would appear to be to prevent them
from denning near roads. This would eliminate the possibility of juvenile
foxes developing the begging habit and result in diffusion of the behavior over
generations. It might thus be possible to eliminate begging entirely from the
study area. Because physical and human disturbance makes foxes shift their
dens (Lloyd 1980, Stubbe 1980, Sargeant et al. 1984, Henry 1986), the selective
destruction of dens near roads, and threats made to foxes denning near road by
humans or dogs may both be effective means of dispersing problematic foxes.
If a direct and intensive control program of foxes in the SNP is necessary, then
aversive conditioning should be introduced to a limited part of their range,
namely the area along the narrow unpaved road, since that is where potentially
infectious (because of their likelihood of having direct physical contact with
humans) foxes live.
Acknowledgments : I wish to thank M. Yamanaka, H. Okada and M. Ohnuma
for supporting my work from the very start, and K. Watanabe and the staff of
the Shiretoko Nature Center for supporting and helping my field work. I also
thank Y. Ueno who gave me valuable advice on the manuscript and provided
encouragement during the writing of this paper. I am grateful to T. Ikeda and
Tsukada, Red fox food begging behavior 19
K. Uraguchi for their critical reading of the manuscript. This study was partly
funded by a Sasakawa Scientific Research Grant from the Japan Science
Society, and also by Shari Town.
REFERENCES
Ables, E.D. 1975. Ecology of the red fox in North America. Jv ( M. W. Fox, ed.) The Wild Canids:
Their Systematics, Behavioral Ecology and Evolution. pp. 216—236. Van Nostrand Reinhold,
New York.
Aoi, T., K. Koichi, E. Komiyama, N. Kondo, H. Nakagawa, N. Ohtaishi, G. Takahashi, H. Uno and M.
Yamanaka. 1988. Conservation and management of animals in Shiretoko. Jn (N. Ohtaishi
and H. Nakagawa, eds.) Animals of Shiretoko. pp. 267—342. Hokkaido Press, Sapporo. (in
Japanese with English abstract)
Harris, S. 1978. Age determination in the red fox (Vulpes vulpes) - an evaluation of technique
efficiency as applied to a sample of suburban foxes. J. Zool., Lond. 184: 91—117.
Henry, J.D. 1986. Red Fox: the Catlike Canine. Smithsonian Institution Press, Washington, D.
Copii4spp:
Herrero, S.and S. Fleck. 1990. Injury to people inflicted by black, grizzly, and polar bears recent
trends and new insight. Int. Conf. Bear Res. Manage. 8 : 25—32.
Kondo, N., K. Takahashi and K. Yagi. 1986. Winter food of the red fox, Vulpes vulpes schrencki
Kishida, in the endemic area of multilocular echinococcosis. The Memoirs of the Preparative
Office of Nemuro Municipal Museum 1 : 23—31 (in Japanese with English abstract).
Lloyd, H.G. 1980. The Red Fox. B. T. Batsford Ltd., London, 320 pp.
Macdonald, D.W. 1981. Resource dispersion and the social organization of the red fox (Vulpes
vulpes). In (J. A.Chapman and D. Pursley, eds.) Worldwide Furbearer Conference Proceed-
ings. Vol. 2. pp. 918—949. University of Maryland Press, Maryland.
Macdonald, D.W. 1983. The ecology of carnivore social behaviour. Nature 301 : 379—384.
McCullough, D.R. 1982. Behavior, bears, and humans. Wildl. Soc. Bull. 10 :27—33.
Murder, J.L. 1985. Spatial organization, movements and dispersal in a Dutch red fox (Vulpes
vulpes) population: some preliminary results. Rev. Ecol. 40 : 133—138.
Nature Conservation Society of Japan. 1978. Thinking about Feeding Wild Birds and Mammals -
from Feeding to Environmental Conservation. Nature Conservation Society of Japan, Tokyo,
42 pp. (in Japanese).
Nonaka, N., M. lida, K. Yagi, T.Ito, H.J.Ooi, Y.Oku and M. Kamiya. 1996. Time course of
coproantigen excretion in Echinococcus multilocularis infections in foxes and an alternative
definitive host, golden hamsters. Int. J. Parasitol. 26 : 1271—1278.
Poulle, M. L., M. Artoris and J. J. Roeder. 1994. Dynamics of spatial relationships among members
of a fox group (Vulpes vulpes: Mammalia: Carnivora). J. Zool., Lond. 233 : 93—106.
Robinson, W. L. and E.G. Bolen. 1989. Wildlife Ecology and Management. Macmillan Publishing
Company, New York, 574 pp.
Sargeant, A.B., S.H. Allen and R. T. Eberhardt. 1984. Red fox predation on breeding ducks in
mid-continent North America. Wildl. Monogr. 89: 1—41.
Stubbe, M. 1980. Population ecology of the red fox Vulpes vulpes (L.1758) in the G. D. R. Biogeogra-
puica tse 123 — 176:
Sugiura, H., N. Agetsuma and T. Tanaka. 1993. Provisioned monkeys among wild population of
Japanese macaques in Yakushima Island. Primate Res. 9 : 225—233 (in Japanese with English
abstract).
Tsukada, H. 1994. A study of the ecology of foxes in Shiretoko National Park and utilization for
nature education programs. Bull. Shiretoko Museum 15:63—82 (in Japanese with English
abstract).
Tsukada, H. 1997. A division between foraging range and territory related to food distribution in
the red fox. J sEthol 215227 — 31.
80 Mammal Study 22: 1997
Tsukada, H. and N. Nonaka 1996. Foraging behavior of red foxes Vulpes vulpes schrencki utilizing
human food in the Shiretoko National Park. Mammal Study 21: 137-151.
Wada, K. 1989. Some problems on and around the provisioning of Japanese monkeys. Honyurui
Kagaku [Mammalian Science] 29:1—16 (in Japanese).
Watanabe, K.and H. Tsukada. 1996. Survey of the history of feeding foxes, and on the attitude of
tour operators towards the problem of feeding foxes in Shiretoko National Park. Bull.
Shiretoko Museum 16: 11—24 (in Japanese).
Wright, R.G. 1992. Wildlife Research and Management in the National Parks. University of
Illinois Press, Urbana and Chicago, 224 pp.
Yamashita, J. 1978. Echinococcus. Hokkaido University Press, Sapporo, 246 pp. (in Japanese).
(accepted 22 May 1997)
Mammal Study 22: 81-87 (1997)
© the Mammalogical Society of Japan
The age of sexual maturity in Japanese giant flying
squirrels, Petaurista leucogenys
Takeo KAWAMICHI
Department of Biology, Osaka City University, Sugimoto, Sumtyoshi-ku, Osaka 558, Japan
Fax. +81-75-551-3936, e-mail. pika @sci.osaka-cu. ac. jp
Abstract. I determined the age of sexual maturity in Japanese
giant flying squirrels, Petaurvista leucogenys. ‘The degree of tes-
ticular development was estimated in 25 males 224 times during
eight years. The scrotum began to extend at the age of 7.5-8.5
months, and was slightly swollen in males 8-13 months old.
Testes of 1/2-3/4 size were observed in males from 14 months
onward. By the mating season when they were 21-22 months old,
the proportion with full-sized testes was 57% of the males. All
five males of 27-28 months of age had full-sized testes. One 22
month-old male and one 27 month-old were observed copulating.
Summer-born males had slightly faster developing testes than
spring-born males. None of 19 young females were observed in
estrus. The attainment of sexual maturity in males at 21-22
months of age seems very late as the intermediate-sized rodents.
It is suggested that mothers allow their young to remain with them
for 1-1.5 years until they become sexually mature in order to
increase the survival rate of their young, thereby compensating for
their small litter sizes of one or two.
Key words: flying squirrels, Petaurista leucogenys, scrotum, sexual maturity,
testis.
Rodents achieve sexual maturity at a great range of ages, depending on the
species. In general, sexual maturity is reached later in larger rodents than in
smaller rodent species. Beavers, Castor canadensis, and marmots, Marmota
monax, for example, which exceed 5 kg in body mass, do not become sexually
mature until they are two years old, whereas small voles and mice weighing less
than 100 g mature very early ; Microtus pennsylvanicus, for example, becomes
sexually mature after 25-45 days (Bourliére 1964, Eisenberg 1981). Adult
Japanese giant flying squirrels, Petaurista leucogenys, attain weights of up to 1.3
kg (Kawamichi 1996), and are therefore presumed to become sexually mature
relatively late.
Various aspects of the ecology of the essentially nocturnal Japanese giant
flying squirrel have been investigated. These include: food habits (Ando et
al. 1985a, Kawamichi 1997) ; feeding behavior (Ando et al. 1984, 1985b, Funako-
shi and Shiraishi 1985), and activity rhythms (Baba ef al. 1982). No informat-
ion has previously been available, however, on the age of sexual maturity in
82 Mammal Study 22: 1997
either captive or wild populations.
The purpose of this paper, therefore, is to describe for the first time the age
of sexual maturity in wild Japanese giant flying squirrels, and to discuss the
factors affecting the age of sexual maturity in this species.
MATERIALS AND METHODS
The study area consisted of 0.65 km? (65ha) of mixed deciduous and
coniferous temperate forest situated adjacent to Nara City, central Japan (34°
AI’N, 135°50’E ; elevation 98-150 m), (see Kawamichi 1997). The climate of the
study area is relatively mild, with snow falling occasionally in winter, but with
snow-cover not lasting more than a few days. Research into the ecology and
behavior of P. leucogenys was conducted at this site for eight years, from April
1983 to January 1991. 7 Hs
: 5 a
fs cel wl
¥ (in
b ,
r aw =
sat! 8
B
re (an ;
as
|
=
Sih ad
>
s
i=
i
Pod ae Al
- H i
= Cay
Bs
x
i
Wy
yo}
c
nS
i =
~
ne
P
33
4
“\\
ae w the inating em claw
ree ae ont es
fe C a ee od a
“ate 108 Re. vi dant: x 68. t genta: Tray ;
bn bei ISR, moaaqgalyoe ie d chins
ativritar |
Tube 1
3
ot
99 sap Spl Pigs ‘grils’ i
"ts the. interval between the twa ams! matin
‘patton ong Ste fie tsuki fait seth rast
nies Th ay pe ahs t ie Oh a. fost: ay ara | ito lal
aa a Rete ee) adsl. ‘i balay canbe Aare ha app
er re rere ere
Yor tiaibe aac fos ie. destiast att im SSHivHAR ik oot:
Wedigeds eligde itr Va Seen Pt HH Bae Sese ge maa! a
shanties ae aL! ot avrixel Oe wen yeoe tats wi ane. wit esnips at
atinie hany wize” in. (Seorseaah wi) wigs ‘fexletediolu erg
zy res sili pA BTTHE, RE & 39301) Ce Ri Ole
beg 2 ze ih i ty (
, eee: pe
a { » c . ; er ; me
if “ 3 * i = ‘ q
C—" ans “me Rite «% a vt ae ‘ ra Oy, ae nate yer
+ Gilpise tS : ote AY . a in} 9 R25 i BN tt ao sare Be Ye
: tT ase a) ; ponte: : : ‘
wit: 4 , ees ¢ ; !
seta vs fe 23" iv! E 4 j } 3
wi ohh = -
L 7 £ er ns) Pie Le
: 5 Race. 4s t= as
a3 i é | ;
iN c
: {
oer ee yin
E | : ‘ LS i. ;
S.- " “j
De a ‘ oe
: : - a
‘ a ESA: F 5 3 -
= 7 1
1 x 2 j
4
= 3 = rs .
‘ 2 . Lt 5 yi 4 FAA 2 of
; = : os
) J
i '
& a { - = ‘ af “o5
— pate ed f Ele
hy i
ij rc! 2 N. is ‘
f i 4 ‘at oe rik etaas ay
a) ig UA SY ire ere ts
\y ult 3 > i bl ; ;
= F;
; ql 7 * ati
t= aks i
Z ; = '
: } S + " j ae
i y L\ 44 - G
a, P : ‘
j £ ee
; ‘3 é 5 ‘ei ’ ae
5 i ae ; 3
ies, Ae .
i ras _
ees 4 i=
ar 4 .
de . :
“a J}
— 4 Hs XY & 3
‘ ane gy I
"e
, Gk eT
; , eeu
E f t HG,
Ree 3
qi
y
Ee a
Mammal Study 22: 89-93 (1997)
© the Mammalogical Society of Japan
Structure of a breeding nest of the Daurian pika,
Ochotona daurica, in Mongolia
Takeo KAWAMICHI’ and Samdannyamin DAWANYAM?
! Department of Biology, Osaka City University, Sugimoto, Sumiyoshi-ku, Osaka 558, Japan
Fax. +81-75-551-3936, e-mail. pika @sci. osaka-cu. ac. jp
2 Rodent Research Section, Mongolian Plant Protection Institute, Ulanbator, Mongolia
Abstract. We excavated a breeding nest of the Daurian pika,
Ochotona daurica, in central Mongolia. Four young were captur-
ed within the burrows. Three food storage chambers contained
plant fragments and a large amount of fecal matter, indicating
that hoarded food had been consumed during the last winter. The
nest chamber was spherical and measured 22*18xX21cm. Most
of the nest chamber was filled with piles of grasses, and these piles
were presumably their resting site. The burrow system had three
entrances, and the nest chamber was connected to three burrows.
Multiple nest entrances were provided ready access to refuge for
pikas active on the ground surface from aerial and terrestrial
predators, while multiple burrows also provide refuge against the
intrusion of predators such as stoats into nest chambers.
Key words: Daurian pika, food storage, nest burrows, nests, Ochotona daurica.
The nest, or burrow system, has been described for four species of pikas in the
genus Ochotona: O. daurica (Dmitriyev 1991), O. rufescens (Puget 1971), O.
pallast (Simirnov 1974), and O. pusilla (Simirnov 1974). Although Dmitriyev
(1991) revealed the distribution of nest chambers in the complicated burrow
systems of a colony of O. daurica, for none of these four species, have the
detailed structure of nest chambers, or breeding nests, been described.
The Daurian pika, O. daurica, occurs commonly throughout grasslands or
steppes in the south-eastern corner of west Siberia in Russia, the northern half
of Mongolia, and northern China (Ognev 1940). Despite their extensive range,
little information on their natural history has been gathered, other than details
of their reproduction, vocalization, and of the hay piles accumulated at their
nest entrances (Loukashkin 1940, Zevegmid 1975, Orr 1977, Dlamtcheren ef al.
1989, Dmitriyev 1991).
The purpose of this paper, therefore, is to provide detailed information on
the structure of a breeding nest of the Daurian pika, and to discuss the function
of its complicated burrow system in steppe habitats.
MATERIALS AND METHODS
The study area was in the grassland at Baan-tsagaan Som (Village) (45°50’
90 Mammal Study 22: 1997
Food chamber ———
Nest entrance
Nest chamber
O 60cm iN
Fig. 1 Horizontal section of burrow system of Ochotona daurica consisting of one nest
chamber, three vacant food chambers (hatched), and three nest entrances (large arrows).
N, 99°30’E), 126km south-west of Bayan-hongor, Bayan-hongor Prefecture,
central Mongolia.
We located one breeding nest of O. daurica after observing that young
pikas repeatedly entered and left a burrow entrance on 14 July 1992. The
burrow system was excavated carefully with a shovel, a knife, and by hands,
and measured to the nearest centimeter. Three-dimensional measurements are
given as: length X width X height.
RESULTS
1. Burrow system
The burrow system had three entrances to the ground surface (Fig. 1).
These entrances, measuring 5cm in diameter, gave access to sloping burrows
which were 5-7 cm in diameter. In vertical section, the burrows were round
with flat bottoms, and extended to a depth of 20-38 cm. The distance from the
left entrance to the two entrances on the right (Fig. 1) was 280 or 290 cm.
Three food storage chambers were detected. Two spherical chambers
measured 21 X21 X*18cm and 22 x 22x20 cm, respectively. The ceilings of the
two chambers were 20 and 21 cm below ground. The remaining chamber was
55cm long and 17 cm wide at its widest point.
The three food storage chambers contained small quantities of plant
fragments and a large amount of fecal matter which was not old, indicating
that food had been hoarded and consumed during the winter of 1991-1992.
Feces were only noticeable in these three food storage chambers and the corner
of the nest chamber.
Kawamichi and Dawanyam, Nest of Ochotona daurica 9]
Ground surface
Excrement
O 20 cm
(|
Fig. 2. The structure of a nest chamber. The nest chamber was linked to the surface by
three burrows; 4-5 layers of dry grasses were accumulated, and two mounds of feces were at
the bottom.
Prior to our excavation, an adult pika, presumably the mother, ran away
from the burrow system. We were able to capture four young of similar sizes
within the burrows (body weight 34.0+0.9 (SE) g; ear length 12.3+0.4 mm;
hind foot length 22.5+0.5mm; total length 106.5+2.3mm, n=4). These
observations indicated that this nest was being used for rearing young, and
because of the large amount of feces found in the three chambers, we believe
that this burrow system was in continuous use throughout the winter of 1991-
1992 and the spring of 1992.
2. Nest chamber
The nest chamber was spherical and measured 22 X18X21cm. The ceiling
of the nest chamber was 16cm below ground. The nest chamber was con-
nected to three burrows each running in a different direction (Fig. 1). There
were two mounds of feces in the corner of the nest chamber.
Most of the nest chamber was filled with fibrous grasses as nesting
material. These grasses, presumably the same as their food plants, included
both leaves and roots. Most of these grasses were curled and intertwined, so
that the piles formed a soft cushion. Piles of grasses (18x21x13cm) were
composed of four or five layers (Fig. 2). The top layer consisted of a 4cm
thick dried disk weighing 42g. The central part was depressed, and was
92 Mammal Study 22: 1997
presumably their resting site. The distance from the top layer to the
chamber’s ceiling was 8cm. Lower layers were less dry, and indicated that O.
daurica had repeatedly added fresh piles of nesting material on top of material
which had lost its softness and/or become damp.
DISCUSSION
Ochotona pikas exhibit three types of habitat preference. They either
occupy rocks, steppes, or habitats intermediate between these two (Kawamichi
1971, Smith 1988). Of the four species whose nests or burrow systems have
been described, O. daurica (Dmitriyev 1991) and O. pusilla (Simirnov 1974) are
“steppe dwellers”, and O. rufescens (Puget 1971) and O. pallasi (Simirnov 1974)
are intermediate types. All four species have complex burrow systems with
many entrances. Rock dwelling species inhabit rock slides, however their
nests have not so far been described, because of the difficulty of excavating
rock slides.
Dmitriyev (1991) described the distribution of burrows in a colony of O.
daurica. The largest burrow system had three nest chambers and 42 nest
entrances within an area of 3.8 X 2.8 m (calculated from Dmitriyev’s [1991] Fig.
1). In both Zevegmid (1975) and Dmitriyev’s (1991) colonies, burrows were 5 cm
in diameter, whereas they were 5-7 cm in this study. The diameter of the nest
chambers was 27.622.5..(SE),cm, (range=22-36, .n=5, ,caleulated ) irom
Dmitriyev’s [1991] Fig.1), which was similar to the 22cm of this study,
although Zevegmid (1975) found them to be much smaller at 11-12 cm.
Dmitriyev’s (1991) burrow system, extending 22-30 cm below the surface, was
very similar in depth to ours (20-21 cm; this study), whereas Zevegmid’s (1975)
burrow system was, at 11-12 cm, much shallower.
O. daurica typically accumulates large amounts of hay at its nest entrances
for winter food (Loukashkin 1940, Ognev 1940, Zevegmid 1975, Orr 1977,
Dlamtcheren et al. 1989). By mid-July, however, when we excavated the nest,
there were no signs of plant material accumulations around the nest entrances.
We were, however, able to describe, for the first time, the existence of food
chambers underground in this species, though this is by no means unique to the
genus, as Puget (1971) has described a similar burrow structure with food
chambers underground and accumulated hay piles at nest entrances for O.
rufescens. Although the food storing capacity of O. daurica’s chambers does
not seem to be great enough for the length of the winter in this region, the large
amount of feces in the chambers suggests that they carried hay from the nest
entrances into these chambers where they fed on it.
It is considered that the complex burrow system serves important funct-
ions. Pikas are often active above ground, thus having many nest entrances
provided ready access to refuge from predators such as snowy owls, Nyctea
scandiaca, corsac foxes, Vulpes corsac, wolves, Canis lupus, and particularly
upland buzzards, Buteo hemilasius (Ognev 1940). Conversely, pikas under-
ground are able to flee to the surface, escaping from ground predators such as
Kawamichi and Dawanyam, Nest of Ochotona daurica 93
the stoat, Mustela erminea, which penetrates their burrow systems, by using one
of the many burrows. Dmitriyev (1991) found each of six nest chambers to be
connected to the surface by 2-3 burrows, as did we, and Simirnov (1974) found
that O. pallasi chambers were similarly connected to the surface by three
burrows and O. pusilla chambers by five burrows. These facts indicate that
multiple burrows also provide refuge against the intrusion of predators into
nest chambers.
Acknowledgments : We are greatly indebted to Prof. Masao Onuki of Shiga
University for participating in the Gobi Project, and to other members of this
project for supporting our field study.
REFERENCES
Dlamtcheren, S., D. Tschendjav, and D. Avirmed. 1989. Animals of Mongolian People’s Republic,
Mammals. Academy of Mongolian People’s Republic, Ulanbator, 160 pp (in Mongolian).
Dmitriyev, P. P. 1991. Vegetation of holes of Daurian pika and their importance for steppe eco-
systems. Jn (A.D. Bernstein and N. A. Formozov eds.) Ecology of Pikas of USSR. pp. 5—13.
Publisher Nauka, Moscow (in Russian).
Kawamichi, T. 1971. Daily activities and social pattern of two Himalayan pikas, Ochotona macrotis
and O. roylei, observed at Mt. Everest. J. Fac. Sci. Hokkaido Univ., Ser. VI, Zool. 17 : 587—
609.
Loukashkin, A. S. 1940. On the pikas of north Manchuria. J. Mammal. 21 : 402—405.
Ognev, S. I. 1940. Mammals of the U.S.S. R. and Adjacent countries. Vol. IV. Rodents. (1966, Israel
Program for Scientific Translations, Jerusalem).
Orr, R. T. 1977. The Little Known Pika. Macmillan Publishing Co., Inc., New York, 144 pp.
Puget, A. 1971. Ochotona r. rufescens (Gray, 1842) en Afghanistan et son elevage en captivite.
Mammalia 35: 25—37.
Simirnov, P. K. 1974. Biotopic distribution and territorial relationships of the steppe and the Pallas’s
pikas in the sympatric zone of their ranges. Bull. Moscow Soc. Natur., Biol. Ser. 79 : 72—79
(in Russian).
Smith, A. T. 1988. Patterns of pika (genus Ochotona) life history variation. Jn (M.S. Boyce, ed.)
Evolution of Life Histories: Theory and Patterns from Mammals. pp. 233—256. Yale Univ.
Press, New Haven.
Zevegmid, D. 1975. Zur Biologie der Pfeifhasen (Ochotonidae) in der Mongolischen Volksrepublik.
Mitt. Zool. Mus. Berlin 51 : 41—53.
(accepted 23 June 1997)
weneo en
BE ORAS oA Bh
leseribed, 0. danricn ‘
gies Bpe ¢ dwellers"; and Oratescen
are iitOrrmediate Ys Pes Alt four. =
Hany ehiraqces. Babcle dwell ng pedi
rattitunydon welqaet: neitogrobenspthata
roe imiegeoM od aq el aotednall) vildegest 2:
98 FINI, Sige i-riteds, Pape shine ,
* 10; aa sk ern Tat z
shine ena ousaa apa nL is Rote cal |
Gradrthaseyae aed aiken pint: "Sebi aN
ac
EL | aaa ee webre 1 nigga rhey ante 57 cet io this att
ty, aes penaeN, sia ysiut sh ae }
ae oe) a af, At: ey ae ide aie ng ban hy
4 ni
a
ahaa ii eee May al ae oF shania Ga meee’ agi
Fannie eee VHD} eae 1% covabtn A tome AROE
er } ce ss ag ie eh vests c¢ ‘arse ish et ee SaaS study, es
geen Deigoaer. att ty n meeoiials bgt a bas gaiudtreth onqO!
Wes) on li 4" " en On * 2. a iorit
eS he eh eee Nos niet Hy Mae GTO" Hou Huh, Peale tai Le Ps ee
es tee #69 we: Caste a a Vista mine fitt uae aay RG ;
hw eae aAet- Rea sf ee oo Gea ener EDS Eee : antesie" n ve aos y
26 7 Pay me
> cic Se hi ae % " ' web acs ie a
he Te. ey os © ee vit wisi 5 } i ts o | as | Koen
wz
vs 2 orf yet
iiluganalle if pedoaitoonh, any fi, Laahnde oiad af) reagtini 293); aigole
ihe , sae " : : > a ae a edt +S
xy a 5 sal by i ' ‘ era - r -
hOhiaeet & it} es Ce € é. it a . 4 i Z ir? i, t “4 _
ts : i
Sey re a _ Diy yore ee ‘Pr ) 3 iar ee
rei 4 - BD eeans - : (sy = RED T UC ce Stee eae:
SRIORR Sp is ES: pps) * oY hey Palate act arr
ve * = ; F ; ) JM
1992 1993 1994
Fig. 1. Seasonal changes in the composition of fruit bats captured by mist net. Abbrevia-
tions: C. b.=Cynopterus brachyotis ; C. h.=C. horsfieldi.
98 Mammal Study 22: 1997
(Fig. 1). The other seven species, Rousettus amplexicaudatus, Macroglossus
sobrinus, Balionycteris maculata, Eonycteris spelaea, Megaerops ecaudatus, Chiro-
nax melanocephalus, and Penthetor lucasii, were far less abundant and were
only captured occasionally in the study area.
Adult C. horsfieldi were found to be both significantly larger (t-test, p<
0.001 applied to forearm length), and significantly heavier (t-test, <0.01) than
adult C. brachyotis, and females of both species averaged larger and heavier
than their respective males. Adult male C. horsfieldi had forearms measuring
74.343.1 (SD) mm, and they weighed 56.7+6.1 (SD) g (n=19), while adult
females measured 75.1+2.3 mm and weighed 59.7+6.9 g (n=26). Adult male
C. brachyotis measured 60.542.4 mm, and weighed 30.6+3.8 g (7=23), whereas
adult females measured 61.442.5 mm and weighed 33.1+4.0 g (n=40).
2. Day roosts
The daytime roosts of Cynopterus horsfieldi were found mainly in the
eastern portion, or along the periphery, of the study area (Fig. 2). They
roosted in trees, preferring the axilla of palm fronds of trees such as Cocos
nucifera and Corypha sp. There were fewer than 20 palm trees over five metres
tall in the study area. Two radio-tagged male C. horsfieldi changed roosts
every 1-7 days, while four radio-tagged females changed roosts less often
(every 3-14 days).
The day roosts of C. brachyotis were mostly in dense foliage more than five
metres above ground either in trees, such as Durio zibethinus (Bombacaceae) or
in bamboos such as Gigantochloa scortechenit (Bambusoideae). Roosts were
abundant, widely scattered in the study area with many being difficult to locate
precisely due to the dense foliage, and they mostly occurred in trees other than
palms (Fig. 2). Three radio-tagged male C. brachyotis made only transient use
of foliage roost sites, occupying each site for only 1-5 days before moving on
to another site. One of the males changed its roost almost everyday (Fig. 3).
Gombak River
0 50m
Fig. 2. Location of day roosts of Cynopterus brachyotis (W) and C. horsfieldi (V’) tracked in
July-August 1993. P=palm trees where bats roosted.
Funakoshi and Zubaid, Ecology of dog-faced fruit bats 99
Fig. 3. Flight movements of an adult male Cynopterus brachyotis between 28 July and 12
August 1993. Locations of day roosts are indicated by solid triangles and those of feeding
sites or resting rooosts by open triangles. Figures show the successive days on and after 28
July 1993.
In contrast, four radio-tagged female C. brachyotis changed roosts only every 2
-13 days, with most only occasionally changing their roosts.
3. Nocturnal activity patterns
Activity patterns were ascertained from the numbers of captures made
during the night. Cynopterus brachyotis were most active within an hour after
sunset (Fig. 4), with activity declining somewhat as the night progressed,
whereas C. horsfieldi were most active from two to four hours after sunset, and
again three hours before sunrise (Fig. 4).
4. Food habits and feeding sites
The dominant fig species in the study area was Ficus variegata (Moraceae),
with a mean density of 1.5 large trees (about 30m tall) per hectare. These
trees fruited asynchronously, and the ripe fruits were produced on a recurrent
cycle of five to eight months, the average being seven months (~=6). Piper
aduncum (Piperaceae) trees were also common, occurring on the edge of the
forest along the river or the road, and fruited throughout most of the year.
Figs featured heavily in the diet of C. horsfteldi in the Ulu Gombak study
area throughout the year, with 88% of 32 feces containing fig seeds in July-
August 1993. Piper aduncum seeds were never found in C. horsfieldi feces,
perhaps because, owing to their weight, it was difficult for these bats to hang
from the thin fruit-bearing branches of P. aduncum. The bulk of the diet of C.
100 Mammal Study 22: 1997
20
‘ —e— Cb. (N=502)
@ Ch. (N=155)
2
=
=)
c
>)
a 10
fe
c
@
oO
he
®
ra
0
0 2 4 6 8 10 V2
Hours after sunset
Fig. 4. Temporal activity patterns of Cynopterus brachyotis (C. 6.) and C. horsfieldi (C. h.).
The graph is based on the percentage of the total number of bats captured at hourly intervals
from 1992-1994.
brachyotis consisted largely of the soft fruits of Ficus variegata, F. viridicarpa
and Piper aduncum, and the flowers of Duvio zibethinus (Bombacaceae). Leaf
pellets were also found occasionally under its feeding sites, however the species
could not be identified. Small fig and P. aduncum seeds were frequently found
in C. brachyotis feces, with fig seeds comprising 71%, and P. aduncum seeds
comprising 25% (by number of identifiable seeds) of 48 feces in July-August
1993.
Neither species of bat ate fruits in fruiting trees. Instead they carried
them from the foraging site to a feeding site in a neighboring tree. Such
feeding sites were located by direct observation and radio tracking, or indirect-
ly by searching for pellets regurgitated by the bats and which fell beneath the
feeding site. The wet weight of the figs carried (into mist nets) by C. horsfieldi
on their way to feeding sites were significantly heavier than those carried by C.
brachyotis (Mann-Whitney U-test, U=4, p< 0.01). Those carried by C. hors-
fieldi averaged 17.8+5.7 (SD) g (n=9), while those carried by C. brachyotis
averaged 7.94+2.5 g (n=11). When a fig was too heavy to be carried, the bats
bit off pieces and carried them in their mouths.
Although there was no significant difference between the maximum diam-
eter of disc-shaped pellets regurgitated by the two species (Mann-Whitney
U-test, Z=—1.76, p<0.05), fresh pellets from C. horsfieldi were significantly
heavier than those from C. brachyotis (Mann-Whitney U-test, Z=—3.73, p<
0.001). Fresh pellets produced by C. horsfieldi averaged 17.0+1.3 (SD) mm in
Funakoshi and Zubaid, Ecology of dog-faced fruit bats 101
maximum diameter and weighed 123.3425.3 mg dry weight (~=15), whereas
those of C. brachyotis averaged 15.9+1.3 mm and 94.4+19.0 mg (n=41).
The distances between Ficus variegata trees bearing ripe fruits and neighb-
oring feeding sites averaged 59.4+14.1 (SD) m (v=21) and 78.3+21.8 m (n=12)
in July and August 1993, and 50.4+21.7 m (n=11) in March 1994 (Fig. 5). The
shortest distances between F. variegata trees averaged 35.1414.6 (SD) m (v=9).
The height of the branches used by bats as feeding sites averaged 3.34+1.0 (SD)
m (v=14) above the ground.
O 50m
Fig.5. Location of feeding sites of Cynopterus brachyotis (open triangles) and C. horsfieldi
(solid triangles) during (a) July and August 1993 and (b) March 1994. The locations of Ficus
variegate trees bearing ripe fruits, and trees not bearing ripe fruits are indicated by open
circles and solid circles, respectively.
102 Mammal Study 22: 1997
5. Home ranges
The distances travelled by Cynopterus horsfieldi were significantly further
than those travelled by C. brachyotis (Mann-Whitney U-test, U=1, p< 0.01).
These measurements were based on the means of the greatest distances trav-
elled by each radio-tracked individual over 12 days, which were 475+105 (SD)
m (n=6) for C. horsfieldi, and 295+55 m (n=7) for C. brachyotis. The overlap
of home ranges, both within and between species, was high (Fig. 6), however the
home ranges of both male and female C. horsfieldi were significantly larger
than those of C. brachyotis (Mann-Whitney U-test, U=2, p<0.01). Home
ranges of adult male C. horsfieldi averaged 8.0 ha (n=2) while those of adult
females averaged 5.8+2.5 ha (n=4), whereas in C. brachyotis, adult male home
ranges averaged 3.1 ha (x=3) and adult female ones averaged 3.2+1.4 ha (n=
4).
6. Reproductive cycles
Female Cynopterus horsfieldi in the later stages of pregnancy, and lactating
females and young, were captured intermittently throughout the year, with
percentages fluctuating aseasonally (Fig. 7). Although the main pregnancy
peaks apparently occurred in four to six month cycles, the cycle of the occur-
rence of lactating females could not be clearly identified because of our small
sample size.
Female C. brachyotis in the later stages of pregnancy, and young, were
captured almost every month with the percentage fluctuating aseasonally (Fig.
7). Lactating females, however, were captured only intermittently, with lacta-
tion peaks apparently occurring in three to four month cycles. Female A005
100m
Fig.6. The home ranges of three adult male (a), and four adult female (b) Cynopterus
brachyotis, and of two adult male (c), and four adult female (d) C. horsfieldt.
Funakoshi and Zubaid, Ecology of dog-faced fruit bats 103
Af 0 ZO Uo 44) Seo AZ Zee) 33) ASS) Zoe) Bars 2S 16
Percent by number
a8) Sill la coglel Ful Opes is eA te SiSie Girt al Aves 2) 212 7
Percent by number
ug
Fig. 7. Seasonal changes in the composition of late-pregnant females (Lpf), lactating females
(Lf) and young (Y) in Cynoperus brachyotis (a) and in C. horsfieldi (b). Data are based on the
ratios of the number of late-pregnant females, and lactating females, to adult females, and the
ratio of the number of young to the total catch every month. Monthly sample sizes are
indicated above graphs.
was heavily pregnant when caught and banded on 17 August 1992, and was
lactating when recaptured on 21 December 1992, while female A292, also
heavily pregnant when caught on 24 May 1993, was again in the same reproduc-
tive condition when recaptured on 8 October 1993.
DISCUSSION
1. Day roosts
The daytime roosts of Cynopterus horsfieldi and C. brachyotis are quite
104 Mammal Study 22: 1997
different. Whereas C. brachyotis usually roost in pairs, or in small groups, in
trees, under leaves, and occasionally in the twilight areas of caves (Lim 1966,
Lekagul and McNeely 1977, Medway 1983, Payne et al. 1985, Mickleburgh e¢ al.
1992), and in our study area, under fronds near the trunk and beneath the
crowns of various trees, C. horsfieldi on the other hand is more gregarious and
often roosts in shallow caves or rock shelters, and occasionally in trees,
especially palms (Lim ef al. 1974, Medway 1983, Payne et al. 1985). These
differences in roost site preference were also noted in the Ulu Gombak study
area. Most C. brachyotis roosts were in trees other than palms, while those of
C. horsfieldi were sparsely distributed because of the small number of palms
and the absence of cave or rock shelter roost sites. Furthermore, C. horsfteld’s
pattern of roost site distribution may also result from the scarcity of sites to
accommodate their larger size, and larger roost numbers.
Males of both species frequently changed their roost sites, while most of the
females rarely changed theirs. Such differences between the sexes have also
been shown to occur in the phyllostomid bat, Artibeus jamaicensis (Morrison
1978, Morrison and Handley 1991). According to Lekagul and McNeely (1977),
C. horsfieldi and C. brachyotis often share roosts, however it remains to be
determined just how many individuals typically occur in these aggregations.
2. Activity patterns during the night
The temporal activity patterns of Cynopterus horsfieldi and C. brachyotis
differ greatly. The initial peak of flight activity of C. brachyotis after sunset
was one or two hours earlier than that of C. horsfieldi. After the first peak, C.
brachyotis’s activity gradually declined during the night, whereas activity
among C. horsfieldi decreased around midnight, but then increased again three
hours before sunrise. Radio-tracking data indicate that the smaller C. bra-
chyotis is more active during the night than the larger C. horsfieldi, with C.
brachyotis moving around frequently, and with some individuals being captured
and recaptured in the same night. The activity patterns of C. brachyotis are
somewhat similar to those of Carollia perspicillata (Heithhaus and Fleming 1978,
Fleming and Heithhaus 1986). Radio-tracked C. perspicillata fed intensively
during their first activity period, then settled down to a routine of about one
feeding bout per hour (Fleming 1988). In contrast, the basic activity pattern of
C. horsfieldi may be bimodal with a resting period around midnight.
3. Food habits and fig seed dispersal
It seems that C. horsfieldi has a narrower dietary range than C. brachyotis,
with the former depending almost entirely on fruits as food (Lekagul and
McNeely 1977, Medway 1983, Payne et al. 1985, this study), while the latter eats
a wide range of fruits weighing 0.4-68.2 g (Boon and Corlett 1989) but also takes
flowers, nectar, pollen, leaves and insects (Lim 1970, Medway 1983, Marshall
1985, this study). Among frugivorous New World Phyllostomid bats there is a
high correlation between body weight and the weight of fruits carried away
(Bonaccorso 1979). This correlation is also apparent when examining C.
Funakoshi and Zubaid, Ecology of dog-faced fruit bats 105
horsfieldi and C. brachyotis, with the larger former species carring off fruits
averaging 17.8g, whereas the smaller latter species only carries off fruit
averaging 7.9g. Such size differences may play an important role in the
partitioning of food resouces among similar species of fruit bats occurring
sympatrically.
In our study, the average distance between fruiting trees and feeding sites
was 50-78 m, while in a young secondary forest in Singapore it was within 100
m (Boon and Corlett 1989). As the home ranges of C. horsfieldi are larger than
those of C. brachyotis, we assume that C. horsfieldi transport figs further from
foraging sites than do C. brachyotis, though we have insufficient data to prove
this. In our study area, the shortest distance between Ficus variegata trees
with heights of 30m or more averaged only 35m. Cynopterus were the most
frequently mist-netted bats in the Ulu Gombak study area. Of the 754 fruit
bats of nine species captured, 87.1% were Cynoptrus species. Similarly,
Cynopterus comprised about 70% of the fruit bats captured at Bangi, a frag-
mented secondary forest site, but only 39% at Kuala Lompat, a primary forest
site (Zubaid 1993, 1994). Thus it seems that Cynopterus species predominate in
secondary forest. In addition to the suite of frugivores birds and arboreal
mammals to be found in forests, frugivorous bats such as these Cynopterus
species are likely to be important seed-dispersal agents for fig trees, enabling
such trees to quickly invade a gap or disturbed forest.
4. Home ranges
In both species, the greatest movements measured equalled the distances
between the day roosts and feeding sites. In the Ulu Gombak study area the
mean distance of 295m moved by C. brachyotis was much shorter than by the
Same species in Philippine submontane rainforest (650m; Heideman and
Heaney 1989). This difference between sites may result from the fact that our
15 day period of radio-tracking was much shorter than the length of time
between captures (10-100 days) in the Philippine study, or from the fact that
fruiting trees or feeding areas were closer to the day roosts at our site. In
addition, home ranges in the Phillippines may have shifted during those periods.
The mean distance moved by C. horsfieldi was significantly further than that of
C. brachyotis.
The home ranges of individuals of both species overlapped, suggesting that
neither roosting sites nor food resources were limiting, and thus eliminating the
need for the bats to hold territories. The estimated home range sizes may,
however, be somewhat smaller than the actual sizes, because of the short
periods of radio-tracking. Whereas Heideman:-and Heaney (1989) estimated
that the population density of C. brachyotis in primary submontane forest on
Negros Island was only 0.2 individuals per hectare, in our secondary forest
study area, C. brachyotis densities were very high (Funakoshi and Zubaid,
unpublished) and home ranges were very small. Such high densities at Ulu
Gombak may be associated with the abundance of roost and food resources.
106 Mammal Study 22: 1997
5. Reproductive cycles
Pregnant female C. brachyotis and C. horsfieldi have been captured in all
months, suggesting that breeding is non-seasonal (Lim 1970, Medway 1983).
Lim (1970) found that peaks in pregnancies among C. brachyotis occur in
January, May, and September at the same latitude in Malaysian rainforest as
our study area. Such seasonal peaks differ, however, from those in our Ulu
Gombak study area where the timing of peaks of pregnancy and lactation vary
from year to year. As for the effects of environmental factors on reproduction,
Lim (1970, 1973) found that the highest frequency of pregnancy coincided with
the greatest availability of fruits.
In the Ulu Gombak study area, it seems that female C. brachyotis may
produce two or three young each year. This assumption is based on the main
pregnancy and lactation peaks (Fig. 7a), and the fact that female A292 had just
one reproductive cycle between late May and early October, and female A005
had the opportunity to produce two young between mid August and mid
December. On the Philippine island of Luzon, at 14°N, C. brachyotis reproduce
seasonaly with two birth periods per year (Ingle 1992). On Negros Island (9°22’
N), the length of gestation in C. bvachyotis is approximately four months, and
lactation lasts for about 6-8 weeks (Heideman 1987). At lower latitudes, such
as at our study area, both gestation and lactation periods may be shorter
because of the short reproductive cycle at Ulu Gombak. Most female C.
brachyotis become pregnant at about 6-8 months of age, while males become
sexually mature at about one year old (Heideman 1987, Mickleburgh e¢ al.
1992). In C. horsfieldi, the peaks of pregnacies occurred in 4 to 6 month inter-
vals, with most females probably producing two young per year (Fig. 7b). The
ages of sexual maturity of this species, however, remain unknown. The
relatively short reproductive cycle of female C. brachyotis may be one of the
factors contributing to the greater size of their populations.
In conclusion, both C. brachyotis and C. horsfieldi are abundant in partially
disturbed rainforest, and can coexist in the same habitat through differences in
roost site selection and partitioning of food resources in relation to their
different body sizes. Cynopterus brachyotis predominates, probably because of
the abundance of roost sites and food resources and its more rapid rate of
reproduction with two or three litters per year.
Acknowledgments : We thank Drs Y. Tsubaki and H. Nagata of the National
Institute for Environmental Studies for their encouragement and valuable
advice, Dr H.I. Azarae of the University of Malaya for permission to use
facilities there, and Messrs S. Ripin and S. Dali for assistance in the field. We
are also indebted to Mr T. Kirwan and other staff of the Field Study Center,
University of Malaya for help with field research, and to Mrs B. Andre for
comments on the manuscript. This work was supported in part by grants from
the National Institute for Environmental Studies of Japan.
Funakoshi and Zubaid, Ecology of dog-faced fruit bats 107
REFERENCES
Bhat, H.R. 1994. Observations on the food and feeding behaviour of Cynopterus sphinx Vahl
(Chiroptera, Pteropodidae) at Puna, India. Mammalia 58 : 363—370.
Bonaccorso, F. J. 1979. Foraging and reproductive ecology ina Panamanian bat community. Bull.
Florida State Mus., Biol. Sci. 24 : 359—408.
Fleming, T. H. 1988. The Short-tailed Fruit Bat. University of Chicago Press, Chicago, 365 pp.
Boon, P. P. and R. T. C. Corlett. 1989. Seed dispersal by the lesser short-nosed fruit bat (Cynopterus
brachyotis, Pteropodidae Megachiroptera). Malay. Nat. J. 42: 251—256.
Fleming, T. H. and E. R. Heithaus. 1986. Seasonal foraging behavior of Carollia persipicillata (Chiro-
ptera: Phyllostomidae). J. Mammal. 67 : 660—671.
Heideman, P. D. 1987. The reproductive ecology of a community of Philippine fruit bats (Megachiro-
ptera, Pteropodidae). Ph.D. thesis, University of Michigan, Ann Arbor, 320 pp.
Heideman, P. D. and L. R. Heaney. 1989. Population biology and estimates of abundance of fruit
bats (Pteropodidae) in Philippine submontane rainforest. J. Zool., Lond. 218 : 565—586.
Heithaus, E.R. and T.H. Fleming. 1978. Foraging movements of a frugivorous bat, Carollia per-
spicillata (Phyllostomatidae). Ecol. Monogr. 48 : 127-143.
Heller, K.G. and M. Volleth. 1989. Fledermadse aus Malaysia. 1. Beobachtungen zur Biologie,
Morphologie und Taxonomie (Mammalia: Chiroptera). Senckenbergiana Biologica 69:
DAS 210.
Ingle, N. R. 1992. The natural history of bats on Mt. Makiling, Luzon Island, Philippines. Silliman
jeso l= 26.
Jones, C. 1972. Comparative ecology of three pteropid bats in Rio Muni, West Africa. J. Zool.,
Lommel 1O¢2 S33 si)
Kitchener, D. J., A. Gunnell. and Maharadatunkamsi. 1990. Aspects of the feeding biology of fruit
bats (Pteropodidae) on Lombak Island, Nusa Tenggara, Indonesia. Mammalia 54 :561—578.
Krishna, A. and C. J. Dominic. 1983. Growth of young and sexual maturity in three species of Indian
bats. J. Anim. Morphol. Physiol. 30 : 162—168.
Lekagul, B. and J. A. McNeely. 1977. Mammals of Thailand. Kurusapha Ladprao Press, Bangkok,
758 pp.
Lim, B. L. 1966. Abundance and distribution of Malaysian bats in different ecological habitats.
Federation. Mus. J. 11 :62—76.
Lim, B.L. 1970. Food habits and breeding cycle of the Malaysian fruit-eating bat, Cynopterus
brachyotis. J. Mammal. 51: 174—177.
Lim, B. L. 1973. Breeding pattern, food habits and parasitic infestation of bats in Gunong Brinchang.
Malay, Nate J26=6— 13)
Lim, B.L., C.K. Shin and I. Muul. 1974. Notes on food habits of bats from the fourth division,
Sakawdke | oarawak Minus) J. 20 235i 3517.
Marshall, A.G. 1970. The life cycle of Baszlia hispida Theodor 1967 (Diptera: Nycteribiidae) in
Malaysia. Parasitology 61:1—18.
Marshall, A.G. 1985. Old World Phytophagous bats (Megachiroptera) and their food plants: a
survey. Zool. J. Linn. Soc. 83 : 351—369.
Marshall, A.G. and A. N. McWilliam. 1982. Ecological observations on epomorphorine fruit-bats
(Megachiroptera) in West African savanna woodland. J. Zool., Lond. 198 :53—67.
Medway, L. 1972. Reproductive cycles of the flat-headed bats Tylonycteris pachypus and T. robustula
(Chiroptera: Vespertilioninae) in a humid equatorial environment. Zool. J. Linn. Soc. 51:
33-01.
Medway, L. 1983. The Wild Mammals of Malaya (Peninsular Malaya) and Singapore. 2nd ed.
Oxford Univ. Press, Kuala Lumpur, 131 pp.
Mickleburgh, S. P., A. M. Hutson and P. A. Racey. 1992. Old World Fruit Bats: An Action Plan for
their Conservation. IUCN, Gland, Switzerland, 252 pp.
Mohr, C.O. 1947. Table of equivalent populations of North American small mammals. Amer.
108 Mammal Study 22: 1997
Midl. Nat. 37 : 223—249.
Morrison, D. W. 1978. Foraging ecology and energetics of the frugivorous bat A7tibeus jamaicensis.
Ecology 59 : 716—723.
Morrison, D. W. and C. O. Handley. 1991. Roosting Behavior. Jn (C.O. Handley., D. E. Wilson and
A. L.Gardner, eds) Demography and natural history of the common fruit bat, Avtibeus
jamaicensis, on Barro Colorado Island, Panama. pp. 131-135. Smithsonian Institution Press,
Washington.
Payne, J., C.M. Francis and K. Phillipps. 1985. A Field Guide to the Mammals of Borneo. The
Sabah Society, Sabah, 332 pp.
Sandhu, S. 1984. Breeding biology of the Indian fruit bat, Cynopterus sphinx (Vahl) in central India.
J2Bombay Nat Hist Soe cilyac00=.o12:
Wolton, R.J., P. A. Arak, H.C. J.Godfray and R.P. Wilson. 1982. Ecological and behavioural
studies of the Megachiroptera at Mount Nimba, Liberia, with notes on Microchiroptera.
Mammalia 46: 419—448.
Zubaid, A. 1993. A comparison of the bat fauna between a primary and fragmented secondary forest
in Peninsular Malaysia. Mammalia 57 : 201—206.
Zubaid, A. 1994. Vertical stratification of pteropodid bats in a Malaysian lowland rainforest.
Mammalia 58 : 309—311.
(accepted 23 June 1997)
109
ERRATUM
The following table was omitted from Asada and Ochiai’s paper in Mammal
Study 21(2) and should have been inserted on page 157.
Table 1. Number of sika deer of conceiving before and after mid October on Boso Peninsula,
central Japan.
Maternal age
Conception periods 1-year-old 2 and 3-year-old 4-year-old and more __ Total
Sep. to mid. Oct. 10 47 91 148
Late Oct. to Dec. i) il} 7 20
Total 12 58 98 168
INSTRUCTIONS TO CONTRIBUTORS
The Mammal Study (the continuation of the Journal of the Mammalogical
Society of Japan) publishes original Articles and Short Communications, written in
English, on all aspects of mammalogy. In principle, membership of the Society is
a prerequisite for the submission of papers, but non-members may be co-authors.
Manuscripts are submitted to qualified referees for critical scientific reviewing.
Authors are notified, with referees’ comments, on acceptance, rejection or need for
revision. The editor also customarily sends manuscripts to qualified reviewers for
English editing.
Manuscripts should be submitted typewritten on one side of the paper (use A4
21.0 cm X 29.7 cm paper), and double-spaced. An approximately 3 cm margin
should be left on all sides. Do not hyphenate words at the right margin. Manu-
scripts should be arranged in the following order: the title, name(s) of author(s)
and affiliation, fax number and E-mail number if available, abstract (fewer than
200 words) and key words (five words or fewer), main text, acknowledgments,
references, tables, figure legends, figures. Titles of papers must be accurate and
concise, and (for abstraction services) include any relevant taxonomic name. A
Japanese title and a Japanese abstract should be written on separate sheets. Text
pages should be numbered through from title to references. Manuscripts should be
line-numbered, every five lines, in the left margin. Short Communications do not
exceed four printed pages. Abstracts and key words are omitted from Short
communications.
Tables and figures should be simple and self-explanatory, and their preferred
locations should be indicated in the right margin of the text. The ratio of tables and
figures to text pages cannot exceed 1:2 and they should be as few as possible. The
author’s name and figure numbers should be written on the back of original figures
and on the surface of copies.
Scientific names should be underlined. All measurements should be in metric
units. The following abbreviations should be used. Length: km, m, cm, mm, etc. ;
ahead tics etce volume: km®, m*, kl, | mil~ete.> weight: ke, s, me, etc. ;
time: hr, min, sec, etc.; others: cal, kcal, C, Hz, p (probability), SD, SE, etc.
Arabic numerals should be used for numbers exceeding 10.
References in the text should follow the forms: “Uchida and Shiraishi (1985)
stated that ...” (Abe and Kawamichi 1990), and (Miura et al. 1993). More than one
reference within the same parentheses should be listed chronologically, alphabeti-
cally if of the same year. Full references cited must be listed alphabetically by the
first author according to the following examples:
Abe, H., S. Shiraishi and S. Arai. 1991. A new mole from Uotsuri-jima, the Ryukyu
Islands. J. Mamm. Soc. Japan 15: 47—60.
Eisenberg, J. F. 1981. The Mammalian Radiations. Univ. of Chicago Press,
Chicago, 610 pp.
Geist, V. 1982. Adaptive behavioral strategies. Jn (J.W. Thomas and D.E.
Toweill, eds.) Elk of North America. pp. 219—277. Stackpole, Harrisburg.
Obara, Y. 1991. Karyosystematics of the mustelid carnivores of Japan. Honyurui
Kagaku [Mammalian Science] 30: 197—220 (in Japanese with English
abstract).
Authors are recommended to refer to recent issues of the journal for details of style
and layout.
Manuscripts should be submitted in triplicate, with a separate sheet giving the
title, author(s) name(s) and address(es) for editorial correspondence, a running
head (fewer than 20 letters), the numbers of main text pages, tables and figures, and
the number of copies of reprints requested.
Galley proofs will be sent to the author. Reprints may be purchased in blocks
of 50.
Mammal Study | i ee
Vol. 22, Nos. 1/2 December 1997
CONTENTS
FOREWORD is/algaia orale eceiaere has eidve orclencle tee bVorerlove avsin eles oPPaare ele We -a'e'eie alte iciee aa eee eee at ee seresecerene | .
MEMORIAL PAPERS FOR DR H. ABE >
Ishibashi, Y:, & Saitoh, S- Abe and M. C. Yoshida: Cross- -species amplificsamae
of microsatellite DNA in Old World microtine rodents with PCR primers forse
a oar
the gray- -sided vole, Clethrionomys rutocanus ie ele ee 9\e/ewisicle solu «/sla\e/s/elole\eintete apatateletelateteeaetiats 7 ate) 5 i
Ohdachi, S: Laboratory experiment on spatial use and aggression in three
"sympatric species of shrew in Hokkaido, Japan oils doteedescterer ee SSee aes 20>: zosc]liL :
Saitoh, T. and A. Nakatsu : The impact of forestry on the small rodent commu-
nity of Hokkaido, Japan vcrrvrreererreeeee crete teeeeeetetecseeeceneeececeeees os a0res aa oT.
Takahashi, K. and K. Satoh: Growth of eye lens weight and age estimation ite
the northern red-backed vole, Clethrionomys rutilus -cvttttttttttt ete steeees 39
MEMORIAL PAPERS FOR DR S. SHIRAISHI
- Ando, A. and S. Shiraishi: Age determination in the Smith’s red- backed oole oe
Eothenomys smithii, using optic lens weight Sieleleleie/ele jo. 06,0 6 «0 ce 0c sine sleclsivcielcialsiole seeeeeeeeeA5
Yoshinaga, Y., W. Ohno and S. Shiraishi: Postnatal growth, development and
ultrasonic vocalization of young Japanese field voles, Microtus montebelli:+-53
ORIGINAL PAPERS =
Tsukada, H: Acquisition of food begging behavior by red foxex in the Shire-
toko National Park, Hokkaido, Japan ree scne beds orn eet ee eters 71
Kawamichi, T: The age of sexual maturity in Japanese giant flying squirrels,
amare ‘and S: pace ae Struct ofa breeding nest in the Daurian
pika, Ochotona daurica, in Mongolia -stterrttteestteeettteees ana nbsines Sane eee B89
Funakoshi, K. and A. Zubaid: Behavioural and reproductive ecology of the ;
dog-faced fruit bats, Cynopterus brachyotis, and C.horsfieldi, in a ~—
Malaysian rainforest siesenensseseeesseessseensssesseseneseeesceseressssessecerecstececeresenssnsQh
The Mammalogical Society of Japan
ISSN 1343-4152
The Continuation of the Journal of
the Mammalogical Society of Japan
THE MAMMALOGICAL SOCIETY OF JAPAN
OFFICERS AND COUNCIL MEMBERS FOR 1997 - 1998
President : Hisashi Abe
Secretary General : Takashi Saitoh
Executive Secretary : Keisuke Nakada
Treasurers : Seiji Ohsumi, Toshiro Kamiya
Council Members: Noriyuki Ohtaishi, Koichi Kaji, Yukibumi Kaneko,
Takeo Kawamichi, Takashi Saitoh, Seiki Takatsuki, Teruo Doi, Kimitake
Funakoshi, Kashio Maeda, Shingo Miura, Okimasa Murakami, Takanori
Mori, Kazuo Wada
The Mammalogical Society of Japan publishes original papers in two
journals: the Mammal Study (the continuation of the Journal of the
Mammalogical Society of Japan) for papers written in English, and Honyurui
Kagaku |Mammalian Science] for those submitted in Japanese. Each jour-
nal is published twice a year. Submissions are considered on the understand-
ing that they are being offered solely for publication by the Mammalogical
Society of Japan. In principle, authors submitting articles to the journals
should be members of the Mammalogical Society of Japan. Both journals
are distributed free of charge to the members of the Society.
The following are the annual dues for the membership :
Domestic members ¥7,000 (Student ¥6,000)
Overseas members US $60.00
Institutional subscriptions ¥20,000
All correspondence regarding application for membership, subscription,
address change, and other matters should be addressed to:
The Mammalogical Society of Japan
Business Center for Academic Societies of Japan, Academic Society
Center C21, 16-9 Honkomagome, 5-chome, Bunkyo-Ku, Tokyo 113, Japan
Mammal Study : the continuation of the Journal of Mammalogical
Society of Japan
Editor-in-Chief : Seiki Takatsuki
Editorial Secretary : Yukihiko Hashimoto, Masamichi Kurohmaru
Editorial Board: Mark A. Brazil, Hideki Endo, Hirofumi Hirakawa,
Toshio Kasuya, Takeo Kawamichi, Shingo Miura, Takashi Saitoh,
Hitoshi Suzuki, Hidetoshi Tamate
All correspondence regarding manuscripts and editorial matters
should be addressed to :
Dr. Seiki Takatsuki
The University Museum, The University of Tokyo, Hongo 7-3-1,
Bunkyo-ku, Tokyo 113, Japan :
Fax. +81-3-3815-7053, e-mail. taka@um.u-tokyo.ac.jp
Mammal Study 23: 1-8 (1998)
© the Mammalogical Society of Japan
The functional anatomy of the masticatory muscles of
the Malayan pangolin, Manis javanica
Hideki ENDO, Isao NISHIUMI, Masamichi KUROHMARU’, Jarujin
NABHITABHATA?, Tanya CHAN-ARD’, Nivesh NADEE?, Srihadi AGUNGPRIYONO%,
and Junzo YAMADA°
Department of Zoology, National Science Museum, Tokyo, Tokyo 169-0073, Japan
‘Department of Veterinary Anatomy, Faculty of Agriculture, The University of Tokyo, Tokyo 113
-8657, Japan
2 Natural Science Research Division, National Science Museum, Thailand, Bangkok 10900, Thailand
3Energy and Environment Research Department, Thailand Institute of Scientific and Technological
Research, Bangkok 10900, Thailand
“Department of Veterinary Anatomy, Bogor University of Agriculture, Bogor 16152, Indonesia
>Department of Veterinary Anatomy, Faculty of Agriculture, Obthivo University of Agriculture and
Veterinary Medicine, Hokkaido O80-8555, Japan
Fax. +81-3-3364-7104
Abstract. The masticatory muscles of the Malayan pangolin,
Manis javanica, were observed in dissection, and relative positions
of the cranium and the mandible were examined under soft-X ray
photographs. The WM. temporalis was well-developed in the
medial area of the zygomatic process of temporal bone. The /.
masseter was found to consist of three large well-developed bun-
dles between the zygomatic arch and the mandible. Based on
these observations, it is suggested that the thin V-shaped mandible
may act as a substantial support in the ventral portion of the oral
cavity, and that the M. masseter and M. temporalis may serve to
help fix the shape of mouth, when the pangolin uses the specialized
tongue for feeding. We demonstrated that the M. digastricus is at
least functionally able to depress and open the mandible. In
addition, the well-developed M. mylohyoideus may contribute to
the control of intraoral pressure during mastication.
Key words: digastric muscle, mandible, masseter muscle, pangolin, temporal
muscle.
Although the tongue structure of pangolins has attracted the interest of a
number of anatomists (Ehlers 1894, Edgeworth 1923, Sonntag 1923, 1925, Lubo-
sch 1938, Kubota et al. 1962, Saban 1968, Doran and Allbrook 1973, Yen 1984,
1985, Chan 1995), who have pointed out that the Manidae species use their
uniquely elongated tongue for feeding on termites and ants, the morphology of
the masticatory muscles and of the mandibular bone of the pangolins has been
overlooked. The mastication system has so far been considered functionally
vestigial or insignificant (Doran and Allbrook 1973, Walker 1991, Chan 1995),
but without there having been detailed descriptions of the masticatory muscles.
2D Mammal Study 23: 1998
The purpose of this study therefore was to examine macroscopically the three
dimensional relationship between the cranium and the mandible, and the
development of the masticatory muscles in order to clarify their functional
significance.
MATERIALS AND METHODS
One formalin-fixed head and three skulls of the Malayan pangolin, Manis
javanica that had been stored in Thailand Institute of Scientific and Technologi-
cal Research, in the Department of Veterinary Anatomy of The University of
Tokyo and in the Department of Zoology of National Science Museum, Tokyo
were used in this study.
The skin, subcutaneous tissue and globe were removed from the fixed head,
then the masticatory muscles, Muscul: masseter, digastricus, temporalis, pter-
ygoider and Musculus mylohyoideus were observed macroscopically. Soft-X ray
photographs were taken to examine the articulation and the positional relation-
ship between the mandible and the cranium, and the areas of attachment of the
masticatory muscles on the skulls were observed. The anatomical nomencla-
ture of the muscular system was based on Miller’s Anatomy of the Dog (Evans
1993).
Fig. 1. Lateral soft-X ray photograph of the head of a Malayan pangolin. Rostral direction
at the top. The thin mandible (small arrow) is gently curved and connects to the ventro-
caudal area of zygomatic process of the temporal bone (large arrow). Arrowheads, incom-
plete zygomatic arch.
Fig.2. Dorso-ventral soft-X ray photograph of the head of a Malayan pangolin. Rostral
direction at the top. The thin mandible represents the V-shape (arrow). Arrowhead indi-
cates the auditory bulla. The atlas vertebra is present in this specimen.
Endo et al., Pangolin Masticatory Muscles 3
RESULTS
The relative positions of the mandibular bones and the cranium were
observed using soft-X ray photographs (Figs. 1,2). The mandibular body was
found to be slender and gently curved dorso-ventrally, but was not generally
well-developed (Figs. 3, 4). The symphysis was relatively long and strong in
comparison with the thin mandibular bone. The lateral surface of the man-
dible was flat and lacked processes for the insertion of muscles, while the
medial side had a shallow groove to which M. mylohyoideus was attached.
The mandible connected to the ventro-caudal area of the zygomatic process of
the temporal bone. The articulation area was slightly depressed, and the
zygomatic process had no specialized surfaces for articulation (Figs. 3, 4). All
three skulls and the preserved head possessed incomplete zygomatic arches
which varied in their developmental state (Figs. 1-4). The temporal bone was
well-developed dorso-rostrally in the area of the zygomatic process (Fig. 3),
which we have called the “temporal-muscle process”. The orbit was surround-
ed by depressed frontal and developed temporal bones, and there was a deep
hollow in the caudal part of the orbit.
Fig. 3. Left side of the skull of a Malayan pangolin. Rostral direction at the top. The
mandible has been artificially attached to the cranium. The skull is elongated and simple in
lateral view, while the mandible bone is slender. The zygomatic arch is not developed
(arrows). The temporal bone is dorso-rostrally well-developed in the part of zygomatic
process (arrowhead). The depressed orbit is surrounded by the temporal muscle process in
the caudal part.
Fig. 4. Ventral view of the skull specimen of a Malayan pangolin. Rostral direction at the
top. The mandible articulation area is slightly depressed (arrow).
4 Mammal Study 23: 1998
Fig.5. Right side of the head of a Malayan pangolin. Rostral direction at the top. The
wedge-shaped WM. temporalis is well-developed in the caudal part of the orbit and in the medial
side of the temporal-muscle process of the temporal bone (small arrows). The M. masseter
consists of three main bundles reaching from zygomatic arch to the caudal part of the
mandible (intermediate arrows). Large arrows, zygomatic arch. Arrowhead, mandible.
Fig. 6. Dorso-lateral view of the orbit region of a Malayan pangolin. Rostral direction at
the top. The wedge-shaped M. temporalis is well-developed in the medial side of the
zygomatic arch (small arrows). The large arrow indicates a part of the M. masseter.
The M. temporalis was well-developed on the medial side of the zygomatic
arch of the temporal bone and the temporal muscle process (Figs. 5,6). The /.
temporalis, which was found to be wedge-shaped, was largely attached to the
caudal part of the orbit, and was rostrally extended to the medial surface of the
zygomatic arch. The muscle was inserted vertically into the caudal mandible
body. The M. masseter consisted of three well-developed main bundles (Figs.
5, 7). The two cranial bundles originated form the medial side of the
zygomatic arch and the most caudal bundle arose from the ventral part of the
arch. All three bundles reached the caudal half of the mandible laterally (Fig.
i).
The WM. digastricus consisted of two thin parts, the lateral part originating
from the ventral area of temporal and occipital bones inserting into the ventral
edge of the mandible (Figs. 7, 8), while the thinner medial part arose from the
ventral surface of the M@. mylohyoideus (Fig. 7), and did not attach to the caudal
part of the mandible. The M. mylohyoideus was thick and occupied the space
between the mandibular bones, and provided an area of attachment for the
medial portion of the M. digastricus (Fig. 8).
The WM. pterygoideus lateralis was found to consist of two small, short
bundles lying parallel and rostro-laterally oriented from the palatine bone to
the medial side of the mandible (Fig. 9).
Endo et al., Pangolin Masticatory Muscles D
Fig. 7. Ventro-lateral view of the head of a Malayan pangolin. Rostral direction at the top.
Superficial muscles are removed. The M. masseter consists of three main bundles (small
arrows). The MM. digastricus can be seen. The lateral part of the WM. digastricus (intermedi-
ate arrow) originates from the ventral area of the temporal and the occipital bones (arrow-
heads), while the thinner medial portion (large arrow) rises form the ventral surface of the M.
mylohyoideus. Asterisks, the ventral edge of the mandible. S, submandibular gland.
Fig. 8. Ventro-lateral view of the head of a Malayan pangolin. Rostral direction at the top.
The M. digastricus is turned out, and the two distinctive parts can be observed (small arrows).
The M. mylohyoideus, which is thick and occupies the space between mandibles (large arrow).
Fig. 9. Ventral view of the head of a Malayan pangolin. The M. pterygoideus lateralis consists
of two small and short bundles (small arrows). The large arrow indicates the ventral edge
of mandible to which the ™. digastricus is attached. Rostral direction at the top.
DISCUSSION
The possibility of morphological differences between species of Manidae in
the developmental of the masticatory muscle should be taken into account,
particularly given that previous descriptions have not been consistent (Lubosch
1938, Saban 1968, Yen 1985, Chan 1995).
Firstly, it is suggested that the thin V-shaped mandible may provide
significant support for the ventral portion of the oral cavity. It became clear
during this study of the Malayan pangolin that the M. temporalis was developed
and had the enlarged attachment to the temporal-muscle process. The multi-
bundled MM. masseter was also found to be a strong mastication motor.
Although the developmental state of the zygomatic arch was found to vary
between individuals, we believe, contrary to Saban (1968), that the arch is not
6 Mammal Study 23: 1998
vestigial. Although active movement of mandible is certainly not important
for feeding in this species, we suggest that the zygomatic arch and its temporal-
muscle process, the M. masseter and M. temporalis, may all serve to help fix the
shape of mouth. Although the mandible is simple and thin, the symphysis is
relatively well-developed in the pangolins (Lubosch 1938, Saban 1968) indicating
that mandibular bones may support the shape of the oral cavity while feeding
with the tongue.
In comparison with the M. masseter and M. temporalis, the M. digastricus of
the Malayan pangolin is not comparable with that of other mammals (Edgewor-
th 1923, 1935, Evans 1993). Although Chan (1995) pointed out that the /.
digastricus disappears into the submandibular gland, in this study we have
demonstrated that the lateral part of the VW. digastricus is at least functional in
depressing and raising the mandible. It is further suggested that the medial
part of the M. digastricus only assists the action of the well-developed M.
mylohyoideus. The M. mylohyoideus may support the function of M. digastricus
and act as a depressor of the mandible. In addition, the well-developed MM.
mylohyoideus may contribute to the control of intraoral pressure during masti-
cation. Specimens with intact hyoid bones should be examined morphological-
ly in the future to elucidate this.
Our description of Mm. pterygoidei is similar to that of Yen (1984). The M.
pterygoideus lateralis could not be confirmed in this specimen. It remains
unclear how this muscle has changed in form and function.
The functional significance of masticatory muscles of certain rodents has
been described (Kesner 1980, Bekele 1983, Druzinsky 1995), and functional
models of mandibular movement have also been established for some rodents
(Weijs 1975, Gorniak 1977, Byrd 1981, Satoh 1997). On the basis of data from
Apodemus and Clethrionomys species (Satoh 1997), it has been suggested that
patterns of mandibular movement are directly modified by adaptations in
dental morphology. We speculate, however, that the masticatory muscles in
toothless mammals such as the pangolin have also been functionally affected by
their special feeding pattern. In such mammals, the primary function of
masticatory muscles may not be to generate occlusal force, but to control the
air pressure within the oral cavity.
In contrast with previous speculations (Doran and Allbrook 1973, Chan
1995), the present study has clearly demonstrated that the masticatory muscles
of the Malayan pangolin are not vestigial, but functional, well-developed, fix
the mandibular bones, support the shape of the oral cavity, and help control the
pressure in the oral cavity during feeding with the tongue.
The masticatory muscles of other toothless mammals may also be a func-
tional part of the mastication system and may also have been adapted for
special feeding as a form of functional convergence.
Acknowledgements : We wish to thank: Drs. R. Niphan, K. Sunee, P. Lakkana
and the staff of Thailand Institute of Scientific and Technological Research, Dr.
T. Nishida of the Department of Anatomy and Physiology of Nihon University,
Endo et al., Pangolin Masticatory Muscles 7
Kanagawa, Japan; and Dr. R. Worawut of the Department of Veterinary
Anatomy in Kasetsart University, Bangkok, Thailand. We are also grateful
to Mrs. C. Nisa of the Department of Veterinary Anatomy of Bogor University
of Agriculture and to Dr. Y. Hayashi of the Department of Veterinary Anatomy
in the University of Tokyo. The work was supported by the Asian and Pacific
co-operative research program of the National Science Museum, Tokyo, and by
a Grant-in-Aid from the International Scientific Research Program of the
Ministry of Education, Science and Culture of Japan.
REFERENCES
Bekele, A. 1983. The comparative functional morphology of some head muscles of the rodents
Tachyoryctes splendens and Rattus rattus. Mammalia 47 : 395—419.
Byrd, K. E. 1981. Mandibular movement and muscle activity during mastication in the guinea pig
(Cavia porcellus). J. Morphol. 170: 147—169.
Chan, L. K. 1995. Extrinsic lingual musculature of the pangolins (Pholidota: Manidae). J. Mammal.
76 : 472—480.
Doran, G. and D. B. Allbrook. 1973. The tongue and associated structures in two species of African
pangolins, Manis gigantea and Manis tricuspis. J. Mammal. 54 : 887—899.
Druzinsky, R. E. 1995. Incisal biting in the mountain beaver (Aplodontia rufa) and woodchuck
(Marmota monax). J. Morphol. 226 :79—101.
Edgeworth, F. H. 1923. On the development of the cranial muscles of Tatusza and Manis. J. Anat. 57:
Sil aS0:
Edgeworth, F. H. 1935. The Cranial Muscles of Vertebrates. Cambridge University Press, Cambrid-
ge, 493pp.
Ehlers, E. 1894. Der Processus Xiphoideus und seine Muskulatur von Manis macrura Erxl. and Manis
tricuspis Surdev. Zoologische Miszellen I. Abhandlungen der K6nigliche Gesellschaft der
Wissenschaften, Gottingen 39: 1—34.
Evans, H.E. 1993. Miller's Anatomy of the Dog, 3rd ed. W.B. Saunders, Philadelphia.
Gorniak, G. C. 1977. Feeding in golden hamster, Mesocricetus auratus. J. Morphol. 154 : 427—458.
Kesner, M. H. 1980. Functional morphology of the masticatory musculature of the rodent subfamily
Microtinae. J. Morphol. 165 : 205—222.
Kubota, K., J. Kubota, T. Nakamura, N. Fukuda, S. Asakura, S. Nakagawa and M. Masui. 1962.
Comparative anatomical and neurohistological observations on the tongue of pangolin (Manis
pentadactyla, Linnaeus). Anat. Rec. 144: 43—55.
Lubosch, W. 1938. Muskeln des Kopfes, Mammalia. Jn (Bolk, L., E. Goppert, E. Kallius and W.
Lubosch, eds.) Handbuch der vergleichende Anatomie der Wirbeltiere. 5, pp. 1065—1106.
Urban & Schwarzenberg, Berlin and Wien.
Saban, R. 1968. Musculature de la téte. Jn (Grassé, P. P., ed.) Traité de Zoologie. pp. 279— 471.
Masson et C'®, Paris.
Satoh, K. 1997. Comparative functional morphology of mandibular forward movement during
mastication of two murid rodents Apodemus speciosus (Murinae) and Clethrionomys rufocaus
(Arvicolinae). J. Morphol. 231 :131—142.
Sonntag, C. 1923. The comparative anatomy of the tongues of the Mammalia. IX. Edentata,
Dermoptera, and Insectivora. Proc. Zool. Soc. London 1923 :515—529.
Sonntag, C. 1925. The comparative anatomy of the tongues of the Mammalia. XII. Proc. Zool. Soc.
London 1925: 701—762.
Walker, E. P. 1991. Order Pholidota. Ju (R. N. Nowak and J. L. Paradiso, eds.) Walker’s Mammals
of the World, vol. 1, 4th ed. pp. 470—472. Johns Hopkins Univ. Press, Baltimore and London.
Weijs, W. A. 1975. Mandibular movements of the albino rat during feeding. J. Morphol. 145: 107—
124.
8 Mammal Study 23: 1998
Yen, Y.C. 1984. Comparative studies on characteristics structures of sensory and motor mechanisms
in the stomatognathic system of the pangolin, Manis aunta (Mammalia): 1. Masticatory
muscles and their spindle supply in the pangolin. J.Stomatol. Soc. Japan 51: 674—688.
Yen, Y. C. 1985. Comparative studies on characteristics structures of sensory and motor mechanisms
in the stomatognathic system of the pangolin, Manis aurita (Mammalia): 2. Electron micro-
scopic observations on the masticatory muscle spindles in the pangolin. J. Stomatol. Soc.
Japan 52: 16—43.
(accepted 2 March 1998)
Mammal Study 23: 9-18 (1998)
© the Mammalogical Society of Japan
Histochemical properties of the masticatory muscles
of murids
Katsumi SUGASAWA and Takayuki MOorI*
Zoological Laboratory, Faculty of Agriculture, Kyushu University 46-06, Fukuoka 812-81, Japan
Fax: +81-92-642-2804, e-mail: sugar @agr.kyushu-u. ac. jp
Abstract. Histochemical studies were made of the masticatory
(temporal, masseter and digastric) muscles of the laboratory
mouse, Mus musculus, and laboratory rat, Rattus norvegicus, which
are omnivorous, the golden hamster, Mesocricetus auratus, which is
omnivorous but with a tendency to eat much vegetable matter, and
the Japanese field vole, Microtus montebelli, which is herbivorous.
It was found that the masticatory muscles were composed almost
entirely of fast-twitch fibers. Interspecific differences were found
in the oxidative enzyme activity of the masseter muscle in relation
to rodent dietary habits. The masseter muscles of the mouse and
rat consisted of fast-twitch oxidative glycolytic and fast-twitch
glycolytic fibers, thus they appear to have the capacity for power-
ful, or sudden, and enduring contractions. ~The masseter muscles
of the hamsters were composed only of fast-twitch intermediate
fibers, thus giving them the capacity for moderately enduring
contractions, whereas the vole masseter muscles consisted only of
fast-twitch oxidative fibers, and consequently they appear to have
the capacity for particularly enduring contractions.
Key words: fiber types, food habits, histochemistry, masticatory muscles,
murids.
The wide range of mechanical demands imposed upon the masticatory appara-
tus of mammals is reflected in its structural and functional diversity. Despite
detailed descriptions of skull and mandible anatomy, and analyses of patterns
of jaw movements and coincident muscle activity in a wide variety of mammals
(De Gueldre and De Vree 1988), little is known about the histochemical charac-
teristics of the masticatory muscle fibers themselves.
Studies of the masticatory muscles of laboratory animals (Taylor ef al.
1973, Schiaffino 1974), livestock (Suzuki 1977), and man (Ringqvist 1973, 1974)
have demonstrated that, like most limb muscles, these muscles are generally
heterogeneous with respect to fiber type. Other studies have shown that the
masticatory muscles have regional differences in fiber length and fiber distribu-
tion, and that these structurally different regions imply different patterns of
muscular activity (Herring ef al. 1979, Maxwell et al. 1979, Gorniak 1985).
Carnivores chew rapidly, have blade-like dentition for slicing, show little
*To whom correspondence should be addressed
10 Mammal Study 23: 1998
horizontal jaw movement, possess a large temporalis and relatively small
masseter complex, and have a high percentage of fast-twitch fibers in their
masticatory muscles. In contrast, herbivorous animals, such as cows, sheep
and rabbits, chew relatively slowly, have flat teeth for grinding, show extensive
horizontal movements of the lower jaw, possess a large masseter complex and
relatively small temporals, and have a high percentage of slow twitch fibers
within their masticatory muscles.
The characteristic specialization of the Rodentia is their ability to use their
incisors to gnaw hard fibrous substances. Gnawing is possible because their
large upper and lower incisors grow continuously. In rodents, both gnawing
and chewing involve predominantly anteroposterior (pvopalinal) movements of
the mandible. The characteristic structural modifications of rodent mandibles
and masticatory muscles are all related to this propalinal movement.
Although a number of functional studies have been made on mammalian
masticatory muscles, few studies have focussed on the relationships between
the histochemical characteristics of these muscles and the food habits of
rodents.
The purpose of the present study is to clarify aspects of adaptation for
particular feeding habits in murids by comparing the histochemical characteris-
tics of the masticatory muscles of the omnivorous mouse, Mus musculus
(Cunliffe-Beamer and Les 1986) and rat, Rattus norvegicus (Weihe 1986), the
omnivorous golden hamster, Mesocricetus auratus which tends to eat a great
deal of vegetable matter (Hobbs 1986), and the fully herbivorous Japanese field
vole, Microtus montebelli.
MATERIALS AND METHODS
Five adult laboratory mice, four laboratory rats, three golden hamsters,
and eight Japanese field voles were euthenased for this study. The anterior
part of the temporal muscle, Musculus temporalis, the superficial masseter
muscle, M. masseter superficialis, and the anterior belly of the digastric muscle,
M. digastricus, were all removed.
For light microscopy, muscle tissues were rapidly frozen in isopentane
solution cooled with dry ice. Serial cross-sections of the muscles, 8 wm thick,
were obtained and stained: for myosin adenosine triphosphatase (ATPase)
(Padykula and Herman 1955) after alkaline (pH 10.5) or acid (pH 4.3) pre-
incubation (Brooke and Kaiser 1970a, b, Suzuki 1977); for reduced
nicotinamide adenine dinucleotide dehydrogenase (NADH-DH) (Burstone 1962),
and for phosphorylase activities (Takeuchi and Kuriaki 1955).
Fibers were classified as either: slow-twitch oxidative (SO), fast-twitch
oxidative glycolytic (FOG), fast-twitch glycolytic (FG), fast-twitch intermediate
(FI) with intermediate NADH-DH activity between FOG and FG, and fast-
twitch oxidative (FO) on the basis of their differences in their reactivity for
myosin ATPase after alkali and acid pre-incubation, and activity for NADH-
DH and phosphorylase (based on Peter et al. [1972] and Armstrong et
Sugasawa and Mori, Murid masticatory muscles iat
Table 1. Histochemical enzyme activities of myofiber types in the masticatory muscles of
the mouse, rat, hamster and Japanese field vole, Microtus montebelli. —, Unreactive; +,
weak ; ++, modemate; +++ to +++4, strong. For myofiber type, see in the text.
Myofiber ___ Myosin ATP ase NADH-DH Phosphorylase
type pH 10.5 pH 4.3
SO 2 +++ +++ ne
FOG +4+4++ - +++ to ++++ t+ to +++
FG ++++4 = + Ba
FI ++4++ = to at
FO ++4++4+ - +++4+++4 +
ae wT. see Dable 1).
The sizes of the muscle fibers concerned were determined by measuring the
maximum distance across the lesser diameter of 50 fibers (Brooke 1970) of each
type on photographs (1,000) using sections stained for myosin ATPase after
alkaline pre-incubation. Means and standard deviations of the diameter were
calculated.
RESULTS
In the mouse, the temporal, masseter (Figs. la, b, c) and digastric muscles
were composed of 35-46% FOG and 54-65% FG fibers (Table 2). Concerning
NADH-DH activity of the mouse masseter muscle FOG fibers, diformazan
Table 2. Percentages (means + SD) of myofiber types in the masticatory muscles of the
mouse, rat, hamster and Japanese field vole, Microtus montebelli. The numbers of animals
analyzed are given in parentheses.
Animal Myofiber types (%)
Muscle SO FOG FG FI FO
Mouse (5)
Temporal 0 46.0+5.9 5A Oat 59 0) 0
Masseter 0 Sb Oareie Il Golesi Seal 0 0
Digastric 0 30 ete 410 rec aselall () 0)
Rat (4)
Temporal 0) S10) sl) 5), (0) TOSOEE a8 0 0)
Masseter () AblenG iste 37) Nod Baers Uf 0 0)
Digastric 0 SOR Er eZ GOR Sse 542 0 0
Hamster (3)
Temporal 0) se, 3 Si 0EE O33 ) 0)
Masseter 0 0 0) 100+0 0)
Digastric 0 50 else See3 49.9+8.3 0 0
Vole (8)
Temporal 0 SL ay 0 ASO sis 5) 7, 0)
Masseter 0 0) 0) 0) 1000
Digastric Grazie S58 0 0 Oiek ste SEIS 0
WZ Mammal Study 23: 1998
deposits were larger than those of the rat. In mouse masticatory muscles, the
diameter of the FOG fibers in the temporal muscles was smallest (20.37+4.27
um), while the diameter of the FG fibers in the digastric muscles was largest
(42.39+3.84 um) (Table 3).
In the rat, the temporal, masseter (Figs. 2a, b, c) and digastric muscles were
composed of 30-42% FOG and 58-70% FG fibers (Table 2). NADH-DH activ-
ity of the FOG fibers in rat masseter muscles was weak, and diformazan
deposits were smaller than those in the mouse. In rat masticatory muscles, the
diameter of the FOG fibers in the masseter muscles was smallest (19.52+2.80
ym), while the diameter of the FG fibers in the digastric muscles was largest
(46.3845.38 wm) (Table 3).
In the golden hamster, the temporal muscles were composed of 13% FOG
and 87% FG fibers. The masseter muscles consisted only of FI fibers which
reacted strongly for myosin ATPase after pre-incubation at pH 10.5 (Fig. 3a),
did not react at pH 4.3 (Fig. 3b), and reacted intermediately for NADH-DH (Fig.
3c). In particular, the NADH-DH activity of the FI fibers in the masseter
muscles was weak in the sarcoplasm and strong beneath the sarcolemma. The
digastric muscles were composed of 50% FOG and 50% FG fibers (Table 2).
The diameter of the FOG fibers in the temporal muscles was smallest in the
hamster masticatory muscles (31.12+7.12 um). On the other hand, the diame-
ter of the FG fibers in the digastric muscles was the largest among the murid
masticatory muscles (68.582 5.99 wm) (Table 3).
In the vole, the temporal muscles were composed of 54% FOG and 46% FI
fibers. The masseter muscles consisted only of FO fibers which strongly
reacted for myosin ATPase after pre-incubation at pH 10.5 (Fig. 4a), but which
Table 3. Diameters (means + SD) of myofiber types in the masticatory muscles of the
mouse, rat, hamster and Japanese field vole, Microtus montebellz.
Animal Diameter of each myofiber type (um)
Muscle SO FOG FG FI FO
Mouse
Temporal = Nsey(aet i seh a=) aloe = 7
Masseter a D552 He) 1 S022 3) 24 = aa
Digastric = Me ae 5) Sl AY SO ae3} so = ae
Rat
Temporal aad Men (zaz leo SO S020 5), 0 =a a
Masseter = IS Se Za) SOSO0 ES. 910 = =e
Digastric = DOES Cie Aras) ae By) So) = =
Hamster
Temporal = Sl ae AY eS SO ae 6.40) == Ts
Masseter a = =a 36.80+6.16 i
Digastric = ADEN On MOOR DO=aOROO a oa
Vole
Temporal = 19PATE 3726 = 20.40+2.98 =
Masseter = = = = 1SHO0 aa sRS
Digastric 6)5 Wael a = a 22.72 14.17
Sugasawa and Mori, Murid masticatory muscles Is
Fig. 1. Histochemical profiles of the masseter muscles in the mouse.a: myosin ATPase
activity at pH 10.5, b: myosin ATPase activity at pH 4.3, c: NADH-DH activity. FG:
fast-twitch glycolytic fiber, FOG: fast-twitch oxidative glycolytic fiber. Bar: 100 wm.
Fig. 2. Histochemical profiles of the masseter muscles in the rat. Explanations for a, b and
c are the same as for Fig. 1. FG: fast-twitch glycolytic fiber, FOG: fast-twitch oxidative
glycolytic fiber. Bar: 100 um.
14 Mammal Study 23: 1998
Fig. 3. Histochemical profiles of the masseter muscles in the hamster. Explanations for a, b
and c are the same as for Fig. 1. FI: fast-twitch intermediate fiber. Bar: 100 wm.
Fig. 4. Histochemical profiles of the masseter muscles in the vole. Explanations for a, b and
c are the same as for Fig. 1. FO: fast-twitch oxidative fiber. Bar: 100 um.
did not react at pH 4.3 (Fig. 4b), although they reacted strongly for NADH-DH
(Fig. 4c). Large granular diformazan deposits and a strong reaction in the
subsarcolemmal region for NADH-DH were recognized in the masseter muscle
fibers. The digastric muscles were composed of about 10% SO, and about 90%
Sugasawa and Mori, Murid masticatory muscles 15
FI fibers (Table 2). The diameter of the SO fibers in the vole digastric muscles
was the smallest among the murid masticatory muscles (8.70 +/—1.74 wm). On
the other hand, the diameters of the FOG, FI and FO fibers in the vole
masticatory muscles were about 20 wm (Table 3).
DISCUSSION
Adult mammalian skeletal muscles are composed of mixtures of highly
specialized fibers in proportions that reflect the muscle’s function. As for the
muscle fiber types found in this study, it was previously well known that: small
diameter SO fibers predominate in continuously active muscles that generate
low force; FOG fibers are found in muscles capable of maintaining contractile
activity with high force; and large diameter FG fibers are found in muscles
involved in phasic bouts of very high force (Pette and Vrbova 1985). Although,
according to Pette and Staron (1997), IIA fibers do not necessarily equate to
FOG fibers, vole masseter muscle FO fibers, with strong oxidative activity, may
be classified as FOG (IIA) subtype, because the FO fibers of the pectoral
muscles of the bat, Myotis lucifugus, are composed just of rat ILA myosin heavy
chains (Hermanson eft al. 1991). Thus, the FO fibers of vole masseter muscles
also seem to be extremely specialized for fast and sustained contraction. The
FI fibers appear to correspond to IIX fibers characterized by an aerobic
oxidative capacity intermediate between those of FOG (IIA) and FG (IIB) fibers
according to Pette and Staron (1990).
Most information obtained to date on the histochemistry of fiber composi-
tion of masticatory muscles in mammals indicates that they are of a heterogene-
ous nature, and that they vary considerably in the proportion and cross-
sectional area of each fiber type both within and among species (Suzuki 1977,
De Gueldre and De Vree 1991, Hurov et al.1992, Miyata et al. 1996). Such
interspecific variation may be due to differences in feeding specializations
among mammals. The movement of the jaw during the feeding cycle is
relatively complex, and differentiation in muscle fiber composition among the
masticatory muscles reflects the different functions that they play during the
feeding cycle.
The murid masticatory muscles examined in this study were composed
almost entirely of fast-twitch fibers, seeming to imply that murids can quickly
masticate various types of food.
The temporal muscles facilitate the powerful upward movement of the
mandible (Hiiemae and Houston 1971). In the omnivorous mouse, rat and
hamster, these were composed of 13-46% FOG and 54-87% FG fibers, thus
giving them the capacity for powerful, or sudden, and enduring contractions
suitable for gnawing. The temporal muscles of the hamster contained the
most FG fibers indicating that of the species studied, they excelled in phasic
bouts of very high force. In contrast, since the temporal muscles of the
herbivorous vole consist of 54% FOG, and 46% FI fibers, they have a more
enduring contractile ability than either the mouse, rat or hamster.
16 Mammal Study 23: 1998
The masseter muscle, which protracts and elevates the mandible (Hiiemae
and Houston 1971), is the largest masticatory muscle in rodents. The histo-
chemical properties of this muscle in rodents are controversial, because this
muscle contains various proportions of fiber types (Mao et al.1992). The
masseter muscles of the rat were composed of both FOG and FG fibers. These
findings confirmed Miyata et al.’s (1993) observations of rat masseter muscles.
Since the masseter muscles of the mouse and rat consisted of 35-42% FOG and
58-65% FG fibers, they appeared to have the capacity for powerful, or sudden,
and enduring contractions suitable for chewing. The masseter muscle of the
hamster was composed entirely of FI fibers, thus it seemed to have a greater
capacity for enduring contractions than those of either the mouse or the rat.
On the other hand, as pointed out by Sugasawa et al. (1997), the masseter
muscle of the vole consisted only of FO fibers with a remarkably enduring
contractile ability, indicating that among the murids studied here, the vole’s
masseter muscle appears to be best adapted for masticating coarse fibrous
materials.
The digastric muscles, which serve to retract the mandible (Woods 1975),
were found to be composed of FOG and FG fibers in both the mouse and the rat,
confirming Hurov ef al.’s (1992) findings for the mouse and Kiliaridis e¢ al.’s
(1988) findings for the rat. Furthermore, since the digastric muscles of the
mouse, the rat and the hamster were composed of 37-50% FOG and 50-63% FG
fibers, they were able to open their mouths rapidly.
In contrast, the vole, with digastric muscles consisting of 91% FI fibers, is
better suited for enduring contractions, than the other murids.
In conclusion, murid masticatory muscles are composed almost entirely of
fast-twitch fibers, enabling them to masticate quickly. The masticatory
muscles of herbivorous voles have enduring contractile ability, while those of
omnivorous murids have powerful or sudden contractile ability. Such a ten-
dency was particularly reflected in the histochemical properties of the masseter
muscles.
Acknowledgments: We are indebted to Emeritus Professor T. A. Uchida of
Kyushu University for his kind and considerate guidance during the course of
this study, to Emeritus Professor H. Takahara of Kyushu University and
Professor H. Iwamoto of the Laboratory of Animal Husbandry II, Faculty of
Agriculture, Kyushu University for their facilities for histochemical examina-
tions.
REFERENCES
Armstrong, R. B., C. D. lanuzzo and T. H. Kunz. 1977. Histochemical and biochemical properties of
flight muscle fibers in the little brown bat, Myotis lucifugus. J. Comp. Physiol. 119: 141—154.
Brooke, M. H. 1970. Some comments on neural influence on the two histochemical types of muscle
fibers. Jn (Briskey, E. J., R. C. Cassens and B. B. Marsh, eds.) Physiology and Biochemistry of
Muscle as a Food. Vol. 2, pp. 131-153. Univ. of Wisconsin Press, Madison.
Sugasawa and Mori, Murid masticatory muscles 7,
Brooke, M. H. and K. K. Kaiser. 1970a. Three myosin adenosine triphosphatase system: the nature
of their pH lability and sulfhydryl dependence. J. Histochem. Cytochem. 18 : 670—672.
Brooke, M.H.and K. K. Kaiser. 1970b. Muscle fiber types: How many and what kind? Arch.
Neurol. 23: 369—379.
Burstone, M.S. 1962. Enzyme Histochemistry. Academic Press, London, England.
Cunliffe-Beamer, T. L. and E. P. Les. 1986. The laboratory mouse. Jz (Poole, T. B. ed.) The UFAW
Handbook on the Care and Management of laboratory animals. pp. 275—308. Longman
Scientific and Technical, England.
De Gueldre, G. and F. De Vree. 1988. Quantitative electromyography of the masticatory muscles of
Pteropus giganteus (Megachiroptera). J. Morphol. 196 : 76—106.
De Gueldre, G. and F. De Vree. 1991. Fiber composition of the masticatory muscles of Pteropus
giganteus (Brunnich, 1782) (Megachiroptera). Belgian J. Zool. 121 :279—294.
Gorniak, G.C. 1985. Trends in the actions of mammalian masticatory muscles. Am. Zool. 25:
S333.
Hermanson, J. W., W. A. LaFramboise and M. J. Daood. 1991. Uniform myosin isoforms in the flight
muscles of little brown bats, Myotis lucifugus. J.Exp. Zool. 259:174—180.
Herring, S.W., A. F.Grimm and B.R.Grimm. 1979. Functional heterogeneity in a multipinnate
muscle. Am. J. Anat. 154 :563—576.
Hiiemae, K.and W.J.B. Houston. 1971. The structure and function of the jaw muscles in the rat
(Rattus norvegicus L.). I. Their anatomy and internal architecture. Zool. J. Linn. Soc. 50:
75—99.
Hobbs, K.R. 1986. Hamsters. Ju (Poole, T.B.ed.) The UFAW Handbook on the Care and
Management of Laboratory Animals. pp.377—392. Longman Scientific and Technical,
England.
Hurov, J., B. W. C. Rosser, K. M. Baker, R. Choksi, B. J. Norris and P. M. Nemeth. 1992. Metabolic
transitions in rat jaw muscles during postnatal development. J. Craniofacial Genet. Dev. Biol.
IOS — 06.
Kiliaridis, S., C. Engstrom and B. Thilander. 1988. Histochemical analysis of masticatory muscle in
the growing rat after prolonged alteration in the consistency of the diet. Archs. Oral Biol.
Som lo — 193, ;
Mao, J., R. B. Stein and J. W. Osborn. 1992. The size and distribution of fiber types in jaw muscles:
A review. J.Craniomandib. Disord. Facial Oral Pain 6: 192—201.
Maxwell, L.C., D.S. Carlson, J. A. McNamara, J. A. Faulkner. 1979. Histochemical characteristics
of the masseter and temporalis muscles of the rhesus monkey (Macaca mulatta). Anat. Rec.
193 : 389—402.
Miyata, H., T. Sugiura, Y. Kawai and Y.Shigenaga. 1993. Effects of soft diet and aging on rat
masseter muscle and its motorneuron. Anat. Rec. 237: 415—420.
Padykula, H. A. and E. Herman. 1955. Factors affecting the activity of adenosine triphosphatase
and other phosphatases as measured by histochemical techniques. J. Histochem. Cytochem. 3:
161—169.
Peter, J. B., R. J. Barnard, V. R. Edgerton, C. A. Gillespie and K. E. Stempel. 1972. Metabolic profiles
of three fiber types of skeletal muscle in guinea pigs and rabbits. Biochemistry 11 : 2627—
2633.
Pette, D. and R.S. Staron. 1990. Cellular and molecular diversities of mammalian skeletal muscle
fibers. Rev. Physiol. Biochem. Pharmacol. 116: 1—76.
Pette, D. and R. S. Staron. 1997. Mammalian skeletal muscle fiber type transitions. Int. Rev. Cytol.
OR WAS 223:
Pette, D. and G. Vrbova. 1985. Invited review: neural control of phenotypic expression in mam-
malian muscle fibers. Muscle Nerve 8 : 676—689.
Ringqvist, M. 1973. Histochemical enzyme profiles in human masseter muscle with special regard to
fibers with intermediate myofibrillar ATPase reaction. J. Neurol. Sci. 18:133—141.
Ringqvist, M. 1974. Fiber types in human masticatory muscles. Relation to function. Scand. J.
Dent. Res. 82 : 333—355.
Schiaffino, S. 1974. Histochemical enzyme profile of the masseter muscle in different species.
18 Mammal Study 23: 1998
Anat. Rec. 180 :53—62.
Sugasawa, K., K. Ando, T. Mori and S. Shiraishi. 1997. Histochemical and electron microscopic
properties of the masseter muscle in the Japanese field vole Microtus montebelli. Zool. Sci. 14:
369 oA.
Suzuki, A. 1977. A comparative histochemical study of the masseter muscle of the cattle, sheep,
swine, dog, guinea pig and rat. Histochemistry 51 :121—131.
Takeuchi, T. and H. Kuriaki. 1955. Histochemical detection of phosphorylase in animal tissue. J.
Histochem. Cytochem. 3:153—160.
Taylor, A. F., F. W. J. Cody and M. A. Bosley. 1973. Histochemical and mechanical properties of the
jaw muscles of the cat. Exp. Neurol. 38 : 99—109.
Weihe, W.H. 1986. The laboratory rat. UI (Poole, T. B. ed.) The UFAW Handbook on the Care
and Management of Laboratory Animals. pp. 309—330. Longman Scientific and Technical,
England.
Woods, C. A. 1975. The hyoid, laryngeal and pharyngeal regions of bathygerid and other selected
rodents. J. Morphol. 147 : 229—250.
(accepted 16 January 1998)
Mammal Study 23: 19-30 (1998)
© the Mammalogical Society of Japan
Regulation of reproduction in a natural population of
the small Japanese field mouse, Apodemus argenteus
Keisuke NAKATA
Hokkaido Forestry Research Institute, Bibai, Hokkaido 079-0198, Japan
Fax: +81-1266-3-4166, e-mail: nakata @hfri.bibai.hokkaido.jp
Abstract. Changes in reproductive parameters were analyzed
quantitatively in a natural population of the small Japanese field
mouse, Apodemus argenteus. Among individuals born in the cur- .
rent year, the lightest female weighed 8 g at sexual maturity and
the lightest male weighed 10 g._ Irrespective of season, the lightest
mice were found only during the phase of population increase.
Among mice that had over-wintered, the lightest individuals of
each sex to reproduce during the spring population decline weigh-
ed 10 g. In years of high population density, the reproductive
rates of females, even at their peak during August, was below 10%.
In contrast, in low-density years, much higher rates, over 69%,
lasted until October during the increase phase. The patterns for
males were almost the same as those of females during survey
years. According to multivariate analysis, the reproductive rate
of males was largely explained by population density (partial
correlation, 0.732), whereas the reproductive rate of females was
largely explained by the fluctuation phase (0.848). The number of
each sex to reproduce increased in proportion to the density of
potentially reproductive mice at lower densities, but then de-
creased at higher densities. The observed maximun number of
reproductively active mice was 15 males and 21 females in a
one-hectare grid. Temperature appeared not to cause any varia-
tion in the breeding season in this population.
Key words: age at sexual maturity, breeding season, limitation of reproduc-
tion, population density, temperature.
In contrast to the considerable amount of information available on arvicoline
rodents (e.g., Alibhai and Gipps 1985, Taitt and Krebs 1985), little is known
about the multi-annual fluctuations of murine rodent population densities,
particularly of Apodemus species. In almost all cases reported so far,
Apodemus populations usually repeat similar seasonal patterns of density
change from year to year (eé.g., Fujimaki 1969, Watts 1969, Bobek 1973, Nishi-
kata 1979, Flowerdew 1985, Moreno and Kufner 1988, Lin and Shiraishi 1992).
These repeating patterns have led to analyses of density variation in relation
to extrinsic factors such as seed crops and temperature, which show marked
seasonal variation. With the exception of aggression among adult males (see
Watts 1969), however, the effects of intra-population or intrinsic factors affect-
20 Mammal Study 23: 1998
ing Apodemus species have been little studied.
Reproductive inhibition has been stressed as one of the most critical
aspects of population regulation in small rodents. For example, limitation of
the number of reproductively active individuals is corroborated in natural
populations of arvicoline rodents, and the limitation is interpreted as a key
attribute in explaining delayed maturation in individuals of the year (e.g.,
Saitoh 1981, Ostfeld 1985, Nakata 1989).
Montgomery (1989) described spatial density-dependence in the reproduc-
tive activity of female Apodemus sylvaticus, a dependence which he suggests is
a likely regulatory mechanism leading to reproductive inhibition. Temporal
density-dependence in reproduction, however, has hardly been studied in
Apodemus species.
The present study was designed, therefore, to make quantitative analyses
of: 1) multi-annual density fluctuations, and 2) the parameters of reproductive
inhibition in the small Japanese field mouse Apodemus argenteus.
MATERIALS AND METHODS
The study was conducted in a natural mixed forest at Mizuho (43°42’N, 142°
39’E), about 25 km east of Asahikawa, in central Hokkaido, Japan. This
semi-boreal forest consists of both coniferous and broad-leaved trees (Tatewaki
1958, Hamet-Ahti et al. 1974). The dominant tree species are Abies sachalinen-
sis, Picea yezoensis, Cercidyphyllum japonicum, Tilia japonica and Acer mono,
and the undergrowth consists mainly of a dense layer of Sasa senanensis. The
output of seed from these species appeared to be rather constant from year to
year during the years of the study according to local foresters. Climatic data
for the study area can be found in Nakata (1989).
Capture-mark-release studies were undertaken from June 1975 to October
1979 in a trapping grid set at an elevation of about 460 m. One hundred trap
stations were set 10 m apart ina 10 X 10 pattern in this grid. During 1975, and
for two months of 1976, however, the trapping pattern of the grid was changed.
A 5 X 6 pattern was used in June 1975, a 7 X 6 pattern in August and October
1975, and a5 X 10 pattern in May and September 1976. Two Sherman-type
live traps, baited with oats, were set less than one metre apart at each trapping
point, and one trapping session was conducted on three consecutive days each
month during the snow-free seasons.
Captured mice were sexed, weighed, their point of capture was noted, and
their reproductive condition recorded. Assuming that marked individuals
were removed, the size of the population was estimated using Zippin’s (1956)
methods. In order to estimate the effective trapping area (Dice 1938), the mean
observed range lengths were calculated from mice which were captured three
times at two or three different trap points during each trapping session. The
population density per hectare was obtained by dividing the estimated number
of mice by the effective trapping area. The study area and the trapping
procedure are described in more detail in Nakata (1986, 1989).
Nakata, Regulation of reproduction in field mice 21
Males with descended testes were regarded as sexually active, while
sexually active females were those either visibly pregnant, or with medium or
large nipples indicating that they were lactating, or those with perforated
vaginae.
In order to obtain further reproductive data, mice for autopsy were captur-
ed from trap lines located 250-500 m away from the live-trapping grid. These
trap lines were situated in the same vegetation as the main trapping grid,
however some additional trapping sessions were undertaken during months
with snow-cover. The following data were recorded from these mice: weight,
total length, tail length, length of testes, condition of the epididymal tubules
(visible to naked eyes or not: see Jameson 1950), number of embryos, number
of placental scars and uterus width. In addition, the development and wear of
the third upper molar (M?) were used as indices of age (Fujimaki 1966).
In order to be able to make comparisons with other rodent studies, a
“cyclicity” index was calculated for the population: s= /(logN;-logN;,)?/("— 1),
where log WN, is the log density at the same time each year, log N; is its mean and
n the sample size (Stenseth and Framstad 1980, Henttonen ef al. 1985). This
index is the standard deviation of the log density.
Four phases of the fluctuating population were arbitrarily defined (Fig. 1),
these were: 1) the low phase when there were fewer than eight individuals/ha,
2) the increase phase when increase was rapid, 3) the peak, and 4) the decline
phase when decrease was rapid. These four phases occurred in rapid succes-
sion during a period of less than one year (Krebs and Myers 1974).
In order to assess the effect of temperature on the population (see Fig. 5)
temperature records were obtained from the Higashikawa Meteorological
Station (alt. 216m) 10 km south-west of the grid. Records of monthly precipita-
tion and snow depth can also be found in Nakata (1989).
RESULTS
1. Density changes
During the course of our five year study, the Apodemus argenteus popula-
tion varied in size, such that some years were high-density, and others were
low-density (Fig.1). In 1976 and 1978, high-density years, the population
density increased rapidly from May to July, reached its peak in August, then
declined from September onwards. In contrast, in 1977 and 1979, low-density
years, the population decreased from May to June or even August, then in-
creased until October. The autumnal increases were not gradual, and they were
at similar rates of growth as found during high-density years. The changes in
density recorded in 1975 may be somewhat over-estimated as a result of bias
caused by the small-scale of trapping at that time, however, despite that, the
changing pattern was similar to that observed in both 1977 and 1979.
The highest density recorded during the study was 78.5 individuals/ha in
August 1978, whereas the lowest density was 2.8 individuals/ha in August 1977.
The amplitude of the change was 28-fold. As described above, a sharp con-
je Mammal Study 23: 1998
1975 1976 1977 1978 1979
o>) o>)
i.e) 12)
NUMBER PER HECTARE
x
ro)
A oa co MJJASON MJJASO MJJASO
PHASE aerle: IPDia AP Dia) al a i Rae !
Fig. 1. Fluctuation in population density of live-trapped Apodemus argenteus. L=low phase,
I=increase phase, P=peak phase, D=decline phase.
trast was found between different summers and consequently the s-values
varied during the five years being 0.453 in June, 0.567 in August and 0.173 in
October.
The duration of the increase phase was highly variable, ranging from three
months (from September to July in 1976) to eleven months (from September 1977
to July 1978). The over-winter decline phases were rather longer, namely from
September 1976 to May 1977 and from September 1978 to June 1979. The low
phase lasted for three months in 1977, and in 1979 there was no low phase
between the decline and increase phases. The population declined just after
attaining its peak density, and accordingly the peak phase was regarded as a
brief time covering just one month.
2. Age and body weight at reproduction
Among mice of the year, the lightest sexually mature males weighed 10 g
(one male in June 1976), and the lightest sexually mature females 8 g (two
females in July 1976 and October 1977; see Fig. 2). Irrespective of season,
these lightest mice were found only during the increase phase. Among the
autopsied mice, the youngest male was 2-4 months old, and the youngest female
was 1-2 months old (Appendix 1).
Among those mice that had over-wintered, the lightest individuals to
reproduce weighed 10 g (one male and one female in May 1977, and one female
in May 1979), when the population was in the decline phases (Fig. 2). These
light mice were presumably more than eight months old, given that reproduc-
tive activity stopped early in the preceding year (no reproductive females were
live-trapped either in October 1976, or during September and October 1978).
The existence of shortened reproductive seasons was corroborated by the
findings from the autopsied samples (Appendix 1).
Nakata, Regulation of reproduction in field mice i)
3. Reproductive rate and the number of reproductively active individuals
Temporal changes in the reproductive rate of Apodemus argenteus were
examined. In order to quantify the reproductive rate (the percentage of indi-
viduals reproductively active), males were considered capable of reproducing
MALES 7
20 f 1
oh t 1 1s
= , al i int itl
~ ae | | Bie a] 1m 1 |e i
rts a L ne 1 P ora trba i
a ; mp j prac Pi 1!
2 Po opteedp ot om hiaooo P
TT | 7 i a po Tedd Tal ; ;
= [ 2 aI i poco |r ir
— 1 H bla Se 1 leis) a0 f
0 0 0 lo
o O 7 A 10 ea
oO 1 : ail f
:; i I od
Tee B J Ty
FEMALES '
,
i I
\
=20 l
=, “eae ja: !
=a ant ee
G) | PEE
io a Ws i oF
j s i
7 ; i a 4 F
i o
= a: a i
© 10 q D 1
1 0
Bao eeee al ep lor POD DERE Tiggat |! rPDD DI Gli
J A QO MJJASO MJJASON MJJASO MJ JASO
V9.5 1976 1977 1978 nos
Fig. 2. Body weights of live-trapped male and female A. argenteus. Each small rectangle
represents one mouse. Ml=reproductively active mouse, [)=immature mouse including
post-reproductive males, [‘]=post-reproductive female. Numbers are sample sizes. Other
symbols are as in Fig. 1. All mice trapped in May had over-wintered except for one female
of the year in 1978 (see text).
24 Mammal Study 23: 1998
when they weighed 10 g or more, and females were considered capable of
reproducing when they weighed 8 g or more.
Rates of reproduction were closely associated with fluctuation phase and
population density (Fig. 3). The proportion of reproductively active females
during the peak phase in August in high-density years was just 1% in 1976 and
only 5% in 1978, whereas in low-density years (1977 and 1979) much higher
rates, over 69%, lasted until October during the increase phase. Very similar
patterns were found for males, except that in July 1979 the proportion suddenly
dropped to 52% and then remained lower than that of females.
The effects of the three important variables, population density, fluctuation
phase, and season, were estimated using the quantification-I method (a multiple
regression analysis using dummy variables: Hayashi 1952, Tanaka et al. 1984).
Population density and fluctuation phase were each divided into four cate-
gories, while the seasons were divided into three (Table 1, for internal correla-
tions see Appendix 2). For males, the rate of reproduction was largely ex-
plained by population density (partial correlation, 0.732), whereas for females
the rate of reproduction was largely explained by the fluctuation phase (0.848).
Furthermore, season contributed considerably to the variance of the rate for
each sex (0.514 or 0.456), however its partial correlation coefficients were the
smallest among the three variables. Thus the intra-population variables
affected the reproductive rates of the two sexes in different ways, and made a
greater contribution in explaining the reproductive rates than did the climate
variable.
oe
100
LJ
>
=
O
a |
: Wh \3
og
ae
LJ
og
0
PHASE II 1 PODDD Dee Lee II] 1PDDD Drie
JI A OQ MJJASON MJJASON MJJASON MJJASO
1975 1976 1977 1978 1979
Fig.3 Changes in the reproductive rate of A. argenteus. @=males,=females. Numbers
are sample sizes of less than six. Samples from the live-trapping grid and trap-lines were
pooled to increase sample size. Other symbols are as in Fig. 1.
Nakata, Regulation of reproduction in field mice ap)
Table 1. Variables and their category scores correlated with reproductive rates of the two
sexes in Apodemus argenteus.
Males Females
Variables Categories Freq. : SSE SSS
Scores Partial cor.* Scores Partial cor
Population 0-19 10 falls G5) 0.732 10.631 0.466
density(/ha) 20-39 9 = 474 —(0.965
40-59 he) = 9.994 =—4-390
60-79 4 oll sults — 18.920
Fluctuation Increase ial 11.508 0.679 6.999 0.848
Phase Peak 3 = 6.17 —= hs). (All
Decline 6 = 5 SAE — 39.146
Low 8 (35 30.509
Season May-Jun 9 15.246 0.514 12.688 0.456
Jul-Aug 9 = 3,485) SOC
Sep-Nov 10 = 10) 63 ONS
Multiple correlation coefficient (R?) 0.811 0.838
*Partial correlation coefficient.
Reproductively active mice were trapped until August or September during
the decline phase in the high-density years of 1976 and 1978, whereas they were
found until October or even November during the increase phase of the low-
density years 1977 and 1979 (Fig. 2). In the latter two years, the extended
reproductive activity included elements of the following two cohorts. During
1979, for example, the mice that had over-wintered continued to breed until as
late as October, and a large number of mice of the year bred between July and
October (see also Appendix 1). Similarly, both continuance and participation
were found in 1977. In contrast, in the high-density years of 1976 and 1978,
over-wintering mice played a large part in reproductive activity by June or July
compared with just a few mice of the current year which reproduced by July.
Regarding the relationship between the number of reproductively active
mice and the number of potentially reproductive mice (the potential density),
the number of reproductively active females increased in proportion to the
potential female density at lower density levels, but then decreased at higher
potential female densities (Fig. 4). A similar relationship was found for males.
The maximum number of reproductively active males in a one-hectare grid was
lower than that of reproductively active females: 15 males and 21 females.
Reproductively active mice were found in November 1977, when the mean
temperature was 4.0 °C, but not in either October 1976 when the temperature
was 10.4 °C, or September 1978, when it was 14.3 °C (ten day means were
obtained from meteorological data). Furthermore, reproductively active mice
occurred naturally in October 1977 and October 1979, when the mean tempera-
tures were both 11.0 °C. Thus the relationship between autumn temperature and
the occurrence of reproductively active mice was contradictory.
26 Mammal Study 23: 1998
Nh
O
—_)
un
©
U1
NUMBER OF REPRODUCTIVELY ACTIVE MICE
O 10 20 30 40
NUMBER OF POTENTIALLY REPRODUCTIVE MICE
Fig.4 The relationship between the number of reproductively active individuals and of
potentially reproductive individual live-trapped A. avgenteus. @=males, O=females.
DISCUSSION
Henttonen ef al. (1985) used an s-value greater than 0.5 and a summer
decline to classify populations as cyclic. Furthermore, among Microtus popu-
lations, Taitt and Krebs (1985) revealed that the amplitude of a cyclic popula-
tion is usually more than ten-fold. The present study population was found to:
have an s-value of 0.567 in August samples ; decline during summer ; and have
an amplitude of more than 28-fold. According to Henttonen ef al.’s (1985) and
Taitt and Krebs’ (1985) criteria, the fluctuation observed during this study may
be regarded as cyclic.
The population fluctuations of A. avgenteus have been commonly found to
be rather stable, repeating similar seasonal patterns from year to year (é.g.,
Fujimaki 1969, Nishikata 1979). The density variation described in this study
substantiates the wider variability of population fluctuation, and essentially
provides the first example of cyclicity in a population of this species.
Age and body weight at sexual maturity were closely associated with the
fluctuation phase. Mice matured sexually as early as 30-60 days of age during
the increase and low phases (see Appendix 1). The rapid maturity achieved
among the autopsied samples was exactly the same as that under laboratory
conditions (Fujimaki and Kuwahata 1985). In contrast, delayed maturity
occurred with greater frequency during the peak and decline phases in the
Nakata, Regulation of reproduction in field mice 27
high-density years. Such changes in maturation closely resemble those of
arvicoline rodents (Krebs and Myers 1974, Nakata 1989).
Reproductive intensity was found to be both density- and phase-related
(Table 1, Figs. 2, 3 and 4). Considering that decreasing rates of reproduction,
and delayed maturation, both occurred earlier in high-density years, these
changes are thought to suppress reproductive output and thus accelerate
population decline. It suggests, therefore, that the principal regulating factors
act on the density- and phase-related reproductive activity. Density-related
population regulation has also been described by Montgomery (1989) for
Apodemus sylvaticus, although Murakami (1974) disregarded the significance of
density in population regulation of A. speczosus.
The limitation of the number of reproductively active mice may be a key
attribute causing reproductive inhibition in a given year. Although a temporal
reduction in the proportion of reproductively active adult females has been
reported at high densities in some Apodemus populations (e.g., Watts 1969,
Nishikata 1979, Montgomery 1989), the factors limiting the number of re-
productively active mice has hardly been demonstrated so far. Ostfeld (1985,
1990) hypothesized that female numbers are self-regulating through female
territoriality, and that female numbers partly or wholly determine male num-
bers in relation to mating success. Although the mechanism was not elucidat-
ed in our study population, Ostfeld’s (1985, 1990) arvicoline-based hypothesis is
as plausible for A. avgenteus as for A. sylvaticus (see Wilson et al. 1993). In
comparison with the sympatric Clethrionomys rufocanus, reproduction of A.
argenteus was suppressed at lower density levels with smaller observed maxi-
mum number of reproductively active individuals for each sex, though the
density amplitudes for both species were almost the same (Nakata 1989). Such
interspecific differences in reproductive suppression were also observed among
mature females of the sympatric A. agrarius and Microtus arvalis (Bujalska
1981). These findings suggest that reproduction inhibition is more intense in
Apodemus than in arvicoline species. In other words, reproduction inhibition
probably depends on differences in home range size and in socio-spatial organi-
zation between mice and voles.
Geographical variation in the timing of the breeding seasons of A. specizosus
and A. argenteus seems to be related more intimately with temperature than
with day length (Murakami 1974, Kimura 1977). According to Nishikata
(1979), A. argenteus’ breeding seasons occur in spring when mean temperatures
range from 2.5 to 13 °C, and in autumn when they range from 22.5 to 11.5°C. In
our study population, however, reproduction occurred in autumn 1979 at tem-
peratures well below 11.5 °C and contrarily reproduction did not occur above
11.5 °C in autumn 1978 (Fig. 5). Thus temperature does not always cause the
variations in the breeding season of wild A. argenteus.
When a population fluctuates in a uniform pattern from year to year, the
effect of climate on the breeding season is likely to be well documented. In
contrast, when a population exhibits significant multi-annual fluctuations, the
effects of ecological factors such as density, seed yield and/or predation are
28 Mammal Study 23: 1998
thought likely to be of importance relative to the proximate factors. Adamcz-
ewska (1961) found that an A. flavicollis population reproduced either in
autumn or in spring-summer, and assumed that the crop of tree seeds exerted
an important influence on the duration of the breeding season. Jensen (1982)
then found that A. flavicollis extended its breeding season into winter in years
when trees produced large crops of seeds. Furthermore, A. semotus’ summer
decline in breeding, described by Lin and Shiraishi (1992), is a consequence of
large numbers of yearlings entering the population. These findings also
discredit the effect of temperature on breeding by Apodemus spp.
Acknowledgments : I appreciate the continuous encouragement and the invalu-
able suggestions of Dr. H. Abe throughout this study. I also thank Dr. K.
Kamijo, Dr. T. Saitoh, Dr. T. Kawamichi and Mr. T. Shida for helpful com-
ments on early drafts of this paper. Dr. M. Brazil kindly improved the English
of the final manuscript. This paper is dedicated to Professor H. Abe on his
retirement from teaching at Hokkaido University in March 1997.
= LD)
(@) (@)
MEAN TEMPERATURE (°C)
(@)
Fig.5 Monthly mean temperature records at Higashikawa Meteorological Station. A=
1975, 0=1976, LJ=1977, @=1978, VW =1979.
Nakata, Regulation of reproduction in field mice 29
REFERENCES
Adamczewska, K. A. 1961. Intensity of reproduction of the Apodemus flavicollis (Melchior 1834)
during the period 1954—1959. Acta Theriol. 5:1—21.
Alibhai, S. K. and J. H. W. Gipps. 1985. The population dynamics of bank voles. Symp. Zool. Soc.,
LOGE Se Silay
Bobek, B. 1973. Net production of small rodents in a deciduous forest. Acta Theriol. 18 : 403—434.
Bujalska, G. 1981. Reproduction strategies in populations of Microtus arvalis (Pall.) and Apodemus
agrarius (Pall.) inhabiting farmland. Pol. Ecol. Stud. 7: 229—243.
Dice, L. R. 1938. Some census methods for mammals. J. Wildl. Manage. 2: 119—130.
Flowerdew, J. R. 1985. The population dynamics of wood mice and yellow-necked mice. Symp. Zool.
Socweona: 555015 —-o30:
Fujimaki, Y. 1966. Age variation in the external characters of Apodemus argenteus. Memm. Fac.
Agr. Hokkaido Univ. 5: 212—217 (in Japanese with English summary).
Fujimaki, Y. 1969. The fluctuation in numbers of small rodents. Bull. Hokkaido For. Exp. Stn. 7:
62—77 (in Japanese with English summary).
Fujimaki, Y. and T. Kuwahata. 1984. Life histories. Jn (K. Ota, ed.) Study of wild murid rodents in
Hokkaido. pp. 47—76. Hokkaido Univ. Press, Sapporo (in Japanese).
Hamet-Ahti, L., T. Ahti and T. Koponen. 1974. A scheme of vegetation zones for Japan and adjacent
regions. Ann. Bot. Fennici 11 :59—88.
Hayashi, C. 1952. On the prediction of phenomena from qualitative data and the quantification of
qualitative data from the mathematico-statistical point of view. Ann. Inst. Stat. Math. 3 :69—
98.
Henttonen, H., A.D. McGire and L. Hansson. 1985. Comparisons of amplitudes and frequencies
(spectral analyses) of density variations in long-term data sets of Clethrionomys species. Ann.
Zool. Fennici 22 : 221—227.
Jameson, E. W. Jr. 1950. Determining fecundity in male small mammals. J. Mamm. 31 : 433—436.
Jensen, T.S. 1982. Seed production and outbreaks of non-cyclic rodent populations in deciduous
forests. Oecologia (Berl) 54: 184—192.
Kimura, Y. 1977. On the breeding activity of the Japanese long-tailed field mouse, Apodemus
argenteus, in Urabandai in Fukushima Prefecture. Sci. Rep. Fukushima Univ. 278 :51—57 (in
Japanese with English abstract).
Krebs, C. J. and J. H. Myers. 1974. Population cycles in small mammals. Adv. Ecol. Res. 8 : 267—399.
Lin, L.-K. and S. Shiraishi. 1992. Reproductive biology of the Formosan wood mouse, Apodemus
semotus. J. Fac. Agr. Kyushu Univ. 36: 183—200.
Montgomery, W.I. 1989. Population regulation in the wood mouse, Apodemus sylvaticus. II. Density
dependence in spatial distribution and reproduction. J. Anim. Ecol. 58 : 477—494.
Moreno, S. and M. B. Kufner. 1988. Seasonal patterns in the wood mouse population in Mediterranean
scrubland. Acta Theriol. 33 :79—85.
Murakami, O. 1974. Growth and development of the Japanese wood mouse (Apodemus speciosus) I.
The breeding season in the field. Jap. J. Ecol. 24:194—206 (in Japanese with English synop-
sis).
Nakata, K. 1986. Litter size of Apodemus argenteus in relation to population cycle. J. Mamm. Soc.
Japane liye li:
Nakata, K. 1989. Regulation of reproduction rate in a cyclic population of the red-backed vole,
Clethrionomys rufocanus bedfordiae. Res. Popul. Ecol. 31 :185—209.
Nishikata, S. 1979. Ecological studies on the population of Apodemus argenteus argenteus in Mt.
Kiyosumi, Chiba Pref. I. A life cycle and fluctuations of population size. J. Mamm. Soc. Japan
7: 240—253 (in Japanese with English abstract).
Ostfeld, R.S. 1985. Limiting resources and territoriality in microtine rodents. Am. Nat. 126:1—15.
Ostfeld, R.S. 1990. The ecology and territoriality in small mammals. Trends Ecol. Evol. 5: 411—
415.
30 Mammal Study 23: 1998
Saitoh, T. 1981. Control of female maturation in high density populations of the red-backed vole,
Clethrionomys rufocanus bedfordiae. J. Anim. Ecol. 50 :79—87.
Stenseth, N.C. and E. Framstad. 1980. Reproductive effort and optimal reproductive rates in small
rodents. Oikos 34 :23—34.
Taitt, M. J. and C. J. Krebs. 1985. Population dynamics and cycles. Jn (R. H. Tamarin, ed.) Biology of
New World Microtus. pp. 567-620. Am. Soc. Mammal. Spec. Publ. 8.
Tanaka, Y., T. Tarumi and K. Wakimoto. 1984. [Handbook of Statistical Analysis by Using Personal
Computers. II. Multivariate Analysis.] Kyoritsu Press C. Ltd., Tokyo, 403 pp. (in Japanese).
Tatewaki, M. 1958. Forest ecology of the islands of the north Pacific Ocean. J. Fac. Agr. Hokkaido
Umi HO SS7URKASS.
Wilson, W. L., W.1. Montgomery and R. W. Elwood. 1993. Population regulation in the wood mouse
Apodemus sylvaticus (L.). Mammal Rev. 23 :73—92.
Watts, C.H.S. 1969. The regulation of wood mouse (Apodemus sylvaticus) numbers in Wytham
Woods, Berkshire. J. Anim. Ecol. 38 : 285—304.
Zippin, C. 1956. An evaluation of the removal method of estimating animal population. Biometrics
132 NOs =),
(Accepted on 13 November 1997)
MALES
V [ 1IMNIZ2 Tl I | 6L Mp B2tt
V LEO 0 | ol peer
i 0 86od | © ct, Ole
|
ANN!
peifpent. [ee | U | ial U
< | Id [a l
>t BMA's
OV zi Lag | lIB@GZde mil
IV 1 il Zl em 277ml | |
Hi El tia [Me | ‘Tete! tl
I] I J D00 100 O00 | ww
I IU [ [
a ee
J A QO MJJASON MJ JASON MJ JASON MJ JASO
1975 1976 1977 1978 1979
Appendix 1. Age distribution of trapped A. argenteus. Each small rectangle represents one
autopsied mouse. MHl=reproductive, //=post-reproductive, |)=immature mouse. Age clas-
ses were: I =25 days old, Il =1-2 months old, III =2-4 months old, VW =4-10 months old, and
V =10-18 months old.
Appendix 2. Simple correlation coefficients between reproductive rate (Y), population
density(X,), fluctuation phase(X,), and season(X;)
Males Females
xe xe X53 Xy Xo X3
Y 0.746 0.562 0.618 0.637 0.822 0.410
xX 0.184 0.467 0.386 0.458
X2 OL178 0.083
Mammal Study 23: 31-40 (1998)
© the Mammalogical Society of Japan
Den site selection and utilization by the red fox in
Hokkaido, Japan
Kohji URAGUCHI: and Kenichi TAKAHASHI?
Hokkaido Institute of Public Health, Sapporo O60-O819, Japan
Fax. +81-11-736-9476, ‘e-mail. ura @iph.pref.hokkaido.jp, *e-mail. takaken @iph.pref.hokkaido.jp
Abstract. Den site selection and den use by the red fox, Vulpes
vulpes, were studied on the Nemuro Peninsula, eastern Hokkaido,
Japan. Certain physical variables of 144 fox den sites were
compared with those of 236 randomly selected control locations.
The red foxes on the Nemuro Peninsula clearly preferred to den on
slopes in woodlands near open spaces and streams. The seasonal
pattern of den utilization was studied from June 1986 to May 1987.
Red foxes used dens mainly during the period from January to
June. Since this period coincides with the gestation, parturition
and cub rearing periods of the red fox, it was confirmed that the
red fox’s den was fundamentally a breeding site. Almost all dens
were observed each spring from 1986 to 1996 to establish whether
they were used for breeding or not, and it was found that the
number of fox families was stable during this decade.
Key words: den, Hokkaido, red fox, habitat selection, Vulpes vulpes.
Habitat selection is a reflection of a species’ environmental, ecological and
physiological requirements. For the red fox, Vulpes vulpes, den sites are very
important because the cubs are born there and because they are reared there
while still juveniles. Therefore, foxes might be expected to exercise some
preference when choosing locations for their dens. Although many studies
have described fox den characteristics in different habitats (e.g., Scott and
Selko 1939, Storm et al. 1976, Roman 1984, Zhou et al. 1995), there have been
few quantitative studies on den site selection by red foxes (Nakazono and Ono
1987, Meia and Weber 1992).
Information on den site preferences, and on the number of breeding dens
being used in a given area, are useful for understanding both the habitat
evaluation being made by red foxes for reproduction, and any trends in their
population dynamics. Furthermore, such an understanding is helpful in the
development of control measures against zoonoses transmitted by red foxes.
In this study, we describe the habitat factors associated with dens that we
detected by comparing certain variables from den sites with those of control
sites, and we also describe the utilization pattern of fox dens in Hokkaido,
Japan.
32 Mammal Study 23: 1998
STUDY AREA
The study area (73.0 km?) is located in the central part of the Nemuro
Peninsula in eastern Hokkaido. The area is composed of low rolling hills with
about twenty streams in small eroded valleys with steep slopes. The highest
point was only 55 m above sea level. The study area consisted of a mosaic of
pastures (43.6%), grasslands (24.7%), woodlands (20.7%) and residential areas
(11.0%). The pastures consisted largely of Phleum pratense which was culti-
vated for pasturage and hay-making. The grasslands were dominated by Sasa
nipponica, Gramineae spp. and Avtemisia montana. The woodlands were
principally located along the banks of streams and were dominated by broad-
leaved deciduous trees such as Quercus nipponica, Alnus hirsuta and Betula
ermani. There were also small woodlots of Abzes sachalinensis. The climate
of this area is cool: the mean February temperature is —5.3°C and the mean
August temperature is 17.1°C. It usually snows from late December to March,
and the average yearly precipitation is 1,035mm (National Astronomical
Observatory 1996). The human population of this area was about 30,000, 95%
of whom lived in two residential areas. There were some fishing ports along
the sea coast, and 54 dairy farms were scattered through the area.
METHODS
The field work for this study was conducted from 1986 to 1996, however
forty-eight fox dens had already been located before the main field study began
as a result of questioning farmers and from field inspections made during 1984
and 1985 (Kondo pers. comm.). Since this preliminary information suggested
that there were few dens in pastures, we searched for fox dens in grasslands and
woodlands mainly during May and June 1986. Because most of the woodlands
in this area were located along streams, almost all stream banks were inspect-
ed. Stream banks were usually surveyed by one observer traversing upstream
along one bank and downstream along the other. In open areas, such as
grassland slopes, binoculars were also used.
Most dens observed in Hokkaido consist of tunnels with a diameter of some
20cm excavated by the foxes themselves. Although rabbits, Ovyctolagus
cuniculus, and badgers, Meles meles, dig tunnels in this size range elsewhere,
hence leading to some difficulties of identification (Cowan 1991, Roper 1992),
neither rabbits nor badgers are found in Hokkaido. Raccoon dogs, Nyctereutes
procyonoides, possibly use such tunnels as their dens, but few individuals occur
in this study area (Kondo pers. comm.). Therefore, we regarded all excavated
tunnels with a diameter of circa 20 cm as fox dens.
All dens were marked on a 1: 50,000 map, and numbered in the order that
they were found. At each site, we measured a series of variables which were
considered likely to be associated with dens, as in previous studies (Zhou e¢ al.
1995, Scott and Selko 1939, Roman 1984, Nakazono and Ono 1987, Meia and
Uvaguchi and Takahashi, Den site selection by red fox 33
Weber 1992). These variables included: 1) habitat type within 10m of the
primary entrance, 2) the number of entrances, 3) eight grade directions of the
slope of the primary entrance, 4) the angle of the slope on which the primary
entrance was located, 5) the distance to the nearest open space (non-wooded
area which was more than 10m in diameter), 6) the distance to the nearest
source of water, 7) the distance to the nearest dwelling house, and 8) the
distance to the nearest road.
The occurrence of red fox dens within habitats versus the relative avail-
ability of habitats, determined from vegetation maps was tested using the
G-test for goodness of fit (Sokal and Rohlf 1981). On the Nemuro Peninsula,
even if foxes were to excavate dens in pastures, they would soon be destroyed,
because the pastures are harvested by tractor every summer and autumn, and
are plowed every three to five years. Two fox families that made their dens
in residential areas during this study were immediately turned out or captured
by city officers as pests. We, therefore, regarded pastures and residential
areas as unsuitable habitat for denning by red foxes, and have excluded them
from further discussion of den site selection by foxes on the Nemuro Peninsula.
To ascertain which habitat factors influenced den site selection by red
foxes, variables from den sites were compared with control sites within grass-
lands and woodlands. Five hundred control locations were marked randomly
onal: 25,000 map; the 264 control sites that fell within pastures or residential
areas were excluded from the analysis leaving 236 control sites within grass-
lands and woodlands. Distances to the nearest house and road were measured
from maps, and the distance to the nearest open space was measured from
aerial photographs. Because the direction and angle of a slope and the dis-
tance to the nearest source of water were difficult to measure from either maps
or aerial photographs, 80 of the 236 control sites were chosen randomly and
visited using a hand-held GPS receiver (GPS45, GARMIN INTERNATIONAL)
and the variables of the sites were measured directly.
The habitat surrounding fox dens and habitat availability were compared
using a 4X2 G-test of fitness. The mean values of the angle of the den slope
and four kinds of distances for both den sites and control locations were
compared using the two-tailed Mann-Whitney U-test. The frequencies of
eight grade directions of the slope in the two samples were compared using an
8x2 G-test of independence (Sokal and Rohlf 1981). Repeating individual
statistical tests increased the chance of type I errors. To compensate for this,
we took the standard probability of $0.05 and divided it by the total number
of tests (x=6) looking for differences in physical variables between den sites
and control locations (Ortega 1987). Consequently, the conservative signifi-
cance level (f/$0.008) was used.
Dens were defined as either a) unoccupied, b) occupied but without cubs, or
c) occupied with cubs (breeding dens) based on the presence of signs found
during monthly visits from June 1986 to May 1987. The distinction between
dens with or without cubs was based either on the direct observation of cubs,
or on the presence or absence of conspicuous marks indicating their presence,
34 Mammal Study 23: 1998
e., polishing of excavated soil by cubs moving in the out of the den, fecal
remains, and signs of play such as flatten grasses.
From 1988 to 1996, dens were usually observed just once a year in spring in
order to check the breeding status of the fox population. As the peak of fox
parturition occurs from late March to late April in Hokkaido (Abe 1974), and
because juveniles usually begin to emerge from the dens when about six weeks
old, that is during May (Lloyd 1980), we mainly observed dens during the latter
half of May.
Red foxes are susceptible to even slight disturbance, and often move their
juveniles from one den to another (Sargeant 1975, Storm ef al. 1976, Lloyd 1980,
Stubbe 1980, Nakazono and Ono 1987) making it difficult, therefore, to distin-
guish between natal dens and to which juveniles have been moved (rearing
dens). In this paper, therefore, we have used the term “breeding den” to
include both natal and rearing dens. Given the risk of disturbing the foxes and
causing them to move by observing them, adjacent dens were always observed
on the same day so as to avoid double-counting litters.
A single vixen and her cubs might use several breeding dens, hence the
number of breeding dens used did not equate to the number of families. In this
study, the minimum distance from a breeding den to an adjacent family was
assumed to be 500 m because 12 out of 15 known den translocations involved
movements of less than 500m from the original den as indicated by radio-
tracking and tag observation (Uraguchi unpublished). Dens within 500m of
each other were regarded, therefore, as belonging to one pee and all other
dens were assigned to different families.
RESULTS
1. Den site selection by red fox
A total of 161 fox dens were found in the study area by May 1996. The
defining variables of 144 of those dens were recorded (the remainder were either
destroyed by man or collapsed naturally). One hundred and twenty-eight, out
of the 144 dens (88.9%), consisted of tunnels excavated by the foxes themselves,
while the remaining 16 dens were artificial (underfloors of abandoned houses or
warehouses, and under concrete debris). One den was found in pasture land,
although systematic searching was not conducted in this habitat.
Table 1. A comparison between the habitats of red fox den sites and habitat availability in
a study area on the Nemuro Peninsula (7=140).
Habitat type
Deciduous Coniferous Mixed Grassland
forest forest forest
Percent available 40.0 A Ls yA
Observed number (%) of dens* 50), oe ao) (eo) 53 (37.9)
Expected number of dens 56.0 Ons. 4 (Ase)
*Excepted four dens that were situated pastures or under the floors of houses.
G=20.8, ad.f.=3, p<0.005.
Uraguchi and Takahashi, Den site selection by red fox 30
Table 2. Mean values (+ SD) of physical variables of fox den sites and control sites within
woodlands and grasslands on the Nemuro Peninsula.
Variables Den sites n Control sites n p
Angle of slope (° ) 305 (GE6 2) 107 55,6) (aes 20) 80 <0.0001*
Nearest stream (m) 85.6 (4134.9) 144 185.9 (4260.0) 80 <0.0001*
Nearest open space (m)** 137 (e207) 87 38.4! (2235..0) 85 0.0003*
Nearest house (m) 408.7 (4248.6) Wal AGG83 (GEL 3) 236 0.0251
Nearest road (m) BUG (aeV 13) dal 48808 (GEA 5) 236 ORSSia7
*p<0.008
**Comparison between den site and control site within forests.
Red fox den sites were not distributed randomly according to habitat
availability. Dens were found more often than expected in woodlands and less
often than expected in grasslands (Table 1). Furthermore, dens within wood-
lands were located significantly closer to open spaces than were control loca-
tions within woodlands (p=0.0003, Table 2). In our study area, most of the
open spaces close to dens were grasslands. Fox dens were also located signifi-
cantly closer to water sources (usually a stream), and on steeper slopes than the
control sites. Den sites and control locations did not differ significantly in
their distance from either the nearest house or the nearest road. The direction
that slopes on which dens were located faced were recorded at 111 den sites and
at 69 control locations. Dens occurred more frequently on slopes facing west
and south-west and less often on slopes facing east or south-east than control
locations, but this difference was not significant (G=15.4, d.f.=7, p=0.03).
The average number of entrances per den for 140 dens was 3.5£3.6 (meant SD,
range 1-36).
Five physical variables of 20 dens used for breeding more than five times
during the 11 year study were compared with those of 21 dens that were never
used for breeding during the same 11 years. There was surprisingly no signifi-
cant difference between them (Table 3).
2. Seasonal patterns of den utilization
Although fox dens were utilized all year around, the proportion of dens
utilized varies seasonally (Fig. 1). The percentage of dens utilized decreased
during July, and remained low until December, then increased again during
January, and remained high until June. Dens occupied by cubs were found
from April onwards, but most of them were observed during May, June and
July.
3. Annual change in the number of breeding dens
The numbers of breeding dens and the numbers of families (estimated by
the use of the 500m criterion) were calculated each year from 1987 to 1996,
though not from 1986 because the sample size that year was too small (Table
4). The number of the breeding dens was 22-41 and the estimated number of
families was 20-31. There were no significant differences between successive
36 Mammal Study 23: 1998
Table 3. Mean values (+ SD) of physical variables at dens used for breeding more than five
times (7=20) and dens never used for breeding (x=21) during the 11 years from 1986 to 1996
on the Nemuro Peninsula.
Variables Breeding dens Non-breeding dens p
Angle of slope* (° ) 315.3 (a215L,,0) 29 56.(GE 5a) 0.402
Nearest stream (m) 85.0 (4148.7) 4: OF Gali 8i40) 0.657
Nearest open space (m) Gan (== 19>) BAS (E23 .,5)) 0.408
Nearest house (m) A063) (GE 17553) ANQ 3) GE22252) 0.927
Nearest road (m) 248.8 (4148.1) 238.9 (+185.9) 0.676
*For this variable only, the sample size for breeding dens was 19, and that for non-breeding
dens was 18.
years in either the numbers of breeding dens used or the estimated number of
families, however, the number of breeding dens fluctuated more than the
estimated number of families, and their trends were not always consistent with
each other.
Eighty-two dens were observed every year from 1986 to 1996. Of these 82,
61 (74.4%) were used for breeding at least once during the 11 year study. One
den was used 11 times, three were used nine times each, and six were used eight
times for breeding. These estimates are considered to be lower than actuality,
because most dens were visited only once a year from 1988 onwards, thus
breeding activity may have been missed.
”
ec
®
3 SO
T
©
a 40
oO
(o)
So 30
5
eZ
S
Cc
Bie cool
®
Of 8G
J RSS +O ON UD Jd CRO M AM
88 93 95 95 96 99 102 71 101 102 101 103
1986 1987
Fig.1. Monthly variation in the proportion of dens occupied during the period from June
1986 to May 1987. MH: dens with cubs, LJ: dens without cubs. The number below each
column represents the number of dens observed.
Uraguchi and Takahashi, Den site selection by red fox ot
Table 4. The number of breeding dens and estimated families. Expected numbers were
calculated from the ratio of the average number of breeding dens and families to the average
number of observed dens.
0.1 GS3 4) 9019
DISCUSSION
Although red foxes are able to make their dens in various environments
such as in woodlands, grasslands, plowed fields, pastures, dunes, among rocks
and residential areas (Sheldon 1950, Nakazono 1970, Sargeant 1972, Abe 1974,
Storm et al. 1976, Harris 1977, 1981, Macdonald and Newdick 1982, Roman 1984,
Nakazono and Ono 1987), in this study area, their dens were strongly associated
with relatively steep slopes near streams and open spaces in woodlands. The
question remains open as to why they prefer these areas rather than others for
denning.
Den sites on steep slopes, as found during our study, may well be advanta-
geous because of their good drainage. Some previous studies have also demon-
strated that many fox dens are to be found in well-drained soil (e.g., Scott and
Selko 1939, Sheldon 1950, Roman 1984), and most dens have been found on
slopes with gradients of 5-10% or more (Scott and Selko 1939). On the Nemuro
Peninsula, the angle of the slopes on which primary den entrances were located
were relatively steep (meant SD =32.5+15.2°). Such den site selection may
have been related to the fact that the soil of the study area consisted largely of
Gleyic Cumulic Andosols which are badly drained (Hokkaido National Agricul-
tural Experiment Station 1985). Slopes may be advantageous for denning for
other reasons in addition to drainage. Digging and the removal of soil may be
easier, for example, and on steep slopes perhaps rain and snow are less likely
to fall into the dens.
Goszczyfski (1989) described forests as primary shelter for foxes and for
raising their young. Woods may also serve to provide shelter for juvenile
foxes. In the present study area, however, fox dens within woodlands were
situated closer to open spaces than were control sites within woodlands indicat-
38 Mammal Study 23: 1998
ing that open areas are also important for them. Nakazono and Ono (1987)
suggested that juvenile foxes require substantial amounts of sunshine for
normal growth. Marginal sites in woodlands might be preferable both for
sheltering and for providing sunning opportunities for juveniles.
Although many fox dens were situated near streams, we do not believe
them to be essential for drink water, because adult foxes are able to find water
to drink in many situations. Moreover since one den, located 300 m away from
a stream, was used for breeding four times during five years, a stream does not
seem necessary for juveniles to drink at either. The Nemuro Peninsula experi-
ences many foggy days during late May and June when young foxes are being
raised in the breeding dens. It is more than likely that the cubs are able to
obtain sufficient water by licking leaves wet with fog and from the food
provided by their parents. There is a tendency for steeper locations to be
closer to a source of water (Fig. 2), thus the reason why many dens were
situated near streams was probably the result of the foxes’ preference for
well-drained, steeper slopes.
No difference was found in five physical variables between breeding and
non-breeding dens. During the course of this study, we were unable to evaluate
the impact of disturbance by other animals, especially humans and stray dogs,
on fox breeding, because it was difficult to express quantitatively. Distur-
bance is, however, considered an important variable affecting selection and
(")
60
50
40
30
Angle of slope
20
10
0 200 400 600 600» *' TOGO" 1200 Vim
Distance to the nearest source of water
Fig.2. The relationship between the angle of slope and the distance to the nearest water
source of 80 control locations.
Uraguchi and Takahashi, Den site selection by red fox 39
utilization of fox den sites (Storm et al. 1976, Harris 1977, 1981). One reason
why no difference was found between breeding and non-breeding dens might be
because of the absence of any measure of this “disturbance” factor in our
analysis.
In the Nemuro area, fox dens were mainly used during the period from mid
winter to early summer, a tendency also reported for the red fox in Kyushu,
southern Japan (Nakazono and Ono 1987). In Hokkaido, fox mating peaks
from late January to mid February followed by a peak in parturition from late
March to late April (Abe 1974). The period during which dens were used most
intensively in the Nemuro area corresponded, not surprisingly, with the period
of mating, parturition and rearing of cubs, confirming that dens are fundamen-
tally breeding sites for the red fox. Of interest, therefore, is the fact that about
half of the dens occupied were not used for rearing cubs during the later winter
and early spring period, and 11-17% of dens were used even during the period
from August to December, though not for breeding. Since few of the signs
typical of frequent use such as polishing of excavated soil were observed, these
dens might have served just as temporary retreats (Nakazono and Ono 1987).
The density of families estimated using the 500m criterion was 0.27-0.42
families/km?, and was stable over a period of 10 years. There have been few
studies on the density of fox families in Japan, however, the density in Nemuro
was clearly higher than in either Yabe, Kyushu (0.18 families/km’, Nakazono
and Ono 1987) or in Koshimizu, Hokkaido (0.24 families/km?, Abe 1974). Some
studies in southern Sweden, central Europe and England have indicated that
where vole densities are high, then fox populations became socially regulated
stable and dense. The relatively high and stable density of fox families on the
Nemuro Peninsula is probably due to the high density of voles in the area
(Saitoh and Takahashi 1998) and the richness of alternative food, such as
organic waste from fisheries and from dairy farms (Kondo eft al. 1986).
Acknowledgments: We are grateful to Dr.H. Abe for his valuable advice
during the course of this study, and dedicate this paper to him on his retirement
from Hokkaido University. We thank T. Saitoh, E. Misawa, K. Yagi and the
students of the Institute of Applied Zoology of Hokkaido University who
assisted us with the search for fox dens. We also thank N. Kondo, many dairy
farmers, hunters and citizens of Nemuro City and the staff of the Nemuro
Health Center and of the Nature Preservation Section of Nemuro Sub-
prefectural Office of the Hokkaido Government for useful information about
the red fox on Nemuro Peninsula.
REFERENCES
Abe, H. 1974. Biology of red fox. Jn (Taketazu, M. ed.) Red Fox. pp. 76—83. Heibonsha, Tokyo (in
Japanese).
Cowan, D. P. 1991. Rabbit. Jn (Corbet, G. B. and S. Harris, eds.) The Handbook of British Mam-
mals 3rd ed. pp. 146—154. Blackwell Scientific Publications, Oxford, London, Edinburgh,
Boston, Melbourne, Paris, Berlin and Vienna.
40) Mammal Study 23: 1998
Goszczyfiski, J. 1989. Population dynamics of the red fox in central Poland. Acta Theriol. 34:
Ady
Harris, S. 1977. Distribution, habitat utilization and age structure of a suburban fox ( Vulpes vulpes)
population. Mammal Rev. 7: 25—39.
Harris, S. 1981. An estimation of the number of foxes ( Vulpes vulpes) in the city of Bristol, and some
possible factors affecting their distribution. J. Appl. Ecol. 18: 455—465.
Hokkaido National Agricultural Experiment Station. 1985. Classification and distribution of arable
soils in Hokkaido. Sapporo, 95 pp. +1pl.
Kondo, N., K. Takahashi and K. Yagi. 1986. Winter food of the red fox, Vulpes vulpes schrencki
Kishida, in the endemic area of multilocular Echinococcosis. Report of the Preparative Office
of Nemuro Municipal Museum. 1: 23-31.
Lloyd, H.G. 1980. The Red Fox. Batsford, London, 320 pp.
Macdonald, D. W. and M. T. Newdick. 1982. The distribution and ecology of foxes Vulpes vulpes (L.)
in urban areas. Jn (Bornkamm, R., J. A. Lee and M. R. D. Seaward, eds.) Urban Ecology. pp.
123—135. Blackwell Scientific Publications, Oxford, London, Edinburgh, Boston and Mel-
bourne.
Meia, J.S. and J. M. Weber. 1992. Characteristics and distribution of breeding dens of the red fox
(Vulpes vulpes) in a mountainous habitat. Z. Saugetierkunde 57 : 137-143.
Nakazono, T. 1970. Researches of burrows of Vulpes vulpes japonica, in Kyushu, Japan 1. Exam-
ples of the burrows and the distributions. J. Mammal. Soc. Japan 5:1—7.
Nakazono, T. and Y. Ono. 1987. Den distribution and den use by the red fox Vulpes vulpes japonica
in Kyushu. Ecol. Res. 2: 265—277.
National Astronomical Observatory, ed. 1996. Chronological Scientific Tables. Maruzen, Tokyo,
1037 pp.
Ortega, J.C. 1987. Den site selection by the red fox in southeastern Arizona. J. Mammal. 68 : 792—
798.
Roman, G. 1984. The burrow construction strategy of foxes in the Biafowieza primeval forest.
Acta Theriol. 29: 425—430.
Roper, T.J. 1992. Badger Meles meles setts-architecture, internal environment and function.
Mammal Rev. 22 : 43—53.
Saitoh, T. and K. Takahashi. 1998. The role of vole populations in prevalence of the parasite
(Echinococcus multilocularis) in foxes. Res. Popul. Ecol. 40:97—105.
Sargeant, A. B. 1972. Red fox spatial characteristics in relation to waterfowl predation. J. Wildl.
Manage. 36 : 225—236.
Sargeant, A. B. 1975. A spring aerial census of red foxes in North Dakota. J. Wildl. Manage. 39:
3039)
Scott, T.G. and L. F. Selko. 1939. A census of red foxes and striped skunks in Clay and Boone
counties, lowa. J. Wildl. Manage. 3 :92—98.
Sheldon, W.G. 1950. Denning habits and home range of red foxes in New York State. J. Wildl.
Manage. 14 : 33—42.
Sokal, R. R. and F. J. Rohlf. 1981. Biometry. 2nd ed. W. H. Freeman and Company, San Francisco,
859 pp.
Storm, G. L., R. D. Andrews, R. L. Phillips, R. A. Bishop, D. B. Siniff and J. R. Tester. 1976. Morpho-
logy, reproduction, dispersal and mortality of midwestern red fox populations. Wildl.
Monogr. 49, 82 pp.
Stubbe, M. 1980. Population ecology of the red fox (Vulpes vulpes L., 1758) in the G.D.R. In
(Zimen, E., ed.) Biogeographica 18: The Red Fox. pp. 71—96. Dr. W. Junk bv Publishers, The
Hague.
Zhou, W., W. Wei and D.E. Biggins. 1995. Activity rhythms and distribution of natal dens for red
foxes. Acta Theriologica Sinica 15: 267—272.
(accepted 10 April 1998)
Mammal Study 23: 41-48 (1998)
© the Mammalogical Society of Japan
Improvement of errors in radiotelemetry locations of
brown bears, Ursus arctos, in Hokkaido, Japan
Takahiro MURAKAMI and Tsutomu MANO?
‘Laboratory of Ecology, Department of Environmental Veterinary Science, Graduate School of
Hokkaido University, North 18 West 9, Kita-ku, Sapporo O60-0818, Japan
Fax. +81-11-706-5569, e-mail. ursus @ vetmed.hokudai.ac.jp
?Wildlife Section, Nature Conservation Department, Hokkaido Institute of Environmental Sciences,
North 19 West 12, Kita-ku Sapporo O60-O819, Japan
Abstract. The errors and the sources of errors made while fixing
radiotelemetry locations were estimated in two brown bear, Ursus
arctos yesoensis, study areas, in the Shiretoko and Oshima regions
of Hokkaido. We measured the sampling error and the bias of
test transmitters placed at various points in our study areas. The
means of our sampling errors were approximately equal to those
previously reported by Springer (1979), while the maxima of our
sampling errors and the means of our biases were larger than
those of Springer’s (1979). We also assessed the amount of error
in estimating locations based on measuring three bearings. As
the sizes of triangles were positively related to the degree of error
in estimating their points, we excluded large (> 6.25 ha) triangles
from the analysis. The maximum values of the 99% confidence
intervals for normalized error distances were 321.4 m in the Shir-
etoko area and 302.3 m in the Oshima area. These values were
compared with Lenth’s (1981) Andrews estimators calculated from
the original data sets of both study areas. The direct method for
estimating radiotelemetry error which we used in this study is easy
to calculate and proved not to be inferior to Lenth’s (1981) method.
Key words: brown bear, error estimation, field test, radiotelemetry, triangle
S1Ze.
Radiotelemetry is often used to locate free-ranging wild animals. Numerous
studies including those of home range, habitat use and movement have depend-
ed on radiotelemetry (Samuel and Fuller 1994). Locations, which are esti-
mated by radiotelemetry do, however, include a certain degree of error (Sprin-
ger 1979, Zimmerman 1990).
Because brown bears have much larger home ranges than most other
terrestrial mammals, and because they are difficult animals to approach, the
estimated locations of radio-collared bears may contain large degrees of error.
Saltz (1994) indicated that many radiotelemetry studies did not describe their
degree of error. Saltz (1994) further asserted that researchers should both
measure and describe their degree of error on the basis that if a radiotelemetry
study were conducted without error estimation, then it could lead to misunder-
42 Mammal Study 23: 1998
standings of animal movements or of their habitat utilization patterns.
Various methods of estimating location error have been described (Heezen
and Tester 1967, Springer 1979, Lenth 1981, Garrott et al. 1986), however,
Zimmerman and Powell (1995) considered that these methods, over-estimate
location errors when applied to field data. Furthermore, some of these
methods have strict prerequisites and some require long calculation processes.
In Japan, Maruyama eft al. (1978) measured the distances between the
estimated and the actual locations of four Sika deer, Cervus, nippon fitted with
transmitters. Maruyama et al’s (1978) study, however, described only the
extent of error under special conditions, and neither indicated how to detect or
decrease errors. Since Maruyama et al’s (1978) study, radiotelemetry studies
reported in Japan have paid little or no attention to error. Improvement of the
error estimation method in the field and the promotion of a greater awareness
of it among researchers is necessary for the appropriate interpretation of large
mammal behavior.
Zimmerman and Powell (1995) introduced an original error indicator which
was based on the statistics derived from the linear distance between the actual
and the estimated locations of test transmitters. We also used test transmit-
ters in the field in order to estimate the degree of error of the location method,
a method often used in Japan, and compared it with Lenth’s (1981) Andrews
estimator. By using our method, researchers who use radiotelemetry to study
large mammals can easily estimate the area of error of their estimated loca-
tions and can improve the precision of their estimation.
STUDY AREA
Our study was conducted in two brown bear radiotelemetry study areas,
one of which was in the Shiretoko National Park in eastern Hokkaido, and the
other of which was on the south-western part of the Oshima Peninsula in
southwestern Hokkaido, Japan.
In the first of these two areas, the Shiretoko-Renzan mountains, ranging in
height from 700m to 1,600m, run along the center line of the Shiretoko
Peninsula. The flanks of these mountains meet the coastline abruptly.
Japanese stone pine, Pinus pumila, is dominant above 500-600 m, while at lower
elevations mixed forest predominates. There are two paved roads which
facilitate radio tracking inside the study area where the road density is 0.37
km/km?.
The second study area, the south-western part of the Oshima Peninsula, is
also mostly mountainous, but here the mountains range from just 200 to 600 m
in altitude. The terrain is more rugged than in the Shiretoko study area
because there are many steep streams. The most common vegetation here is
deciduous forest. There are two paved roads and several forestry tracks
inside the area which facilitate radio tracking. The road density here is 0.44
km/km‘?.
Murakami and Mano, Telemetry error improvement 43
MATERIALS AND METHODS
1. Measurement of Bias and of Sampling Errors
Radiotelemetry error is derived from a combination of bias and sampling
error (Springer 1979), where bias is the angle between the measured value and
the true direction of the transmitter, and where sampling error is the amount of
variation in estimated values when repeatedly taking bearings off the same
transmitter and when using the same apparatus. In order to quantify such bias
and error, we set several 144-147 MHz radio transmitters (Telonics, Inc., Mesa,
Arizona, or Loteck, Inc., Aurora, Ontario) within the study area. Someone
who was unaware of the transmitter’s location was selected to measure sam-
pling errors and biases from several points on one of the roads in the study
area.
Directions were determined using a 3-element Yagi-antenna and an F[290-
mk II receiver (Yaesu Musen, Inc., Tokyo). The direction from each receiving
point to each transmitter was measured 10 times. Following Springer (1979),
we considered pooled standard deviations as the sampling error, and regarded
the angles between the average bearings of measured values and the true
directions as the biases. After one set of measurements was made, the trans-
mitter was moved to another location, and the procedure was repeated. We
included biases derived from the following tests in our analyses.
A map of the study area was overlaid with a grid of 500 m square quadrats.
Because topographical similarity affects results, it was decided to use only one
transmitter set point within a single quadrat. Transmitters were set at 21
points in the Shiretoko study area, and at eight points in the Oshima area. The
distances between the observers and the transmitters, ranged from 350m to
2,150 m (m= SD =1,156.2 +569.9 m) in the Shiretoko study area, and from 175 m
to 3,750 m (m+ SD =1,770.6+£951.2 m) in the Oshima area.
2. Measurement of the Error of Estimated Locations
Maruyama et al. (1978) described an original method which considered the
centroid of the triangle, derived from three bearings as the location of the
transmitter. Some researchers in Japan have used this method (Hokkaido
Institute of Environmental Sciences. 1995), which we now call the Triangle
Center Method or TCM.
Transmitters were set at various points in the study areas, as described in
the previous section ; 17 transmitter set points were used in Shiretoko and 30 in
Oshima. We measured the bearings of the signals from three to nine receiving
points for each transmitter set point and recorded each bearing and receiving
point on 1: 25000 scale topographical maps. The location of each transmitter
set point was calculated using the TCM by a researcher who did not know its
location. We then gauged the distances between the true locations and the
centers of triangles derived from any three bearings. Large triangles exceed-
ing 6.25 ha, which is the size we use in our brown bear study, were excluded
44 Mammal Study 23: 1998
from location estimation in order to improve reliability. This method was
used after confirmation of the positive correlation between triangle size and
error distances.
Lenth’s (1981) Andrews estimator was considered by White and Garrott
(1990) to be the most reliable way to estimate location errors. We calculated
Andrews estimator from our data (computed by TRIANG [Garrott e¢ al. 1986],
provided by G. C. White), and compared this with the TCM error.
The distances between observers and transmitters in our study ranged
from 75 m to 4,063 m (m+SD =1,392+769.2 m) in the Shiretoko area, and from
100 m to 3,750 m (m+ SD =1,185+769.0 m) in Oshima. These values differed
from those obtained in the previous section, because the transmitter set points
were different from those used when measuring bias and sampling error.
RESULTS
1. Bias and Sampling Error
Mean sampling errors were 4.31.7 (SD)° in Shiretoko area, and 6.0+4.5
(SD)° in Oshima area. The maximum sampling errors recorded were 8.7° in
Shiretoko area and 20.2° in Oshima area. Biases ranged from —172° to +61.5°
in Shiretoko area, and from —108 to +140° in Oshima area. Biases aver-
aged —2.3+27.7 (SD) in Shiretoko area, and —3.6+31.9 (SD)° in Oshima area
(see Fig. 1 for the frequency distribution of biases in each study area).
2. Error of Estimated Location
In Shiretoko area, 188 triangles were derived from triangulation of 17
transmitter set points. In Oshima area, we obtained 133 triangles from 30
transmitter set points. The means of estimation errors were 495.5 + 467.4 (SD)
Shiretoko Oshima
\)
RR
Frequency of errors
on
MH
RYYYAAHAVBQH
77 ZZ
-150 -100 -50
(£4 77
100 150 -150 -100 -50 0 50 100 150
Bias (° )
Fig.1. Frequency distributions of biases accompanied by bearings in the Shiretoko and
Oshima study areas. Biases ranged from —172° to +61.5° in Shiretoko area and from — 108°
to +140° in Oshima area.
50
(=)
Murakami and Mano, Telemetry error improvement 45
m in Shiretoko area and 339.2+286.3 (SD) m in Oshima area.
There was a positive correlation between triangle size and estimated
location error when using the TCM (Fig. 2, Kendall’s 7=0.23, P<0.01 in Shir-
etoko area and r=0.35, P<0.01 in Oshima area). When we excluded large
triangles (those exceeding 6.25ha) from the analysis of location error, we
obtained a frequency distribution of location errors (Fig. 3). As these distribu-
tions were not parametric (Shapiro-wilk test for normality, P<0.01), we calcu-
lated the cube root of each value to obtain a normal distribution. After
transformation, the means of the TCM errors were 260.6+7.28 (SD) m in
Shiretoko Oshima
Error distance (m)
Area of triangle (ha)
Fig. 2. The relationships between the estimated location error of the TCM and the areas of
triangles derived from three measured bearings. Estimated locations from larger triangles
tend to have larger location errors.
Shiretoko Oshima
Y
Y
UY yy
Gy;
j
yy.
Gh LY, LY; Wh nU1 7, YG; ALLA
0 400 800 1200 1600 2000 0 400 800 1200 1600
Error distance by TCM (m)
] ]
Y ¢
Y; Yy
Y; Y
Y; Yy
Y; Yj
Y; Yy
Uy; Yy
Y Yy
Y Y
Y
Y
Y
Y
Y
Y
Y
Y
Y
Y
G
Y
Y
Y
y
Y
y
Y
Y
Y
Y
Z
Y Y
Y Y
Uy Y
y Y
]
]
/
/
/
Ly
Y
y
YG
Yy
Uy;
Y
Yy
Y
Yy
y
Y
Uy Yy
ZZ
Frequency of error distance
o
Fig. 3. Frequency distributions of error distances between locations estimated by TCM and
true locations.
46 Mammal Study 23: 1998
Shiretoko area and 241.7+5.96 (SD) m in Oshima area. The maxima of the 99
% confidence intervals were 321.4 m in Shiretoko area and 302.3 m in Oshima
area.
In the same way (though using natural logarithms instead of cube roots for
normalization of the Oshima data sets), the means of the location errors found
by Andrews estimator for the same data sets were calculated to be 258.5+61.08
(SD) m in Shiretoko, and 297.7+7.53 (SD) m in Oshima. The maxima of the
99% confidence intervals in Shiretoko were 319.9m, and 381.6 m in Oshima.
The means of TCM errors did not differ significantly from those of Andrews
estimator in Shiretoko (Student’s t-test, £=0.37, p >0.05), while in Oshima, the
mean of Andrews estimators was significantly larger than that of TCM errors
(Student’s t-test, £=54.3, p<0.01).
DISCUSSION
Springer (1979) who measured biases and sampling errors in field trials
reported that sampling errors ranged from 3.4° to 4.3° and biases ranged from
—(0.4° to 1.7°. In our field tests, although the means of the sampling errors (4.3°
and 6.0°) were nearly equal to Springer’s (1979) values, the maxima (8.7° and
20.2°) were much larger. The means of our biases, —2.3° and —3.6’, did not
differ significantly from zero (Student’s f-test, Shiretoko: t=0.63, p>0.05;
Oshima: t=1.00, p>0.05), however the ranges of our biases were much wider.
These differences may be accounted for by differences in study conditions.
Springer’s (1979) study area was comparatively flat, whereas our study area
contained steep terrain. Sometimes we received radio signals from a very
wide range of directions and as a result we experienced large sampling errors.
Hilly terrain also generates large biases (Lee et al. 1985). Thus, when using
radiotelemetry in mountainous areas such as the Shiretoko and Oshima Penin-
sulas, we must take into consideration the likelihood of large sampling errors
and biases.
Large biases and large sampling errors cause large location errors. It
appears that estimated TCM locations may include large errors. Maruyama
et al. (1978) reported a TCM error of 123+11.8 (SD) m on Kinkazan Island,
however, the maxima of the 99% confidence intervals of the TCM errors for
our two study areas were even larger at over 300m. We consider that this
difference may have been caused by differences in our experimental methods.
Maruyama et al. (1978) did not describe the distance between their transmitters
and receivers, which, on the basis of the figures that appear in their report, may
have been under 800 m. In contrast, the mean distances between transmitters
and receivers in our study was greater than 1,000m. Furthermore, the topo-
graphy of Kinkazan Island is less rugged than that of either of our study areas.
These factors, we believe, may well have affected the results. Zimmerman and
Powell (1995) considered the arithmetic mean of the compass bearing intersec-
tions, derived from three bearings, to be the estimated location, and reported
the mean of the linear distances between their estimated and true locations as
Murakami and Mano, Telemetry error improvement 47
279m. Our TCM error was very similar to this value, and our study conditions
were also similar to theirs. Their tracking distances ranged from 300m to
6,020 m, while ours, ranged from 75m to 4,063 m and from 100 to 3,750 m.
We consider that the long range locations of large mammals are ac-
companied by degrees of error which can not be disregarded, however, when
radiotelemetry is used for animal studies, there is rarely an opportunity to
know the distance between an animal’s real, and its estimated, location. Salts
(1994) recommended that those using radiotelemetry should assess their degree
of error with an appropriate method and should describe their area of error.
Andrews estimator was regarded as robust, particularly where reflected
signals occurred frequently (Garrott ef al. 1986). It was concluded, however,
that Andrews estimator suffers the same extent of error as that estimated by
the TCM, or even a significantly larger error than the TCM. Andrews
estimator maintained accuracy by failing to generate location estimates when
bearings did not adequately converge (Garrott et al. 1986). In our field data,
it may be impossible to eliminate bad locations sufficiently, as many bearings
were biased.
Zimmerman (1990) and Zimmerman and Powell (1995) showed that both the
error polygon method (Heezen and Tester 1967) and Lenth’s (1981) maximum
likelihood estimator which is the origin of Andrews estimator were poor
indicators for estimating location errors and they recommended an approach
using the location error method (LEM). Error areas using this approach were
indicated by circles with 90% and 95% confidence distances between estimated
locations and true locations as their radii (Zimmerman and Powell 1995). Our
approach was essentially the same as the LEM, and our results confirmed the
superiority of this approach. We were able to realize the extent of our TCM
location errors by field testing.
We urge that when researchers begin a radiotelemetry study, they measure
their location precision in the field. They must then judge whether the degree
of error that they record is acceptable or not. They should also describe their
average location distances and the extent of errors in their reports.
In this study, we did not consider possible increases of error resulting from
animal movements. Shumutz and White (1990) calculated such errors by
computer simulation. We should take these errors into account by adding
error or by decreasing the time interval of measurement.
Acknowledgments : We wish to thank Mr. K. Okada, Mr. T. Koizumi, Ms. M.
Endo, Mr. Y. Kawamoto, Ms. A. Kinjo, Ms. T. Matsuhashi, Ms. Y. Matsuura,
Mr. F. Nomura, Ms.H. Maeno, Mr.S.Waga, Mr. K. Suzumura, ‘Mr. N. Fu-
jimoto, Mr. K. Hoshina, Mr. U.Goudo, Mr. H. Shinohara, Mr. H. Hamamoto,
Mr. H. Hashimoto, Mr. M. Asano, Mr. A. Umejima and Ms. T. Sawaguchi, who
devoted themselves to our field test. We are indebted to Mr. Y. Yamanaka,
Mr. H. Okada and the staff of the Shiretoko Nature Center and members of
Hokkaido University’s brown bear research group for supporting our research.
Thanks are due also to: Dr. N. Ohtaishi, Dr. M.Ohmiya, Dr. Y. Ono, Dr. Y,
48 Mammal Study 23: 1998
Kurashige, Mr.S. Kameyama and Dr. H. Tsukada for helpful suggestions and
to Dr. M. Masuda, and Mr. B. Albrecht, for their contributions to improving the
manuscript. Dr. M. Brazil kindly improved the English of the final manuscript.
This research was supported in part by PRONATURA FUND from the Nature
Conservation Society of Japan, and the Wildlife Distribution and Abundance
Research Project of the Hokkaido government.
REFERENCES
Garrott, R. A., G.C. White, R.M. Bartmann and D.L. Weybright. 1986. Reflected signal bias in
telemetry triangulation systems. J. Wildl. Manage. 50: 747—752.
Heezen, K.L., and Tester, J. R. 1967. Evaluation of radio-tracking by triangulation with special
reference to deer movements. J. Wildl. Manage. 31: 124—141.
Hokkaido Institute of Environmental Sciences. 1995. A report of ecological investigation of brown
bears and deer 1, A report of distribution of wildlife in Hokkaido (1991-1993), 164 pp. (in
Japanese).
Lee, J. E., G.C. White, R. A. Garrott, R. M. Bartmann and A. W. Alldredge. 1985. Assessing accuracy
of a radiotelemetry system for estimating animal locations. J. Wildl. Manage. 49 : 658—663.
Lenth, R. V. 1981. On finding the source of a signal. Technometrics 23: 149—154.
Maruyama, N., T. Ito, K. Tamura, M. Miyaki, M. Abe, S. Takatsuki and T. Naito. 1978. Application
of radiotelemetry to Sika deer on Kinkazan Island. J. Mammal. Soc. Japan. 7: 189—198 (in
Japanese with English abstract).
Saltz, D. 1994. Reporting error measures in radio location by triangulation: a review. J. Wildl.
Manage. 58: 181—184.
Samuel, M.D. and M.R. Fuller. 1994. Wildlife radiotelemetry. Jn (Bookhout, T. A., ed.) Research
and Management Techniques for Wildlife and Habitats. 5th ed. 370—418. The Wildlife Society,
Bethesda, Md.
Shumutz, J. A. and G.C. White. 1990. Error in telemetry studies: effects of animal movement on
triangulation. J. Wildl. Manage. 54 :506—510.
Springer, J. T. 1979. Some sources of bias and sampling error in radio triangulation. J. Wildl.
Manage. 43 : 926—935.
White, G.C. and R. A. Garrott. 1990. Analysis of Wildlife Radio-tracking Data. Academic Press,
San Diego, 383 pp.
Zimmerman, J. W.1990. 10
1
Mar Apr May June July Aug Sept Oct Nov
Month
Fig. 1. Seasonal changes in the numbers of R. cornutus (---A---), R. ferrumequinum (—*#—),
M. macrodactylus (---C---), M. natterert (—@— ) and M. fuliginosus (---)---) at Katano-d6 Cave
in 1994.
52, Mammal Study 23: 1998
males and subadult females.
2. Food habits
Five orders of volant insects: Diptera, Lepidoptera, Coleoptera, Tricho-
ptera and Ephemeroptera, as well as spiders (Araneae) were represented in the
diet of M. nattereri (Fig. 2). The body lengths of the available prey were 5-13
mm (Table 1). Among the taxa commonly preyed on by M. nattereri were
Sericania (Scarabaeidae, body length ca. 11 mm), Macrolagria rufobrunnea
(Lagriidae, ca. 10 mm), Carabidae (ca. 10 mm), Tipulidae (8-13 mm), Araneidae
(6-8 mm), Tetragnatha (Tetragnathidae, 8-10 mm) and Theridiidae (ca. 6 mm).
The frequency of the occurrence of Diptera in M. nattereri feces fluctuated
between 15 and 39% from April to November (see Fig. 2). The frequency of
Lepidoptera was 15-26% from April to August, but increased to 33-50% in fall.
The frequency of Coleoptera was 42% in April, but dropped to 8% in May
before increasing to 18-27% in summer, and then falling to 7-21% in fall. The
occurrence of Trichoptera and Ephemeroptera was less than 13% from April to
November, while the Araneae varied from 3-48% from April to November,
peaking 40-48% in May-June.
The prey of R. ferrumequinum included Diptera, Lepidoptera, Coleoptera,
Trichoptera and Plecoptera (Fig. 3), ranging in size from 8 to 45 mm (Table 1).
Species or genera that were frequently found in the diet included: Tzpula
coquilletti, other Tipulidae and Tabanus (Diptera, 14-30 mm in body length) ;
Holotrichia picea, Anomala cuprea, A. geniculata, A. daimiana, A. albopilosa,
Melolontha japonica, M. satsumaensis, Mimela splendens, M. costata, Maladera
castanea, M. secreta, Hydaticus grammuicus, Melanotus legatus and Prionus
insularis (Coleoptera, 10-45 mm long). The frequency occurrence of Diptera
100
-~
—wZvZ
> 80
c iptera
® ;
=) (50) \ Il UT phepisepiaie
oy ee ee
Oo °°» (|e eee YY ws: me Coleoptera
bs
CS BA Vad d
® 40 ME CLE [7] Trichoptera
oO yy ey uu
c Yee iy, ee iy g a | [] eEphemeroptera
Vege EE 1 = 4
@® Yay : : Ble er 4 el] &
= Uy a A ecelene) Be Araneae
20 a“ nN 58087 —
= oy AL EL eens wee A
S ae
Oo
Apr May June July Aug Sept Oct Nov
Month
Fig. 2. Seasonal changes in occurrence frequency of foods (order level of insects) in the feces
of M. natterert in 1994-1995.
Funakoshi and Takeda, Food habits of insectivorous bats
Table 1. Body length for each order of insects found in fecal
pellets of bats.
Bat species
Prey item
Myotis nattereri
Myotis macrodactylus
Miniopterus fuliginosus
Rhinolophus cornutus
Rhinolophus ferrumequinum
Coleoptera
Lepidoptera
Diptera
Trichoptera
Ephemeroptera
Coleoptera
Lepidoptera
Diptera
Trichoptera
Ephemeroptera
Coleoptera
Lepidoptera
Diptera
Trichoptera
Ephemeroptera
Coleoptera
Lepidoptera
Diptera
Trichoptera
Coleoptera
Lepidoptera
Diptera
Trichoptera
SLPALE LE:
| aA v7 “or
| se see
Pd a.
\ ee
| pee
1 & wee
| f er. ts
ft
o, 7 z ae
Occurrence frequency (%)
June July Aug Sept
Month
ae -
Body length
Oct
(mm)
Osa liZ
= 18}
ie pil!
oo IU)
CHA
oy — Ils}
G=A15
8—20
UE
Or il2
6—15
Ome
(27
SA)
NO IA
Sa 2Z
8)
i723
oe ld)
9—45
Wai
NOS 30
ae I
Sf BAO
Diptera
Lepidoptera
Coleoptera
Trichoptera
Plecoptera
03
Fig. 3. Seasonal changes in occurrence frequency of foods (order level of insects) in the feces
of R. ferrumequinum in 1994-1995.
54 Mammal Study 23: 1998
in R. ferrumequinum feces was 71% during March, but fluctuated between 30
and 48% from April to October (Fig. 3). The frequency of Coleoptera in the
diet varied between 26 and 56% from March to September, and dropped to 4%
in October, whereas the frequency of Lepidoptera gradually increased from
April onwards reaching 43% in October. The frequency occurrence of both
Trichoptera and Plecoptera was less than 11% from spring to fall. Most
significant was that the combined frequency occurrence of both Diptera and
Coleoptera was 80% or more from May to August.
The diet of M. macrodactylus included Diptera, Lepidoptera, Coleoptera,
Trichoptera, Plecoptera, Ephemeroptera and Araneae, ranging in size from 7 to
20 mm in body length (Table 1). These bats commonly took for example:
Tipulidae (8-20 mm in body length), Tabanidae (ca. 18 mm), Scarabaeidae (A.
geniculata ca. 12 mm, A. daimiana ca. 16 mm, and H. picea ca. 18 mm), and
Araneidae (ca. 10 mm). The frequency occurrence of various prey from March
to May as determined by analysis of M. macrodactylus feces were: Diptera
45 %, Trichoptera 18 %, Coleoptera 9 %, Plecoptera 9 %, Ephemeroptera 9 %,
Lepidoptera 5% and Araneae 5%. In July these frequencies changed to:
Diptera 36%, Trichoptera 16%, Coleoptera 16%, Lepidoptera 24% and
Araneae 8 % (Fig. 4).
The prey of M. fuliginosus in July, as measured by fecal analysis, included
Diptera 23 %, Lepidoptera 44 %, Coleoptera 7 %, Trichoptera 14 %, Ephemero-
ptera 7 % and Plecoptera 5 % (Fig. 4), ranging in size from 5 to 25 mm in body
length (Table 1). For example, the Tipulidae (Diptera) that were eaten
measured, ca.10 mm and A. geniculata (Coleoptera) ca. 12 mm.
— 100
oS
=v
~
o 80 [] Diptera
2 [1] Lepidoptera
a 60 Coleoptera
hes
a es 4 | EF] Trichoptera
®o 40 LE oe IEEE |
2 YL , sun Ephemeroptera
© a tee “ ee f
pa é ‘—4 Plecoptera
A HM Araneae
Oo
Oo oO
M. n. M. m. M. f. Fic: Rts Thc
Bat species
Fig. 4. Occurrence frequency of foods (order level of insects) in the feces of M. natterent (M.
n.), M. macrodactylus (M. m.), M. fuliginosus (M. f.), R. cornutus (R. c.) and R. ferrumequinum
(R. f) in July of 1994.
Funakoshi and Takeda, Food habits of insectivorous bats O09
A BC D E
@ Coleoptera
4 Lepidoptera
@ Diptera
+ Trichoptera
Body length of insect prey (mm)
4 8 12 16 20 24 28
Body weight of bats (g)
Fig.5. Correlation of mean body weight of bats and mean body length of insect prey. A:
R. cornutus, B: M. nattereri,C: M. macrodactylus, D: M. fuliginosus, E: R. ferrumequinum.
The diet of R. cornutus in July included Diptera 34 %, Lepidoptera 57 %,
Coleoptera 6 % and Araneae 3 % (Fig. 4), ranging in size from 7 to 23 mm in
body length (Table 1). In addition to these orders, Trichoptera was found in
their feces in June. Typical examples were Tipulidae (Diptera) measuring 8-
23 mm, and M. castanea, A. geniculata and H. grammicus (Coleoptera), measur-
ing 9-15 mm.
A significant positive relationship was found between the mean body
weight of the bats and the body length of their insect prey (Pearson’s correla-
tion coefficient : ~=0.63, p<0.01, see Fig. 5).
3. Insect abundance
Total insect numbers (collected at the night) reached a peak during July,
whereas dry weights were heaviest during June (see Figs.6 and 7). In every
month Diptera constituted a major portion of these samples (Fig. 6), but the
ratio of the dry weight of Diptera to that of all insects trapped from April to
September was less than 25 % (Fig.7). Trichoptera (4-25 %) and Ephemero-
ptera (1-21 %) were the next most abundant groups from April to November
(Fig. 6), although the ratios of their dry weight to those of all insects was less
than 16 % for the Trichoptera, and less than 10 % for the Ephemeroptera (Fig.
7). Lepidoptera and Coleoptera were often collected, but constituted only a
small percentage of the total fauna (Fig. 6), yet the two orders contributed a
56 Mammal Study 23: 1998
676 2045 1794 2286 632 5— 1352 26 136
O
Diptera
=
Lepidoptera
Coleoptera
Trichoptera
Ephemeroptera
Hemiptera
EI
i)
[4
|
Hymenoptera
Sy
Plecoptera
Percent by number
Neuroptera
Blattaria
May June July Aug Sept Oct Nov
Month
Fig.6. Seasonal changes in percent number of insects of various orders collected by insect
suction traps near Katano-do Cave in 1994. Monthly sample sizes are indicated above
histograms.
100
[] Diptera
= | | I] Lepidoptera
4 80 | —Yy Coleoptera
> | Yy Trichoptera
= 60 | Y Ephemeroptera
> | Y FA Hemiptera
< 0 | Yj BA Hymenoptera
SW) UY Plecoptera
~~ 20 eZee os
PT) | - ae i Ea Neuroptera
~ ISSA ey Be ; HM Blattaria
Apr May June July Aug Sept Oct Nov
Month
Fig. 7. Seasonal changes in percent dry weight of insects of various orders collected by
insect suction traps near Katano-do Cave in 1994. Monthly total dry weights (g) are indicat-
ed above histograms.
Funakoshi and Takeda, Food habits of insectivorous bats oil
M. n.
M. m.
M. f.
> B-.-@--20
Feale
>
Fae
Percent by number in feces
0 10 2030 A050 60 0
Percent by number in trap
Fig. 8. Percent representation of each of five groups of insects in the feces of bats and in
insect suction traps. A: Lepidoptera, B: Coleoptera, C: Trichoptera, D: Ephemeroptera,
E: Diptera; M. n.: M. natteren, M.m.: M. macrodactylus, M. f.: M. fuliginosus, R.f.: R.
ferrumequinum, R. c.: R. cornutus.
high proportion of the dry weight. The ratio of the dry weight of Lepidoptera
to that of all insects varied from 2 to 61% from April to October, being
particularly high (37-61 %) during April, May and October (Fig. 7). The ratio
of dry weight of Coleoptera to that of all insects fluctuated even more widely
between 4 and 73 % from April to September, being particularly high (60-73 %)
from June to September (Fig. 7).
When the rates of occurrence in bat feces of the five main insect groups
were compared with the same groups occurring in traps during July, no correla-
tion was found between the two values (Pearson’s correlation coefficient: =
0.30, p>0.1, see Fig. 8). The percentages of Diptera in the feces of both M.
natterert and R. ferrumequinum were significantly lower than those in the trap
samples (Tables 2 and 3), whereas the percentages of Lepidoptera or Coleoptera
in the feces were significantly larger.
In addition, spiders including Araneidae, Tetragnathidae and Theridiidae
were frequently found along the edges of woodlands or brooks during May and
June, however quantitative samples were not collected.
DISCUSSION
1. Prey selection
M. natterert was found to feed mainly on Lepidoptera, Coleoptera, Diptera
58 Mammal Study 23: 1998
Table 2. Proportions of five insect groups in insect suction traps
and in the feces of M. nattereri for eight nights. Probability (p)
refers to Wilcoxon signed-ranks tests applied to establish whether
each insect group was consistently commoner or rarer in the trap
samples than in the fecal ones.
% trapped % in feces
Orde: Mean+ SD Mean+ SD P
Diptera 65) 4s 1987 S7e late ORS <0.01
Lepidoptera S5OLe Day) 30), 4ac lala <0.01
Coleoptera adlanns oe) De. Mae IL a qeyeequons
Ee par ead
NE gr" poo
i = Iusy yy
Ja1aqunyny / y ar a
oSV miqeH
z
SS
sitios Oo <3
z leq[V-IqoH
xs
ueYyyAeZq
—* fmm oom,
‘N
oée atk B" 3
Oe] JON san Poot wi
cS) = a
oOS | 424, | Sn. \ f ieese ysoy
| eABYSUIANT
VISsnd
oS Cl oS II oS Ol 096 098
67
Jiang et al., Status and conservation of Mongolian gazelle
o9 Cl
9s ar) ae a a
W009
= Sar
!
'
4
‘
'
i]
‘
i
\
§
‘
‘
’
‘
t]
'
é
‘BI[OSUOJ] PUL CUIYD UI aI[9zZeS UeI[OSUOJ] JO UOTINCI1}SIpP oy} JO SasueYD [BOIOJsIy OY 7 “BI
OSP
o9 Cl
00€
OSI
oS II
oS LI
@eeeesveceevees
> itl
oS OI
oS Ol
Juasaid pUe S,OR6T JOY TMNT
S:0L61 Lissette
SOG. Finieiii:
S,006T ALIOg -------eennenne
SQOLT cccerccrsecseeeees
UOLNIIIIP ISCHULIYS eam em dem Gem Gem Gem
06 098
oOP
oo F
o0S
68 Mammal Study 23: 1998
far as the Yellow River (JlyxauwKxun 1927). As agriculture has spread and
developed, however, the gazelle’s distribution has continuously shrunk. In the
early decades of the 20th century, its range was still extensive (Figs. 1 and 2):
it occurred in Inner Mongolia across the Great Xingan Ranges, southward to
the Nenjiang River and to the Songhuajiang River area of Heilongjiang
Province, and to Baicheng in Jilin Province. The easternmost point of its
range was reached in the middle of the watershed of the Liaohe River. At
present, its southeastern limit is to be found in the leagues of Hulunbeier,
Xilinguole and Wulanchabu at the border between China and Mongolia (Zhang
et al. 1995). It is extinct now in Heilongjiang Province.
2. Mongolia
Most Mongolian gazelles are now to be found only in Mongolia. As
recently as the 1950s, Mongolian gazelles were distributed widely across about
two thirds amounting to about 780,000 km? of the country, though they were not
to be found in northern forested areas or in southern desert areas, and the
population still numbered about a million individuals (Bannikov 1954). During
the 1950s, the northern limits of their range were reached in the Ubsa Nor lake
basin (50°N, 91°E, Tentuep et al. 1961), however, during the second half of the
20th century, the range of the species in Mongolia has been shrinking. A
survey conducted during the decade from 1975 to 1985 revealed that its distribu-
tion had decreased dramatically to just one quarter or one fifth (about 170,000
km’) of its range during the 1950s. Over the same period, the population
decreased by half to about 500,000 animals. The remaining population was
confined to areas such as: Khentii, Dornod, Suchbaatar and East Gobi in
eastern Mongolia (Lushchekina et al. 1983, 1985, 1986, and Lhagvasuren and
Milner-Gulland 1997). Small scattered populations remain in other parts of
western Mongolia (Fig. 2, Lhagvasuren and Milner Gulland 1997). The most
recent information (IUCN 1993) shows that most gazelles are now confined to
an even smaller area (10% in size) in the eastern part of Mongolia and that the
population amounts to only about 300,000 animals, of which about 60% are
migratory and the rest sedentary.
3. Russia
Until the 1970s, Mongolian gazelles still occurred in small numbers in the
southeastern Altai Mountains, southern Tuvinskaya and east Zabaykal of
Russia (Figs. 1 and 2), though previously they had been common in some areas.
In the 19th century, several thousand Mongolian gazelles were to be found
in east Zabaykal during winter (Yepxacop 1867). During the winters of 1925-
1926 and 1944-1945, several thousand Mongolian gazelles lived in east Zabay-
kal, while the number was fewer in west Zabaykal. During the winter of 1947-
1948 only groups of fewer than 100 animals were found (Jleontbes 1949). In the
grasslands of the southeastern Altai Mountains, hundreds of Mongolian
gazelles were often found and large groups sometimes immigrated from
Mongolia, but by the end of the 1950s the gazelles had become rare there
Jiang et al., Status and conservation of Mongolian gazelle 69
((entHep et al. 1961). In 1935 there were still several hundred gazelles in
Tuvinskaya, but by the winter of 1940 only a few individuals remained, and
thereafter no gazelles have been seen there (Guyuiesuy u Baaropeusenckui 1952).
At Kosh-Agach and in the border area between Russia and Mongolia (Fig.1),
only 5-6 gazelles were found in the 1956-57 winter (Centuep et a/. 1961). In west
Zabaykal there were not many Mongolian gazelles and some of them migrated
from Mongolia during winter. Their last visit was in the winter of 1947-1948,
when they numbered fewer than 100 animals (Jleoutbes 1949). In east Zabaykal
the population was relatively stable until the 1940s, but during the 1950s the
gazelles decreased and by the end of the 1950s only a few small groups were to
be found in the border area of China, Mongolia and Russia (Tentuep et al. 1961).
Sludskii and Shubin (1963), who conducted aerial censuses of the Kazakh-
stan Desert area in the winter of 1960, reported 9,300 gazelles, about 60% of
which were in the northern part of the Kyzyl-Kum Sands (at about 60-70°E),
though was, however, contrary to lentuep et al. (1961) who defined the distribu-
tion of Mongolian gazelles in Russia as limited to areas east of about 85°E.
Whatever the original limits of their distribution were, since the 1970s no
gazelles have been seen in Russia, and it is believed that they are now extinct.
HABITAT
Information on the Mongolian gazelle’s habitat in Mongolia and Russia is
limited, and therefore information on the characteristics of their habitat is
based on observations in China. Their main preference seems to be for flat or
undulating steppes or dry grasslands.
1. Topography
The Great Xingan Range extends from northeast to southwest in the
central Hulunbeier League (Fig. 1). To the west of the range is the rolling
Hulunbeier Plateau which lies above 600m. The highest point reached at
1,038 m is Bain Mountain, while the lowest place, the 2,200 km? Dalai Lake, is
at 540m. The areas around the Dalai and Beier Lakes, and along the Wuersun
River are lowlands where rich water systems such as the Erguna River and
Dalai Lake develop (Pan ef al 1992).
2. Climate
Because the Great Xingan Range blocks the movement of moist oceanic
winds, the climate here is semi-arid. The average annual temperature is as
low as -3 to 0°C, while the lowest temperature reached is -40°C, and the highest
35-40°C. Continuous snow-cover lasts from 120 to 180 days each winter, and
the frostless summer period is of 80-120 days. The annual rainfall is of only
250-380 mm, of which 70% falls in summer, while annual evaporation amounts
to 1,300-1,900 mm (Pan et al. 1992). The main natural calamities that the
gazelle’s face in this region are snow, snowstorms and frostbite.
70 Mammal Study 23: 1998
3. Vegetation
The vegetation which comprises typical gazelle habitat consists of cool
temperate tall grassland (Hu ef al. 1992). Five types of such grasslands are
recognized according to their species composition: 1) Stipa grandis/Aneuro-
lepidium chinense type, 2) Stipa grandis/Cleistogenes squarrosa type, 3) Cleis-
togenes squarrosa/Lespedeza spp. type, 4) Artemisia frigida type and 5) Aneuro-
lepidium chinense/ Stipa grandis/Herbs type (Hu et al. 1992).
4. Other Animals
About 200 species of birds and more than 20 species of mammals have been
recorded in the area (Office of Local Chronicles in Hulunbeier 1986). Other
mammals that are common in the area include bobak marmot, Marmota bobak,
cape hare, Lepus capensis, steppe polecat, Mustela eversmanni, red fox, Vulpes
vulpes, Corsac fox, V. corsac, the wolf, Canis lupus, and many species of mice.
FooD HABITS
The Mongolian gazelle eats a wide range of plant species, however the bulk
of its diet consists of a very limited number of species. Bannikov (1954)
identified just 21 plant species in the stomach contents of 22 gazelles from
Mongolia. These included: Stipa capillata, S. gobica, Allium polyrrhyzum,
Agropyrum pseudoagropyrum, Kochia prostrata and Koeleria gracilis. Interest-
ingly, the gazelles avoid Diplachne spp. even though these are relatively abun-
dant. Of the 21 plant species recorded, Stipa spp. accounted for 60% of the
stomach contents collected in January. Bannikov (1954) found clear seasonal
variation in diet with Gramineae, Avtemisia, Caragana, Allium and
Leguminosae in stomach contents sampled in spring, while in August about
80% of the stomach contents consisted of onions, Allium spp. (Lhagvasuren and
Milner-Gulland 1997).
Fecal analyses of Mongolian gazelles in the Hulunbeier grasslands of Inner
Mongolia, China during 1993-94 have revealed 38 plant genera in the diet with
Stipa spp., Aneurolepidium chinense, Caragana microphylla and various
Liliaceae and Compositae being of particular importance (Jin 1994, Gao ef al.
1995). In winter, the three main components of the diet were found to be Stipa
spp. (38.6%), A. chinense (21.8%) and C. microphylla (7.5%). In winter, the diet
of the Mongolian gazelle is very similar to that of domestic sheep, the diet of
which consists of Stipa spp. (30.1%), A. chinense (28.4%) and C. microphylla
(6.7%) (Gao et al. 1995).
GENERAL HABITS AND ACTIVITY
1. Adaptation to Grasslands
Like other grassland dwellers such as the saiga, the Tibetan antelope,
Pantholops hodgsoni, and the North American pronghorn antelope, Antzlocapra
americana, Mongolian gazelles can run very fast. They can reach speeds of
Jiang et al., Status and conservation of Mongolian gazelle 71
60-65 km/hr, jump height up to two meters and lengths of 4-6m with a
maximum of 13 m (JlyxauKun 1927). Mongolian gazelles find it difficult to run
on ice or move in snow that is deeper than 20 cm (Bannikov 1954). Mongolian
gazelles have keen eyesight but relatively poor senses of smell and hearing.
In order to obtain sufficient food, Mongolian gazelles must graze all day
long during autumn and winter, whereas during summer they graze only from
dawn to 10: 00 or 11: 00, and then again from 19: 00 or 20: 00 to dusk (Tentuep
et al. 1961).
During summer, because sufficient water for their needs is contained in
their green fodder, Mongolian gazelles are able to forage tens or even hundreds
of kilometers away from open sources of freshwater.
2. Group Formation
Mongolian gazelles usually live in groups all year round, but in larger
groups in winter than in summer. Group size increases from September to
April in Russia (Tentuep ef a/. 1961). During summer, the largest groups consist
of fewer than 100 individuals, and usually groups number about 20-30 individ-
uals. From late August or early September onwards, group size increases to
60-80, or even to several hundreds in some cases. During the rutting period
from late November to early January, group size further increases to reach 100-
120 individuals. If snow falls, groups increase in size to several thousands or
even 10,000 animals. These large groups begin to break apart during May and
June (Bannikov 1954). During spring and autumn migrations, they form large
groups, some as large as 80,000 animals (Lhagvasuren and Milner-Gulland
1997).
In Inner Mongolia, mixed groups were most common during spring (63.1%),
autumn (51.0%) and winter (56.2%), however in summer female groups were
most common (60.7%), and solitary individuals were common in male groups
(Guan 1996). Before the rutting season from September to November, the
male/female ratio is about 1.3, and males often form bachelor groups. These
groups join to form larger groups during late November, then separate again
from the beginning of the rutting season (Zhao 1963).
3. Society and Behavior
The social system of the Mongolian gazelle is not yet well understood,
however it is known that they are polygynous with one male gathering on
average 13 females into his harem (range 6-25, Lhagvasuren and Milner-
Gulland 1997). In Russia, rutting begins in late November and continues until
early January (lentuep ef al. 1961), whereas in Mongolia it begins during
mid-November and continues until early February with the peak between
mid-December and mid-January (Lhagvasuren and Milner-Gulland 1997).
During the rutting season, males battle with each other though the fighting is
not serious (Tentuep e¢ al. 1961). Pregnant females close to parturition in
spring move to open rolling countryside where it is easy for them to avoid
disturbance (Bannikov 1954).
72 Mammal Study 23: 1998
4, Migration
Mongolian gazelles migrate during winter. In the northern part of their
range, this migration is from south to north, whereas in the southern part of
their range it is from north to south or east (Bannikov 1954). Part of the
southern population migrates from Mongolia to Inner Mongolia, and before the
1970s some migrated from Mongolia into Russia. Since the 1970s, however,
and since the population has been so reduced, migration into Russia has not
been reported. These migrations may have occurred because of reduced food
availability in the center of the range.
During summer, gazelles travel widely over ranges of several hundred
square kilometers, often moving more than 10 km in a day with distances
increasing as forage deteriorates. During the parturition period, however,
females stay in restricted areas (Tentuep et al. 1961). Gazelles do not migrate
when food is abundant or when there is little snow, which indicates that their
migrations may be adaptive to avoid food shortages and heavy snow (Bannikov
1954).
POPULATION ECOLOGY
During the 1940s, the population of Mongolian gazelles is estimated to have
reached approximately 1.5 million, with one million in Mongolia and 500,000 in
China. During the 1950s and 1960s in China, 200,000 gazelles were hunted each
year (Xiao et al. 1982), and as a result of this over-hunting, combined with
over-grazing and desertification, the population has decreased considerably
during the last 40 years.
1. Age Estimation
On the basis of tooth eruption and wear, Zhao (1982) categorized Mongolian
gazelles into seven age groups. Jiang ef al. (1995) have determined the exact
age of 224 gazelles by counting growth layers in teeth cementum and have
shown that the accuracy of Zhao’s (1982) method is 72.3%. Of the remainder of
the samples, 69.4% were over- or under-estimated but within just one year.
Therefore, for practical purposes in the field, Zhao’s (1982) categories are
useful.
2. Demography
a. Natality
Females become fertile at about 17-18 months of age (Ientuep ef al. 1961).
The gestation period is about six months, and parturition occurs during May
and June in Russia (Tentuep et a/. 1961), and from mid-June to mid-July in
Mongolia (Lhagvasuren and Milner-Gulland 1997). The pregnancy rate of
Inner Mongolian females older than 1.5 years is as high as 100% (m=122, Jiang
et al. 1993), and over 90% in Russia (Bannikov 1954), although in two popula-
tions in Mongolia, it has sometimes been lower at 40% and 60-85% (Lhagvasur-
en and Milner-Gulland 1997). Fawns are usually born singly with twins only
Jiang et al., Status and conservation of Mongolian gazelle 133
occurring rarely (2.5-8.2%) in both Mongolia and in Russia (Bannikov 1954,
Lhagvasuren and Milner-Gulland 1997).
The survival rate of fawns in their first summer reaches 80%. Because of
the high rate of pregnancy and of fawn survival, the rate of increase of the
population sometimes reaches 20-25% (Bannikov 1954). Zhao (1988) estimated
that the annual rate of increase in Inner Mongolia was also considerable at
about 27%.
b. Mortality
Predation, periodic epidemics and severe winters are the main causes of
death of the Mongolian gazelle. The main predators are wolves, domestic
dogs and steppe eagles, with manul, Felis manul, and red fox also able to catch
newborn fawns. Wolves attack the gazelles during late winter and spring,
particularly after rutting when males are exhausted and unable to run for long.
In early summer, wolves attack pregnant females. According to Tentuep ef al.
(1961), birds such as kites and vultures sometimes attack young fawns.
Information on diseases contracted by Mongolian gazelles is limited,
however, that diseases do seriously affect them is well documented. In 1974,
for example, about 140,000 animals were killed in eastern Mongolia by an
unknown disease, and since then similar outbreaks have occurred regularly,
though fewer gazelles have died (Lhagvasuren and Milner-Gulland 1997).
Captive Mongolian gazelles are known to suffer from “foot-and-mouth disease”
(O.upKop and Hocospa 1940, Llperaepa 1941) and FPasteurvellosis (Yuan 1991).
Rotshil’d et al. (1988) showed that the high level of molybdenum in their onion
diet can be a cause of Pasteurella infections.
Various parasites of the Mongolian gazelle have been found including :
Przevalskiana aenigmatica, Pharyngomyia dzerenae, Melophagus spp. (Hippobos-
cidae), Cysticercus tenuicollis, C. bovis, Eimeria spp. (Coccidia) and warble flies
(Hypodermatidae and Oestridae) (Kosocos 1939, Mayyapcxuit 1941, Cpyaun 1950,
Sugar 1981/1982, Minar et al. 1985).
In Mongolia, severe winters, occurring about once every seven years since
1932, have killed thousands of gazelles (Lhagvasuren and Milner-Gulland 1997),
and heavy snows and food shortages were recognized by Bannikov (1954) as
sometimes causing losses of one third or half of Mongolian gazelle populations.
c. Sex Ratio
In Inner Mongolia, the sex ratio varies from year to year, but is slightly
biased towards males (M/F=1.1 in 1979, Xiao et al. 1982, and 1.3 in 1988, Jiang
et al. 1993), whereas in Russia, Bannikov (1954) found it to be slightly biased to
females (M/F=0.92). Subsequently, Lhagvasuren and Milner-Gulland (1997)
have found ratios in Mongolia strongly biased to females (M/F=0.1-0.14 in
autumn, 0.08 in winter, and 0.05 in summer).
d. Life Table
Jiang et al. (1993) estimated the age structure of the Inner Mongolian
74 Mammal Study 23: 1998
gazelle population as consisting of fawns (0.5 year old, 39.7%), reproductive
females (over 1.5 years old, 25.0%), and older animals (more than 4.5 years old,
12.7%). Three mortality peaks were noted among 0.5 year olds (39.7%), 3.5
year olds (57.4%) and among those over 6.5 years old (100%). This population
was considered to be increasing because of the high proportion of young
gazelles, the high rate of fecundity and the low mortality rate.
The oldest known-age individuals in an Inner Mongolian population of
1,026 animals were 7.5 year old males and 9.5 year old females (Jiang et al.
1995), making them much younger than other related ungulates. For example,
mountain goat, Oveamnos americanus, males reach 14 years of age and females
18 years (Cowan and McCrory 1970), chamois, Rupricapra rupricapra, have
survived to about 22 years of age (Walker 1975) and male Japanese serow,
Capricornis crispus, reach 20 years while females may live as long as 24 years
(Miura and Tokida 1988). Jiang (1990) considered that Mongolian gazelles live
short lives partly because of quick teeth wearing.
The net reproductive rate (R,) of a population in Inner Mongolia was 1.134
in 1979 and 0.864 in 1988, while the finite rate of increase (£) was 1.043 in 1979
and 0.954 in 1988 (Jiang et al. 1993). The abrupt decrease in both Ro and E
between these years may have resulted from habitat deterioration such as
desertification, overgrazing by livestock, and particularly from over-hunting
and poaching.
As a result of over-hunting and poaching, gazelles have been exposed to
shooting for longer periods. Poachers shoot more rutting males just after the
rut, and more pregnant and lactating females after the legal hunting period
because they are easier to shoot. As a consequence, the proportion of repro-
ductive females in the total population dropped from 32.5% in 1979 to just 25.0%
in 1988 (Jiang et al. 1993). The reduction of pregnant and lactating females
would result in a decrease in fecundity, and the reduction of reproductive males
would result in unhealthy sex ratios.
CONSERVATION AND MANAGEMENT
Mongolian gazelles seem to be the Asian ecological equivalent of the
pronghorn which is a member of the grassland ecosystem of North America.
Both gazelles and pronghorns are highly adapted to northern dry grassland
ecosystems, however, they differ because the grasslands where Mongolian
gazelles live are unique, in as much as they are not truly natural but have been
utilized by humans as grazing lands for thousands of years. In the past, people
maintained this ecosystem based on an understanding of suitable grazing levels
from experience, and hence they avoided deterioration of the grasslands. In
other words, these grasslands are the historical product of a system of “sus-
tainable use”. The Mongolian gazelle has long been a representative member
of this managed grassland ecosystem.
The most significant natural mortality factors of the gazelles seem to be
predation, periodic epidemics and severe weather, however, the factor causing
Jiang et al., Status and conservation of Mongolian gazelle is
Mongolian gazelles to be endangered is human activity. These activities
include over-hunting, poaching and deterioration of their grassland habitat
resulting from the over-extension of cultivated lands and by over-grazing.
The impact of poaching is extremely biased towards males because of their
large body size and their horns making them particularly valuable. This leads
to a strongly biased sex ratio and, as a consequence, reduces the fecundity of
females. Lhagvasuren and Milner-Gulland (1997) have calculated that Mon-
golian poachers kill 80,000 animals each year, at least 80-85% of which are
males. Poaching just after rutting and during the birth period reduces num-
bers of reproductive males and females. Over-hunting is also responsible for
the decline of populations. The heavy harvest (100,000 each year) for meat for
soldiers during the Second World War, and during severe winters after the war,
probably resulted in the rapid decline of populations during the 1950s and 1960s
(Sokolov et al. 1982). Deterioration of grasslands results in the disappearance
of suitable habitats which reduce the carrying capacity of the environment.
One major factor contributing to the decline of the population in western
Mongolia is thought to be the construction of the Ulaanbaatar-Beijing railway
at the end of the 1950s. This obstructed the gazelles’ east-west migration
routes (Lhagvasuren and Milner-Gulland 1997).
In Inner Mongolia the extent of the grasslands has been declining.
Compared to 1965, the grassland area has decreased by 62,000 km’, degraded
grasslands have increased by 287,000 km’, and total grass production has
dropped by 30% (National Research Council 1992). Asa result, the Mongolian
gazelle is facing a dangerous situation. It was estimated that the Mongolian
gazelle population before the 1940s was about 1,000,000 in Mongolia and 500,000
in China (Tenruep et al. 1961), but today just 300,000-500,000 remain in total.
Taking this situation into consideration, the Chinese government listed the
Mongolian gazelle under its 1989 wildlife protection law as a Class II species
for conservation. Under this law, nature reserves are to be established in the
species’ main distribution areas, and inspection of the condition of the habitat
is to be made regularly. Construction projects that will degrade the habitat
and trading of the gazelles and their parts are to be controlled. Hunting is
prohibited and poaching may be prosecuted under criminal law.
In the Russian Federation’s “Red Data Book”, the Mongolian gazelle was
listed as a “disappearing species”. In Mongolia, hunting has been controlled
since 1932, and in 1995 a new hunting law was introduced in order to control
poaching (Lhagvasuren and Milner-Gulland 1997).
Establishment of hunting controls based on population ecology is neces-
sary. Zhao (1988), who has taken into consideration the current system of
hunting in China together with the ecology of the Mongolian gazelle, has
recommended that the open season for hunting gazelles should be limited to the
period from early November to the middle of December because body weight is
greatest and the meat quality is at its best during this period. On the basis that
the Mongolian gazelle’s capacity for increase is high at about 25%, Zhao (1988)
also recommended that hunting intensity should be limited to 19% of the total
76 Mammal Study 23: 1998
population. Because of its high reproductive capability, the Mongolian gazelle
population would then be able to recover quite quickly despite continued
hunting, once hunting and poaching are controlled.
Besides control of legal hunting, a reduction of poaching is also vitally
important. Both the Chinese and the Mongolian governments are trying to
control poaching, but this is extremely difficult to carry it out in vast, remote
steppe areas. Consequently, nature conservation education is seen as crucially
important in such areas.
Because of the rapid shrinkage of distribution and the reduction of popula-
tion size, it is urgently necessary to establish reserves. A steppe plain in the
Matad-Somon area of Mongolia (Fig. 1) is recommended as a reserve (Sokolov
et al. 1982, Lushchekina e¢ al. 1985, 1986). The first national park of Mongolia,
the Eastern Steppe National Park, was established in 1995 to conserve the
Mongolian gazelle. More reserves are needed in China. The reintroductions
have been done in 1978 and 1988-1990 in Mongolia and small populations
survived in Dzavkhan, Gobi-Altai and Uverkhangai maybe because of the
reintroductions. Trials of captive breeding in the reserves and transplantation
should be considered. Studies on epidemics, migration routes, genetic struc-
ture etc. are also needed. Since Mongolian gazelles migrate between Mongolia
and China, consistent plans for management, conservation and cooperative
activities between the countries are necessary. Grassland productivity should
be improved based on both agricultural and ecological sciences. The tradi-
tional grazing system of Mongolian people should be also reconsidered.
Acknowledgments : We appreciate Mr. Xie Xuchang for translation of Russian
literature and Mr. Guan Dongming for the permission of use unpublished data.
REFERENCES (Russian references are listed below)
Allen, G. M. 1940. The Mammals of China and Mongolia. Amer. Mus. Nat. Hist., New York.
Bannikov, A.G. 1954. The Mammals of the Mongolian People’s Republic. Publishing Company of
the Academy of Sciences of USSR, Moscow. Issue 53 (in Russian).
Corbet, G.B. 1978. The Mammals of the Palaearctic Region: a Taxonomic Review. British
Museum (Natural History). Cornell University Press. London and Ithaca. 314 pp.
Cowan, I. M. and W. McCrory. 1970. Variation in the Oreamnos americanus (Blainville). J. Mam-
jnoeily Ibs C0 Wor
Ellerman, J. R. and T.C.S. Morrison-Scott. 1951. Checklist of Palaearctic and Indian Mammals 1758
to 1946. London (cited in Corbet 1978).
Ellerman, J. R. and T.C.S. Morrison-Scott. 1966. Jbid 2nd ed. London (cited in Corbet 1978).
Gao Zhongxin, Jin Kun, Ma Jianzhang and Chen Huahao. 1995. Winter food habits of Mongolian
gazelle in Hulunbeier grassland. Acta Theriologica Sinica. 15: 203—208 (in Chinese with
English summary).
Guan Dongming. 1996. The study on the grouping behaviour of Mongolian gazelle. Master thesis
of Northeast Forestry University. 53 p. (in Chinese with English summary).
Hu Shingtsung, D. B. Hannaway and H. W. Youngberg. 1992. Forage Resources of China. Center
for Agricultural Publishing and Documentation (Pudoc), Wageningen, Netherlands. 327 p.
IUCN-The World Conservation Union. 1993. Species. Newsletter of the Species Survival Commis-
sion. June. No. 20: 41—42.
Jiang et al., Status and conservation of Mongolian gazelle he
Jiang Zhaowen. 1990. A study on population structure and dynamic trend of Mongolian gazelle.
Master thesis of Northeast Forestry University. 50 p. (in Chinese with English summary).
Jiang Zhaowen, Xu Li and Zheng Hong. 1991. The comparative analyses on age identification
indexes of Mongolian gazelle. Chinese Wildlife. 3: 25—28. (in Chinese).
Jiang Zhaowen, Ma Yiging and Gao Zhongxin. 1993. A study on population structure and dynamic
trend of Mongolian gazelle in China. Acta Theriologica Sinica. 13:16—20. (in Chinese with
English summary).
Jiang Zhaowen, Ma Yiqing, Gao Zhongxin, Wang Jun and Li Guangfu. 1995. A comparative study
on two age identification techniques of Mongolian gazelle. Studies on Mammal Biology in
China. 124—130. (in Chinese with English summary).
Jin Kun. 1994. The study on food-habits of Mongolian gazelle in Hulunbeier grassland. Master
thesis in Northeast Forestry University. 56 p. (in Chinese with English summary).
Lhagvasuren, B. and E. J. Milner-Gulland. 1997. The status and management of the Mongolian
gazelle, Procapra gutturosa, population. Oryx. 31:127—134.
Lushchekina, A., V. Neronov, G. Ogureeva and A. Sokolova. 1985. Distribution, ecology and protec-
tion of Procapra gutturosa. Arch. Naturschutz Landschaftsforsch. 25 : 57—69 (English abstract
was cited).
Lushchekina, A., V. Neronov and A. Shurkhal. 1983. The territorial structure, intraspecific varia-
tion and questions of the rational use of the stock of Mongolian gazelles. In Applied Aspects
in the Programme on Man and the Biosphere. Moscow, USSR (in Russian).
Lushchekina, A., V. Neronov, G. Ogureeva and A. Sokolova. 1986. Distribution, ecology, protection
and efficient use of the Mongolian gazelle in Mongolia. Byull Mosk O-Va Ispyt Prir Otd Biol..
91: 73—82 (in Russian with English abstract).
Minar, J., V.S.Lobachev, M. Kiefer and D.Bazardorzh. 1985. New findings of warble flies
(Hypodermatidae, Oestridae) of wild animals in Mongolia. Folia Parasitol (Prague). 32 : 89—
91.
Miura, S. and K. Tokida. 1988. Demographic parameters of Japanese serow population in Japan. pp.
111-118. lm (Y.Ono ed.) The Basic Study on Ecology and Conservation of Japanese Serow.
National Research Council. 1992. Grasslands and Grassland Sciences in Northern China. National
Academy Press. Washington, D.C. 214 p.
Office of Local Chronicles in Hulunbeier. 1986. The Circumstances of Hulunbeier League. Inner
Mongolia People Press (in Chinese).
Pan Xueqing, Feng Guojun, Erdun and Feng Futang (eds). 1992. Hulunbeier Grassland in China.
Jilin Sciences and Technology Press. 424 p (in Chinese with English summary).
Rotshil’d, E. V., A. K.Evdokimova and Z. Amgalan. 1988. Abnormalities of the trace element
composition on plants as a factor in the loss of the Mongolian gazelle in Mongolia. Byull
Mosk O-Va Ispyt Prir Otd Biol. 93 : 35—42.
Sludskii, A. A. and I. G. Shubin. 1963. Aerial visual counting of saigas, dzeren, Procapra gutturosa
and their numbers in the Kazakhstan deserts. Akad. Nauk USSR: Moscow. 84-91.
Sokolov, V., Ya. Dash, A. Lushchekina and V. Neronov. 1982. Current distribution and numbers of
Mongolian gazelles in Mongolia. Jn Zoological Research in Mongolia. Nauka, Moscow (in
Russian).
Soma, H., H. Kada, K. Matayoshi, T. Kiyokawa, T. Ito, M. Miyashita and K. Nagase. 1980. Some
chromosomal aspects of Naemorhedus goral and Procapra gutturosa. Proc. Jpn. Acad. Ser. B,
Phys: Biol. Sci. 565273277.
Soma, H., T. Kiyokawa, K. Matayoshi, I. Tarumoto, M. Miyashita and K. Nagase. 1979. The chro-
mosomes of Procapra gutturosa, a rare species of antelopes. Proc. Jpn. Acad. Ser. B, Phys.
BOL Sol, Say3 GOs
Sugar, L. 1981/1982. Eimeria cagandzeeri, new species and Eimeria sp. (Coccidia) from the Mon-
golian gazelle in Mongolia. Parasitol. Hung. 14:57—59.
Walker, E. P. 1975. Mammals of the World. 3rd ed. by J. L. Paradiso. The Johns Hopkins
University Press, Baltimore and London. 1500 p.
Xiao Qianzhu, Gao Zhongxin and Wang Xuequan. 1982. The Study on population age structure and
sex ratio of Mongolian gazelle in Hulunbeier grasslands. J. Northeast Forestry Coll. 6 :69—
78 Mammal Study 23: 1998
74 (in Chinese with English summary).
Yuan Yuhai. 1991. The investigation on Pasteurellosis of Mongolian gazelle in Hulunbeier. Sci.
Tech. Chinese Vet. 21:14—15 (in Chinese with English summary).
Zhang Zixue, Sun Jingping, Bai Shaoli and Wang Zhongen. 1995. The distribution change and
resource sustainable use of Mongolian gazelle. Biodiversity 3: 95—98.
Zhao Kentang. 1963. The biology and hunting method of Mongolian gazelle. Bull. of Biology. 1:
19—20 (in Chinese).
Zhao Kentang. 1982. The age identification of Mongolian gazelle. Chinese Wildlife. 2:40—44 (in
Chinese).
Zhao Kentang. 1988. The reasonable hunting of Mongolian gazelle. Proc. lst Conf. Int. Wildlife
Protection : 328—329 (in Chinese with English summary).
Tentuep, B.T., A. A. Hacumosuy uv A.T’. Bannuxos. 1961. Maexonutarouie Cosetckoro Corosa. TI ocyszapceTBeHHoe
Vizgateapcetso. (Boicuaa Lko1a) 441—452.
Dpynun, K. A. 1950. Oxoga asepena u3 Mouroabekoi Hapognoit Pecny6amuku. loka. AH CCCP, tr. 73, No. 4 (cited
in Tentuep et al., 1961).
Koaocos, A, M. 1939. S3sepu toropoctounoro Avirad MH CMexKHOH O6acTH Moxrosun. Yu. 3an. Mock. roc. ya, Boil. 20,
3001 (cited in Tentuep et al., 1961).
Jleoutbes, A. H. 1949. Oxoruuunii npompicez. Tp. Ka xTHHcK. Kpaepegqueck. My3ea u KaxTuHck. oTg. Bcec. reorpad.
o6pa, T. 16, Yaan-Yaa (cited in Tenru ep et al. 1961).
Jlyxauikuy, A.C. 1927. MonrosbcxanctenHaa aHTwo na (Jisepen). Tp. O6sa usyy. Manbwxypex. Kpas, Soosorua,
spin. 1. Xap6un (cited in Tentuep et al., 1961).
Mauyapexuit, C.H. 1941. Teapmuntospi a3sepena. Tp. By pat-Monroubck 300TBer. vHTa, T. 2. Yaan-Yaa (cited in
Tentuep et al., 1961).
Ou.uBKos, B. M. u O. A Hocosa. 1940. Hexpo6ataie3 y MapHOKONbITHbIX W KeHrypy Mockoscxoro 300napKa. Tp. Mock.
30onapka, T. 1 (cited in Tentuep ef al., 1961).
Tlasios, E.. 1949. Tpompicuiosbie 3Bepu Unrunckoli o 6lactu. Unra (cited in Tentuep et al. 1961).
L[petaepa, H.11. 1941. Bo.wesun xxuBoTHbIx Mockosckoro 300napka. Tp. Mock. 30onapka, T. 2, Bbin. 2 (cited in
Tentuep ef al., 1961).
Uepxacos, A. 1867. S3anvckn oxorHuka Boctouxoit Cu6upu. 1-e u3a., CI16 (cited in Tenruep et al., 1961).
Anywesuy, A. u MW. Baaropeuenckui. 1952. TIpompiciosbie 3Bepx HW MTHUbI SanagHol CuOupu. W3,. 2-e. Hoso-cu6upeKk
(cited in Tantuep et al., 1961).
(accepted 24 October 1997)
Mammal Study 23: 79-82 (1998)
© the Mammalogical Society of Japan
Short Communication
Seasonal change in the testis size of the Japanese
giant flying squirrel, Petaurista leucogenys
Takeo KAWAMICHI
Department of Biology, Osaka City University, Sugimoto, Sumiyoshi-ku, Osaka, Japan 558-8585
Fax. +81-75-551-3936, e-mail, pika @sci.osaka-cu.ac.jp
In seasonally breeding male mammals, the testes generally regress completely
during the non-breeding season. This is followed by a “reawakening” of the
regressive testes in a process known as recrudescence (Nalbandov 1976). For
the accurate estimation of testis size throughout the year, many individuals
have to be killed at different seasons (e.g., 116 male flying squirrels, Petaurista
petaurista, by Lee et al. 1993), however, such study methods cannot be applied
to protected animals such as the Japanese giant flying squirrel, P. leucogenys. |
have adopted an alternative method which involves no harm to study animals.
This involves, instead, estimating testis size during natural observations of
squirrels above me in trees. Despite this being only a rough estimation, it is
easy to perform, and the data obtained are useful in understanding the mating
system and reproductive cycle of P. leucogenys.
From my behavioral and ecological studies of P. leucogenys, I have already
confirmed the existence of two mating seasons, the first from mid-November to
mid-January, and the second from mid-May to mid-June (Kawamichi ef al.
1987). The two intervals between these mating seasons are in different sea-
sons, winter and summer. There is no information, however, on the seasonal
changes in the testis size of this species. In the genus Pefaurista, the details of
seasonal change in testis weight are known only for P. petaurista in Taiwan
(Lee et al. 1993). In this paper, therefore, I describe visual estimates of testis
size of wild P. leucogenys, and discuss seasonal changes in testis size in relation
to the species’ biannual mating seasons.
MATERIALS AND METHODS
The study area consists of 0.65 km? (65 ha) in a temperate mixed forest of
deciduous and coniferous trees. It is situated at 34°41’N, 135°50’E, at an eleva-
tion of 98-150 m, adjacent to Nara City in central Japan (see Kawamichi 1997a).
Snowfalls occur occasionally in winter, but snow-cover lasts only a few days.
Observations were conducted during 977 nights from 1983 to 1990. P.
leucogenys were located by walking at random through the forest at night using
a 9-volt searchlight. Nikon zoom binoculars (8-16, Tokyo) were used to
identify all resident squirrels by the scars on their ears and by the details of
80 Mammal Study 23: 1998
their pelage. The testes of known individual males were observed, illustrated,
and classified into four size categories: 1) full-size, 2) 2/3 to 3/4, 3) 1/3 to 1/2,
and 4) complete regression.
RESULTS
A total of 667 estimates of testis size was made for 52 resident adult males.
These males were observed for up to six years, and ten were observed continu-
ously from before they became sexually mature. Testis condition was deter-
mined bimonthly (see Fig. 1).
During the two mating seasons, from mid-November to mid-January and
from mid-May to mid-June (Kawamichi et al. 1987), more than 80% of adult
male P. leucogenys had full-sized testes (Fig. 1).
Each year testes regressed soon after the May/June mating season (Fig. 1),
and by July no males had full-sized testes, and 55% already had fully regressed
testes. Given that in the first half of June 81% of adult males still had full-
sized testes, the speed of regression during late June was considerable, and the
difference between the proportion of males with full-sized testes during the
second half of June, and the first half of July was statistically significant
(Fisher’s exact probability test, /=0.0007).
During the first and second halves of July, testes assessed as “small” (1/3
to 3/4 size) included both those regressing and those already redeveloping.
From the first half of August, however, all small testes were in the process of
ui N © © O
© Oo ~.© © OF 1OC) 1o =On ©. Oo gO
o>)
SS [> &— Js
NOV_DEC JAN. FEB MAR APR MAY JUN JUL AUG SEP OCT
MATING MATING
Fig. 1. Bimonthly changes in the testis size (estimated visually) of wild, adult male Petaurista
leucogenys. Figures on the top are sample sizes. The gradation from dark to white bars
indicates testis size: full-size, 2/3 to 3/4, 1/3 to 1/2, and complete regression, in that order.
Horizontal bars indicate the mating seasons.
Kawamichi, Testis size of Petaurista leucogenys 81
redevelopment. The proportion of males with full-sized testes reached 80%
again in the second half of October, one month before the next mating season.
During the second half of February the proportion of males with full-sized
testes decreased to 75%, and during the first half of March this further de-
creased to 64%. The remaining males had 2/3 to 3/4 sized testes during these
periods. In only one 19-month-old male, did the testes regress from March
right through the May/June mating season.
The complete process of testicular regression through to redevelopment
was observed 34 times in 24 different males. The period from the beginning of
regression to the early stage of redevelopment ranged from 42 to 57 days and
averaged 47 days (42.6, SE ; n=5). There was, however, great individual
variation. “The earliest case of regression was found on 4 June, while one male
still had full-sized testes until 22 June. Redeveloped, full-sized testes were first
observed on 8 September, although one male still had almost fully regressed
testes on 14 September.
Of 12 males observed on 24, 30, and 31 July, only three had testes which
were beginning to redevelop, but within the first week of August, the early
stages of testicular redevelopment were recognized in 10 out of the 12 males.
Although there were not enough data in late June, the main period of regression
was assumed to be from late June to late July, and the period of redevelopment
was assumed to be from late July through October.
DISCUSSION
During summer, there was much variation in testis size in the male popula-
tion. Some adult males still had regressive testes at the same time that others
already had redeveloping testes. Yearling males born in the early spring of the
previous year, begin to develop visible testes for the first time during summer
(Kawamichi 1997b). Thus, only year-round observations of males from when
they are still sexually immature onward will reveal the complexity of change
in testis size in the male population during summer. |
Lee et al. (1993) found that of 116 male P. petaurista collected in Taiwan,
the weights of testes and epididymides showed the same two peaks, from March
to June, and from October to November. Although these peak seasons were
different from those of P. leucogenys, the presence of two active seasons,
separated by an interval of a few months, is similar to that of the P. leucogenys
described in this study.
Lee et al. (1993) found that in P. petaurista, spermatogenesis degenerated
during the periods from June to August and from December to March, that is,
during the intervals separating the two active seasons. Complete regression of
testes during summer has also been observed in a captive male P. leucogenys
(Kawamichi per. obs.). Although anatomical analyses of testes during the
period from February to March are required for confirmation, it appears that
64% of adult males had full-sized testes, and the remaining 36% had testes of
2/3 to 3/4 size in the first half of March (Fig. 1), whereas no adults had full-sized
82 Mammal Study 23: 1998
testes in July. This suggests that the small size of testes in 36% of adult males
was due to the contraction of the scrotum at low temperature (mean minimum
air temperatures obtained from Nara City Meteorological Station were —0.5°C
in February and 1.6°C in March). Further study is required to clarify whether
testicular regression really occurs in winter in all parts of the male population
or not.
The exact interval between matings during winter, that is, from the last
mating on 29 January to the earliest one on 12 May, was 102 days. This period
was 51 days shorter than the interval between the last mating on 16 June and
the earliest one on 17 November (153 days) during summer (Kawamichi unpubl.
data). During the summer non-mating period, the steady increase in the
proportion of males with full-sized testes covered four months (Fig.1). The
mean duration from the beginning of regression to the early stage of redevelop-
ment, was 47 days, although there was a great deal of individual variation.
These facts suggest that the interval of 102 days during winter may not be
sufficient for functional testicular redevelopment in the male population.
The testes regressed rapidly in June, during or soon after the May/June
mating season. Therefore, if females failed to become pregnant, they could
not mate again until the next mating season from mid-November onward.
Testicular regression may be related to the fact that the May/June mating
season is one month shorter than the November to January mating season.
REFERENCES
Kawamichi, T. 1997a. Seasonal changes in the diet of giant flying squirrels in relation to reproduc-
tion. J. Mammal. 78 : 204—212.
Kawamichi, T. 1997b. The age of sexual maturity in Japanese giant flying squirrels, Petaurista
leucogenys. Mammal Study 22 : 81—87.
Kawamichi, T., M. Kawamichi, and R. Kishimoto. 1987. Social organizations of solitary mammals.
In: (Y.Ito, J. L. Brown, and J. Kikkawa eds.) Animal Societies: Theories and Facts. pp. 173—
188, Japan Scientific Societies Press, Tokyo.
Lee, P., Y. Lin, and D. R. Proguiske. 1993. Reproductive biology of the red giant flying squirrel,
Petaurista petaurista, in Taiwan. J. Mammal. 74 : 982—989.
Nalbandov, A. V. 1976. Reproductive Physiology of Mammals and Birds. W.H. Freeman & Co.,
334 pp., San Francisco.
(accepted 2 February 1998)
83
Errata (Mammal Study, Vol. 22 [1/2])
Cover back page, line 5, Ryosuke Nakata should read Keisuke Nakata
page 2, line 43, Taiveria should read Thezleria
page 3, line 1, Tazveriosis should read Thezkeriosis
page 3, line 4, paras-italogical should read paras-itological
page 3, by the Australian government should read by the Australian-Japan
Foundation, the Australian government
page 3, line 9, Southerncross should read Southern Cross
page 3, line 24, Mori should Mori
page 4, line 10, Tzkusnema javaense n, gen. should read Tikusnema javenense n.
gen
page 4, line 13, Gene’s should read Gené’s. Mori should Mori
page 4, line 14, 16: 63—275 should read 16: 263—275
page 4, line 22, Ohdachi, S., R. Masuda, H. Abe, J. Adachi, N. E. Dokuchaev, V.
Hasegawa, H., S. Shiraishi and Rochman. 1992. Tztkusnema javaense n,
gen., n.sp. (Nematoda: Acuarioidea) and other nematodes from Rattus
argentiventer collected in West Java, Indonesia. J. Parasit. 78 : 800 —804.
should read Ohdachi, S., R. Masuda, H. Abe, J. Adachi, N. E. Dokuchaev,
V. Haukisalmi,and M. C. Yoshida. 1997. Phylogeny of Eurasian soricine
shrews (Insectivora, Mammalia) inferred from the mitochondrial cyto-
chrome b gene sequences. Zoological Science 14 : 527—532
page 4, line 32, Yoshinaga, Y.and Shiraishi should read Yoshinaga, Y., T.
Okayama, W. Ohno and S. Shiraishi
page 4, line 34, Mori should read Mori
page 43, Ando, A. and S. Shiraishi. 1997. Eye lens weight for age determination
in Smith’s red-backed vole, Eothenomys smithiz. Mammal Study 22: xx
- xx. should read Ando, A.and S. Shiraishi: Eye lens weight for age
determination in Smith’s red-backed vole, Eothenomys smithi : Mammal
Study 22 45... 52
¢ ‘¢ om ” ra
a a,
= ; : Es
: ae
= ee S-
oie
‘ eet
Re r .
: ~* a 7
x =
ie
7 q a
sy
a ns ¢ she ssunimets ronsnating
et ‘ é
ra ; iH eG f a. f x i
eo ae a d ated et aon fe frp ne vexionlili al regression rai
at Ss na i, —— - aa ian pha there wens ies
obyheds i ae Ph shins whe:
memes sony a ‘ert mont bari (silamaneNe stO¥
b ere Pree Wie ~The |b Peani2 lssigolgo: 2songupee Ss
al T ? mpeoie't | bsoy bsltvorie ideigiite ‘has - > 5 Reiger
0 ay aan Blacaia 30. TAa, = enter wes
a: Sr ee 2 geet PRLS AIOM beer'h
. othe eal eat isin Saal & yet “NORE if istic be
“aopbioybare dL ante beng Pee iglov beste
C - tot Scheie): ona ( Hidlakid .2 bah qobeeks bier
ge", aay haa Branston ato ¥ east bea i
. “ ; is 3 t av my *
4 fe ae? S af
: ris 2 hee aie ig)
INSTRUCTIONS TO CONTRIBUTORS
The Mammal Study (the continuation of the Journal of the Mammalogical
Society of Japan) publishes original Articles and Short Communications, written in
English, on all aspects of mammalogy. In principle, membership of the Society is
a prerequisite for the submission of papers, but non-members may be co-authors.
Manuscripts are submitted to qualified referees for critical scientific reviewing.
Authors are notified, with referees’ comments, on acceptance, rejection or need for
revision. The editor also customarily sends manuscripts to qualified reviewers for
English editing.
Manuscripts should be submitted typewritten on one side of the paper (use A4
21.0 cm X 29.7 cm paper), and double-spaced. An approximately 3 cm margin
should be left on all sides. Do not hyphenate words at the right margin. Manu-
scripts should be arranged in the following order: the title, name(s) of author(s)
and affiliation, fax number and E-mail number if available, abstract (fewer than
200 words) and key words (five words or fewer), main text, acknowledgments,
references, tables, figure legends, figures. Titles of papers must be accurate and
concise, and (for abstraction services) include any relevant taxonomic name. A
Japanese title and a Japanese abstract should be written on separate sheets. Text
pages should be numbered through from title to references. Manuscripts should be
line-numbered, every five lines, in the left margin. Short Communications do not
exceed four printed pages. Abstracts and key words are omitted from Short
communications.
Tables and figures should be simple and self-explanatory, and their preferred
locations should be indicated in the right margin of the text. The ratio of tables and
figures to text pages cannot exceed 1:2 and they should be as few as possible. The
author’s name and figure numbers should be written on the back of original figures
and on the surface of copies.
Scientific names should be underlined. All measurements should be in metric
units. The following abbreviations should be used. Length : km, m, cm, mm, etc. ;
edicts etce: volume: km, m°, kl, I mil etc.: weight: ke. & me, etc. ;
MimeemiGminins Sec, etc,; others: cal, kcal, C, Hz, p (probability), SD) SE, etc.
Arabic numerals should be used for numbers exceeding 10.
References in the text should follow the forms: “Uchida and Shiraishi (1985)
stated that ...” (Abe and Kawamichi 1990), and (Miura e¢ al. 1993). More than one
reference within the same parentheses should be listed chronologically, alphabeti-
cally if of the same year. Full references cited must be listed alphabetically by the
first author according to the following examples:
Abe, H., S. Shiraishi and S. Arai. 1991. A new mole from Uotsuri-jima, the Ryukyu
Islands. J. Mamm. Soc. Japan 15: 47—60.
Eisenberg, J. F. 1981. The Mammalian Radiations. Univ. of Chicago Press,
Chicago, 610 pp.
Geist, V. 1982. Adaptive behavioral strategies. In (J.W. Thomas and D.E.
Toweill, eds.) Elk of North America. pp. 219—277. Stackpole, Harrisburg.
Obara, Y. 1991. Karyosystematics of the mustelid carnivores of Japan. Honyurui
Kagaku [Mammalian Science] 30: 197—220 (in Japanese with English
abstract).
Authors are recommended to refer to recent issues of the journal for details of style
and layout.
Manuscripts should be submitted in triplicate, with a separate sheet giving the
title, author(s) name(s) and address(es) for editorial correspondence, a running
head (fewer than 20 letters), the numbers of main text pages, tables and figures, and
the number of copies of reprints requested.
Galley proofs will be sent to the author. Reprints may be purchased in blocks
of 50.
—
_ “omens >
We. ~ ORIGINAL PAPERS aes | foo a
Re Endo, pales I. Nishiumi, M. ‘ordaaes, ‘i. Nabhineee 7 ©
i. — i Nadees: Agungriyono and J. Yamada: ~The functional a
Pat sinasticalony muscles of the Malayan pangolin, Manis J
Ce ae
: a ‘Sugasawa, kK and T. Mari: "Histochemical properties of the masticatory mus-
; ; “cles of FaITTGS eoeceseee OSE Ena CO cae
_ Nakata, Kee Resulation of reproduction ina natural ‘popu |
Pe Japanese field mouse, Apodemus SEA Pica eg
=
" Uraguchi, IK and he Takaneeni Den Gite eelceuion and utiliza or
fox | in Hokkaido, Japan oa ABODDADOS SOUG COL ae
aa iravakanye a. ‘and i. Mano : Improvement of errors in radio
if tions of brown bears, Ursus arctos, in Piola al apan
c Funakoshi, K and Y. Takeda: Food ite of sympatric insect
i bs aa southern Kyushu, Japan ar eleevele eee. sees AROOOOOOUOG pecs an
ee REVIEW
ee ei iang Zhaowen, S. Takatsuki, on Zongzin and Jin Kun: ‘The r pre
a
— “Short COMMUNICATION Ane Poa ab ae
The Mammalogical Society of Japan —
ISSN 1343-4152
ion of the Journal of
The Continuat
| Society of Japan
the Mammalogica
y
i
©
=o
=
‘
®
Q
;
Vol.23
| Society of Japan
ogica
The Mammal
THE MAMMALOGICAL SOCIETY OF JAPAN
OFFICERS AND COUNCIL MEMBERS FOR 1997 - 1998
President : Hisashi Abe
Secretary General : Takashi Saitoh
Executive Secretary : Keisuke Nakada
Treasurers : Seiji Ohsumi, Toshiro Kamiya
Council Members: Noriyuki Ohtaishi, Koichi Kaji, Yukibumi Kaneko,
Takeo Kawamichi, Takashi Saitoh, Seiki Takatsuki, Teruo Doi, Kimitake
Funakoshi, Kashio Maeda, Shingo Miura, Okimasa Murakami, Takanori
Mori, Kazuo Wada
The Mammalogical Society of Japan publishes original papers in two
journals: the Mammal Study (the continuation of the Journal of the
Mammalogical Society of Japan) for papers written in English, and Honyurui
Kagaku {Mammalian Science] for those submitted in Japanese. Each jour-
nal is published twice a year. Submissions are considered on the understand-
ing that they are being offered solely for publication by the Mammalogical
Society of Japan. In principle, authors submitting articles to the journals
should be members of the Mammalogical Society of Japan. Both journals
are distributed free of charge to the members of the Society.
The following are the annual dues for the membership :
Domestic members ¥7,000 (Student ¥6,000)
Overseas members US $60.00
Institutional subscriptions ¥20,000
All correspondence regarding application for membership, subscription,
address change, and other matters should be addressed to:
The Mammalogical Society of Japan
Business Center for Academic Societies of Japan, Academic Society
Center C21, 16-9 Honkomagome, 5-chome, Bunkyo-Ku, Tokyo 113, Japan
Mammal Study : the continuation of the Journal of Mammalogical
Society of Japan
Editor-in-Chief : Seiki Takatsuki
Editorial Secretary : Yukihiko Hashimoto, Masamichi Kurohmaru
Editorial Board: Mark A. Brazil, Hideki Endo, Hirofumi Hirakawa,
Toshio Kasuya, Takeo Kawamichi, Shingo Miura, Takashi Saitoh,
Hitoshi Suzuki, Hidetoshi Tamate
All correspondence regarding manuscripts and editorial matters
should be addressed to:
Dr. Seiki Takatsuki
The University Museum, The University of Tokyo, Hongo 7-3-1,
Bunkyo-ku, Tokyo 113, Japan
Fax. +81-3-3815-7053, e-mail. taka@um.u-tokyo.ac.jp
(Set ee ee ee
Mammal Study 23: 85-93 (1998)
© the Mammalogical Society of Japan
Postnatal development of the neuromuscular
junction of the masseter muscles in the
Japanese field vole, Microtus montebelli
Katsumi SUGASAWA’, Koichi ANDO? and Takayuki MorI1’*
* Zoological Laboratory, Faculty of Agriculture, Kyushu University 46-06, Fukuoka 812-0053, Japan
5 Biological Laboratory, Department of Regional Culture, Faculty of International Studies of Culture,
Kyushu Sangyo University, Fukuoka 813-0004, Japan
* To whom correspondence should be addressed
Fax. +81-92-642-2804, e-mail: sugar @agr.kyushu-u.ac.jp
Abstract. The developmental pattern of the neuromuscular junc-
tion (NMJ) in masseter muscles of the Japanese field vole, Mz-
crotus montebelli, was investigated using acetylcholinesterase
(AChE) staining and electron microscopy. At birth, intense AChE
activity limited to the site of the NMJ where many axon terminals
with the cholinergic nature were converging was observed, indicat-
ing that cholinergic neuronal activity in the vole masseter muscle
begins at this stage. The major morphogenesis of the NMJ such
as: AChE staining reaction, concentration of myonuclei at the
subneural site, elimination of the axon terminals, formation of the
myeline sheath in the intramuscular axons, and the appearance of
numerous junctional folds in the postsynaptic membrane was
accelerated after postnatal day five, and amended dramatically at
day ten with the maturation time of these NMJ components at
around day fifteen. From the combination of the present and
previous studies, it is clear that both AChE reaction and neuronal
structures alter considerably at a time when structural and func-
tional improvements give rise dramatically to muscle fibers.
This must be considered in relation to the critical role of the
neuronal influence on the differentiation and maturation of the
vole masseter muscles that are required for the accomplishment of
its own characteristic herbivorous food habits.
Key words: acetylcholinesterase, masseter muscle, neuromuscular junction,
postnatal development, ultrastructure.
Among the masticatory muscles of the rodents, the masseter muscle is the
largest, and is hence regarded as the most functional muscle during biting.
Our recent ontogenical study of a particularly successful herbivorous rodent,
the Japanese field vole, Microtus montebelli (Sugasawa and Mori 1997),
revealed that vole masseter muscles differentiate abruptly after birth and
mature fully before weaning. This developmental pattern of the masseters is
distinctly different from that of the masseters of either the rat, Rattus spp. or
the mouse, Mus spp.,in which they remain immature even at postnatal day
86 Mammal Study 23: 1998
(PND)23, when the young are weaned from their mothers (Maeda et al. 1981,
Hurov et al. 1992, Miyata et al. 1996).
It is well established in both the rat and the mouse, that neuronal actions
and factors are significantly involved in the differentiation of developing
skeletal muscles in various parts of the body (Ridge 1989, Hall and Sanes 1993,
Grinnell 1995). Nevertheless, little is known about the neuromuscular interac-
tion in the ontogenical process of the masseter muscle. Therefore, as the first
step towards an understanding of the neuronal influence on the development of
the rodent masseter muscle, we examined the developmental pattern of the
neuromuscular junction (NMJ) in the vole masseter muscles from birth to PND
15, using histochemistry for acetylcholinesterase (AChE), the enzyme hydrolyz-
ing acetylcholine (ACh) and electron microscopy.
MATERIALS AND METHODS
The Japanese field voles used for this study were obtained from our
laboratory colony which originated from wild voles live-trapped in Fukuoka
Prefecture. They were kept in cages in an environment-controlled room (23+
1°C, LD 14:10). All the animals were given a herbivorous diet (ZF, Oriental
Yeast Co., Ltd., Tokyo), a commercial mouse diet (NMF, Oriental Yeast Co.,
Ltd., Tokyo) and water ad libitum. Twenty four newborn voles of both sexes,
which were kept with their mothers in cages, were used in this study. The day
of birth (day 21 or 22 of gestation) was regarded as postnatal day 0 (PND 0).
The animals were divided by age into the following four groups: PND 0, PND
9, PND 10, and PND 15. For each of the four groups, three individuals were
used for AChE histochemistry and electron microscopy.
1. Histochemistry for AChE
The voles were anesthetized with ethyl ether then perfused through the left
ventricle with Ringer’s solution, followed by 30 ml of ice-cold 4% buffered
formaldehyde. The masseter muscles were carefully dissected from the jaws,
then postfixed with the same fixative for one hour. They were washed thor-
oughly with 0.1 M phosphate buffer (PB, pH 7.4), and then immersed sequential-
ly in PB containing 10% and 20% sucrose for two days each at 4C. For
sectioning, the materials were quickly frozen in isopentane chilled with dry ice
and sectioned at a thickness of 20 wm ina cryostat. To detect AChE activity,
sections were maintained in substrate (acetylcholine iodide, Sigma Chemical,
USA), free Karnovsky’s medium (Karnovsky and Roots 1964) for 30 min at 4°C,
and incubated in the complete medium containing 2<10°* M tetraisopropyl
pyrophosphoramide (Sigma Chemical, USA) as an inhibitor of non-specific
cholinesterase for one hour at 20°C. These procedures have been described in
detail by Ando (1981).
2. Electron microscopy
In order to avoid excessive muscular contraction during direct fixation,
Sugasawa et al., Development of neuromuscular junction 87
once the voles were fully anesthetized they were decapitated, and the heads
were first immersed for 20 min in 3% glutaraldehyde buffered with 0.1M
sodium cacodylate (SC) at pH 7.2. Subsequently, the masseter muscles were
dissected out from the jaw in the same fixative, and postfixed for two hours.
The materials were washed briefly in 0.1 M SC, and fixed for a further two
hours in 1% osmium tetroxide buffered with 0.1 M SC. The tissues were
dehydrated in an ethanol series and embedded in Epon 812. Thin sections (~60
nm) were cut on a Porter-Blum MT-1 microtome using a glass knife, and
doubly stained with lead and uranyl acetate before examination in an Hitachi-
H600A electron microscope (75 kV).
RESULTS
1. AChE-activity
In all of the voles examined at birth, AChE activity was observed to be
limited to the center of the muscle fibers where the NMJ is formed. The
muscular areas stained specifically with AChE were shaped like a button with
a diameter of about 3.5 4m, and showed a linear profile in the transverse
direction (Fig. la). The staining reaction at this site did not change signifi-
Fig. 1. AChE reaction of the masseter muscle in the vole at birth (a) and on PND 15 (b).
Bar : 50 wm.
88 Mammal Study 23: 1998
cantly from PND 0 to PND 5, however, by PND 10, the AChE-positive area had
increased to about three times the diameter observed at birth with a rise in the
activity of this particular enzyme. The AChE-positive area enlarged further
after PND 10, reaching approximately five times the area observed at birth on
PND 15. The enzyme activity also became more prominent (Fig. 1b). No
detectable difference in the AChE staining properties of the NMJ was observed
between the neonates at PND 15 and maternal voles at six months of age.
2. Electron microscopic observations
At birth, many axon terminals covered with Schwann’s cells converged at
the site of the NMJ, (Fig. 2a). These axon terminals did not contain the
cytoskeletal or membranous components indicative of growth cones, but ac-
cumulated with small clear vesicles (about 50 nm in diameter) indicating their
cholinergic nature (Fig. 2b). At this stage, although the myeline sheath was
not yet formed, most of the intramuscular axons were already encircled by
Schwann’s cells (Fig. 2c). The basal lamina extended over the synaptic cleft in
the muscle fibers. On the one hand, no junctional folds or subneural nuclei
were seen, nor was an accumulation of mitochondria noted in the soleplate
region. On the other hand, the subneural muscle plasma membrane was
undercoated with an electron-dense amorphous material, showing a profile
similar to the postsynaptic membrane in adults (Fig. 2b).
No appreciable difference in the number of axon terminals in the NMJ was
observed between birth and PND 5, however each of the intramuscular axons
was surrounded by a thin myeline sheath by PND 5 (Fig. 3a, b, c). After PND
5, some structural specializations in the muscle fibers were observed in the
soleplate region. Numerous myonuclei were concentrated at the subneural
site, forming the subneural nucleus (Fig. 3a). In parallel with this, the muscle
plasma membrane began to invaginate and form junctional folds (Fig. 3c).
By PND 10, the number of axon terminals had decreased markedly (Fig.
4a), and the myeline sheaths of the intramuscular axons became much thicker
(Fig. 4b). At this stage, the junctional folds increased greatly in number and
grew taller owing to the frequent occurrence of deep invaginations of the
plasma membrane. The accumulation of mitochondria, though not so prom1-
nent, was also observed in the soleplate regions (Fig. 4a).
By PND 15, the NMJ had only one axon terminal that was filled with small
clear vesicles and small mitochondria, which was also furnished with numer-
ous, regularly arranged junctional folds that were very tall and showing
structural properties similar to those seen in adult voles (Fig. 5a, b).
DISCUSSION
The present study has shown for the first time an age-related change in
AChE-activity and in the neuronal elements in the NMJ of the vole masseter
muscle. At birth, high AChE activity was localized specifically at the NMJ,
where a number of axon terminals with small clear vesicles, typical of a
Sugasawa et al., Development of neuromuscular junction 89
Fig. 2. Electron micrographs of the NMJ (a, b) and intramuscular axons (c) in the vole
masseter muscle at birth. at: axon terminal, bl: basal lamina, im: intramuscular axon,
mf: myofiber, ps: postsynaptic membrane, sc=Schwann’s cell, sv: small clear vesicle.
bane wll poma(ay©)e 05 X,’, where X; is the 7th allele frequency of the locus in the
population. An average of expected heterozygosity (He) was calculated using
the formula He=She;/r, where he; is heterozygosity of the jth locus and ¢ is
the number of analyzed loci. Microsatellites genotype frequencies were tested
against the Hardy-Weinberg’s expectation for each locus in the population
using the computer program Arlequin ver. 1.0 (Schneider et al. 1997). Genetic
differentiation between populations was estimated with Weir and Cockerham’s
(1984) Fst value. The significance of Fst value was tested using the permuta-
tion procedure in Arlequin ver. 1.0.
RESULTS
At two microsatellite loci (OarFCB193 and BOVIRBP), clear bands of 100
-150 base-pairs (bp) were identified as alleles. The INRA040 locus provided
prominent bands (188-240 bp) with a few weak bands (Table 2). Animals from
the Hokkaido (n=93 for OarFCB193, ~=108 for BOVIRBP, and ~=100 for
INRA040) and the Chiba (x=13 for all loci) populations were analyzed to
estimate allele frequencies for each microsatellite locus. At OarFCB193 locus,
two alleles in Hokkaido and four alleles in Chiba were found. At INRA040
locus, two alleles in Hokkaido and five alleles in Chiba were found (Table 2),
Table 2. Microsatellite variation in the Hokkaido and Chiba popuiations.
Locus Hokkaido Chiba
OarFCB193 No. individuals 93 13
Allele* & frequency 130 0.87 0.08
128 0 0.08
23 0 0.08
109 18 0.78
ho 0.24 0.39
he 0.23 0739
BOVIRBP No. individuals 108 13
Allele* & frequency 144 IL 0.96
140 ) 0.04
ho 0 0.08
he 0 0.07
INRA040 No. individuals 100 13
Allele* & frequency 240 0 0.04
238 0 0.08
202 0637 0.81
190 0 0.04
188 0.68 0.04
ho 0.39 523
he 0.44 0.38
Average over No. individuals NOOBS SxS 13.00+0.00
> lense SIS A AGe=0F33 3.67+0.88
Ho 0) 2llseO Ii 0, 2322 0R09
He O77 a= NR 0228 = ORubt
*Molecular sizes (bases) refer to allele name
ho and Ho: observed heterozygosity.
he and He: expected heterozygosity.
Nagata et al., Sika deer microsatellite DNA 99
while the BOVIRBP locus showed monomorphism in the Hokkaido population
and two alleles in the Chiba population (Table 2). Between Hokkaido and
Chiba populations there were some common alleles: two alleles at OarFCB193,
one allele at BOVIRBP and two alleles at INRA040.
Observed heterozygosities (ho) of OarFCB193, BOVIRBP and INRA040
were ().24, 0 and 0.39, respectively, in the Hokkaido population, and 0.39, 0.08
and 0.23, respectively, in the Chiba population. The average observed hetero-
zygosity (Ho) was 0.21+0.11 for the Hokkaido population and 0.23+0.09 for the
Chiba population (Table 2). The microsatellite genotype frequency signifi-
cantly agreed with the Hardy-Weinberg expectation in each locus in the
population except at INRA040 in the Chiba population (p=0.06) (Table 3).
The difference between Hokkaido and Chiba was statistically significant (Fst
value=0.072, =0.03 in permutation tests).
DISCUSSION
Microsatellite analysis has more advantage than allozyme analysis and
multilocus DNA fingerprinting, because of higher polymorphism and easier
genotyping from a small amount of DNA. Nozawa ef al. (1985) analyzed 28
allozyme loci from 20 individuals in the Hokkaido sika deer population and
reported only two polymorphic loci with low variability : the average hetero-
zygosity was 0.0158. By contrast, our results of microsatellite analysis showed
much higher values (Ho =0.21+0.11) than their allozyme data (Table 2).
Abernethy (1994) indicated that the sika deer population introduced to
Scotland showed monomorphism at the BOVIRBP locus and two alleles for
OarFCB193. In the present study, the BOVIRBP locus of the Hokkaido popu-
lation was also monomorphic and showed a low value (0.08) of heterozygosity
in the Chiba population. These data suggest the BOVIRBP locus is not so
hypervariable in the sika deer. Pépin et al. (1995) reported that the number of
alleles for INRA040 were nine in the goat (x=60) and 44 in the cattle (7 > 36).
Our results revealed that the sika deer in Japanese islands have at least four
alleles for OarFCB193, five alleles for INRA040 and two alleles for BOVIRBP.
In the present study, two other loci (INRA003 and INRA023) could not be
PCR-amplified with primers reported by Pépin ef al. (1995).
The genotype frequency significantly well agreed with Hardy-Weinberg
expectations at all loci in both populations except for the INRA040 locus in the
Chiba population (Table 3). The observed heterozygosities of OarFCB193 and
BOVIRBP were same level as the expected heterozygosity, while the observed
heterozygosity of INRA040 was lower than the expected heterozygosity (Table
2). Some heterozygotes such as null/normal genotypes, however, might have
been counted as homozygotes of normal alleles, because it is difficult to
distinguish homozygotes of normal alleles from null/normal genotypes with a
single band of PCR product. Our results show that null allele may exist at
INRA040 locus. Jarne and Lagoda (1996) suggested that null alleles may
disturb population studies leading to underestimate of heterozygosity. The
100 Mammal Study 23: 1998
INRA040 locus in the present study is likely in that case. From this reason, we
compared heterozygosities of OarFCB193 and BOVIRBP between Hokkaido
and Chiba. At both loci, heterozygosities of the Hokkaido population were
less than those of the Chiba population (Table 2). Besides that, allele numbers
at each locus in the Hokkaido population were much smaller than those of the
Chiba population (Table 2). These results suggest a higher degree of homoge-
neity in the Hokkaido population. This supports a low genetic variety of
mitochondrial DNA in the Hokkaido population, shown by our previous analy-
sis (Nagata et al. 1998). Some bottlenecks of the sika deer recorded in
Hokkaido history (Inukai 1952) could have induced such a low genetic diversity
in the population.
The present results provide invaluable information for understanding
genetic variety and history of the Hokkaido sika deer population, leading to the
range of application of molecular genetics to conservation biology of the sika
deer in Japan.
Acknowledgments : We would like to express our thanks to Dr Seigo Higashi
for helpful comments. We are grateful to Mr Masami Yamanaka, Mr Hiroyu-
ki Uno, Dr Tadayoshi Takeda and other scientists for helpful supports of
sample collection. We are grateful to Nature Conservation Department of
Hokkaido Government, Hokkaido Institute of Environmental Sciences, Onbe-
tsu Town Office, Shintoku Town Office, Shibecha Town Office, Shiranuka
Town Office, Hamanaka Town Office, Utanobori Town Office and hunters for
providing the sika deer specimens. This study was supported in part by
Grants-in-Aid for Scientific Research from the Ministry of Education, Science,
Sports and Culture, Japan, and by the Global Environmental Research Fund
(F-1) from the Japan Environment Agency.
REFERENCES
Abernethy, K. 1994. The establishment of a hybrid zone between red and sika deer (genus Cevvus).
Mol Ecoly3& 5al562:
Chakraborty, R. and M. Nei. 1977. Bottleneck effects on average heterozygosity and genetic dis-
tances with the stepwise mutation model. Evolution 31 : 347-356.
Hokkaido Government. 1986. Result of a Survey Related to Sika Deer and Brown Bear Sighting in
Hokkaido. Hokkaido Nature Preservation Division, Sapporo (in Japanese).
Hokkaido Government. 1994. Result of a Survey Related to Sika Deer and Brown Bear Sighting in
Hokkaido. Hokkaido Institute of Environmental Sciences, Sapporo (in Japanese).
Inukai, T. 1952. The sika deer of Hokkaido and its prosperity and decline. The Report of Northern
Cultural Research 7: 1-45 (in Japanese).
Jarne, P. and P. J. L. Lagoda 1996. Microsatellites from molecules to populations and back. TREE
12424-4729)
Kaji, K.1995. Deer irruptions - A case study in Hokkaido, Japan. Honyurui Kagaku [Mammalian
Science] 35: 35-43 (in Japanese).
Kaji, K., T. Koizumi and N. Ohtaishi. 1988. Effects of resource limitation on the physical and
reproductive condition of sika deer on Nakanoshima island, Hokkaido. Acta Theriol. 33 : 187
~208.
Nagata et al., Sika deer microsatellite DNA 101
Masuda, R. and M.C. Yoshida. 1994. Nucleotide sequence variation of cytochrome b genes in three
species of weasels, Mustela itatst, Mustela sibirica and Mustela nivalis, detected by improved
PCR product-direct sequencing technique. J. Mammal. Soc. Japan 19 : 33-43.
Nagata, J., R. Masuda, K. Kaji, M. Kaneko and M.C. Yoshida. 1998. Genetic variation and popula-
tion structure of the Japanese sika deer (Cervus nippon) in Hokkaido Island, based on
mitochondrial D-loop sequences, Molecular Ecology 7 : 871-877.
Nei, M., T. Maruyama and R. Chakraborty. 1975. The bottleneck effect and genetic variability in
populations. Evolution 29: 1-10.
Nozawa, K., T.Shotake, Y. Kawamoto and K. Hayasaka. 1985. Genetic variability in several
mammalian species of Japan. The Report of Grant-in-Aid for Specific Research (Evolution-
ary Mechanisms at Molecular Level) from the Ministry of Education, Science, and Culture of
Japan 3: 220-221 (in Japanese).
O’Brien, S. J. and J. F. Evermann. 1988. Interactive influence of infectious disease and genetic diver-
sity in natural populations. TREE 3: 254-259.
Ohtaishi, N. 1986. Preliminary memorandum of classification, distribution and geographic variation
on Sika deer. Honyurui Kagaku [Mammalian Science] 53: 13-17 (in Japanese).
Pépin, L., Y. Amigues, A. Lepingle, J. L. Berthier, A. Bensaid and D. Vaiman. 1995. Sequence conser-
vation of microsatellites between Bos taurus (cattle), Capra hircus (goat) and related species.
Examples of use in parentage testing and phylogeny analysis. Heredity 74 : 53-61.
Queller, D. C., J. E. Strassmann and C. R. Hughes. 1993. Microsatellites and kinship. TREE 8: 285-
288.
Sambrook, J., E. F. Fritsch and T. Maniatis. 1989. Molecular Cloning. Cold Spring Harbor Labora-
tory, Cold Spring Harbor, New York.
Schneider, S., J. M. Kueffer, D. Roessli and L. Excoffier. 1997. ARLEQUIN ver. 1.0: A software for
population genetic data analysis. Univ. of Geneva, Switzerland.
Takatsuki, S. 1994. Extinction of plants caused by herbivory. KAGAKU [Science Journal] 64 : 672
-674 (in Japanese).
Vaiman, D., D. Mercier, K. Moazami-Goudarzi, A. Eggen, R. Ciapolini, A. Lépingle, R. Velmala, J.
Kaukinen, S. L. Varvio, P. Martin, H. Léveziel and G. Guérin. 1994. A set of 99 cattle mi-
crosatellites: characterization, synteny mapping and polymorphism. Mammalian Genomes
eZ Oom2 Oil.
Viard, F., P. Bremond, R. Labbo, F. Justy, B. Delay and P. Jarne. 1996. Microsatellites and the
genetics of highly selfing populations in the freshwater snail Bulinus truncatus. Genetics 142:
W824 7.
Weir, B.S. and C. C. Cockerham. 1984. Estimating F-statistics for the analysis of population struc-
ture. Evolution 38:1 358-1370.
Whitehead, G. K. 1993. The Encyclopedia of Deer. Swann-Hill, Shrewsbury. 704pp.
(accepted 14 October 1998)
Mies) r eset ie cay ta. rit vet
aes fuloe ARRON eras iat,
y 4 imi
, =F) a |
vo s (eine iu Lae’ cS fant FE
| gad A if he |
| “+0 inl soe inlet th
t
4
6
-
yey
=
—~ ei 5
. eae ae oe i . : zB —
‘i oe + ayia grail 1 cerry
h ig Se ahh ‘tia. pa hy
¢ eo ts Nad coe 7 hh eh Th aa ‘ . 7
ie . z NRA He! Pe ie aes eM deg "} be
par, ~ ' , ce
rams. COR pi? Ms ye PRT ie) ES than bate ae ¥' Mri 2]
=, NeW Un diaare ten A AH inh ila inet ae the ate
= oh > t a ; Ms ae ry =a | a ia :
F si ‘ ole Sete bee
= a: - ee / pil ae Poke, ‘ol it pete om ‘vali ah : war's a dddat: 5 he
ey / Ris ° ' vs ,
~ oe Dyan $5 “athe ches Oa tise ela eT ost at EA Teil earl bas
. ' ; f ] . ; of <4 phavi N
=i ‘: me ee e ee ‘ re es
et Mi Wier .20) Say a g ae) 107 thai ee | ry, iT
3s i i _ Y 2
he n oh y a mr a ¥ | ;
i STEEP A ER walhitvebis hdrizcpl a te
= Ss pe Ae a if
Sten Tie) =f ~ ee
" a4 i H ' ie > { ‘ * =
= Se ee mete z * 4 re
, 5 % ~ el UP os a 4 Zz
: a > at :
= —— ~ a> At 7 5
= 3 ‘ ea ore Zz y
i reve l F. , 4
: i s4 { An " = = hes i
en cae af
A ae 3 2 . ee bike Z
4 sy x “ i
= < q is “a 3 mt “ 3
eX 2 . whe.
, s ») n i
a pS ; tf
y \ a + 4 = Cae ( t #
=f — Al oo : e
: 7 ; ; EN Se Ta i :
S >
5 3
fi
Ai i “ . J
ra f |
Sear %
E a 4
es e a \
Mammal Study 23: 103-107 (1998)
© the Mammalogical Society of Japan
The twinning rate of sika deer, Cervus nippon, on
Mt. Goyo, northern Japan
Seiki TAKATSUKI
The University Museum, The University of Tokyo, Hongo 7-3-1, Bunkyo-ku, Tokyo 113-0033, Japan
Fax. +81-3-3815-7053, e-mail: taka @um.u-tokyo.ac.jp
Abstract. Knowing demographic parameters is important in
order tounderstand the life history of mammals. As an example,
the twinning rate of sika deer, Cervus nippon, on Mt. Goyo was
determined based on 2,064 samples collected from 1981 to 1997.
The sex ratio of single fetuses (7=1,946) was even (49.8% males
and 50.2% females). Six pairs (0.29%) of twins were found. One
pair was composed of male and female embryos, suggesting that at
least some conceptions are dizygotic. It was concluded that twin-
ning is rare in sika deer. This rate was similar to, or lower than,
that found in red deer, C. elaphus.
Key words: Cervus nippon, Japan, reproduction, sika deer, twinning.
Many of the life history variables among mammals may be best explained on
the basis of body size. The “Fast-slow continuum” theory (Eisenberg 1981,
Stearns 1983, Martin and MacLarnon 1985), for example, has shown that
smaller-bodied mammal species are not merely short-lived, but that they typi-
cally produce large litters of rapidly developing young, whereas larger mam-
mals produce fewer young which develop slowly and live longer. There are,
however, exceptions. Sika deer, Cervus nippon, for example, the males of
which weigh 80 kg and the females of which weigh 50 kg, usually produce single
offspring, while similarly sized Odocoileus species (Wallmo 1978) and the very
much larger moose, Alces alces, the largest extant species of deer, regularly
carry twins (Franzmann 1978). These differences may be better explained in
terms of variation in species-specific habitat quality than in terms of mere body
size. The habitats of Odocozleus species and moose are dominated by browse,
which prevents detection by predators (Geist 1981).
In order to fully understand the life histories of mammals, a comprehensive
range of parameters including body size, phylogenetic relations and habitat
quality must be investigated (Wootton 1987, Harvey et al. 1989), and precise
quantitative data is essential. Among the various life history variables, demo-
graphic information is one of the most important (Millar and Zammuto 1983,
Fowler 1987).
Although the pregnancy rates and the age of weaning are fairly well known
for sika deer (Koizumi 1992, Takatsuki 1992, Kaji 1995, Asada and Ochiai 1997),
it was believed until recently that twinning did not occur in wild populations
104 Mammal Study 23: 1998
(Feldhamer and Marcus 1994). There have been, however, several reports of
twinning both in captivity and in the wild.
I have collected information on sika deer pregnancies since 1981 on Mt.
Goyo, northern Japan, and have found several cases of twinning among more
than 2,000 females. The objectives of this paper, therefore, are to report on
twinning in this population and to review previous reports on twinning in sika
deer and in the closely related red deer, C. elaphus.
MATERIALS AND METHODS
Sika deer were shot for pest control on Mt. Goyo in northern Honshu,
Japan, between January and March each year from 1981 to 1997. The deer
carcasses were brought to checking stations where whole body weights were
determined to the nearest 0.5 kg using spring scales prior to dissection. As
conception takes place during the autumn rut, fetuses were already well
developed and generally weighed 100-900 g during the sampling period, thus it
is believed that none were overlooked. The rate of twinning was examined
among 2,064 culled females. The sex of the fetuses was determined by genital
examination, though some fetuses (7 =124) were too badly injured as a result of
the shooting of their mothers for their sexes to be determined (Table 1). The
ages of the adults were determined by examination of the cementum annuli of
the first incisors, or were estimated from the wear of the incisors (Ohtaishi 1976)
according to known age-wear relationships (Takatsuki, unpublished).
RESULTS AND DISCUSSION
Since sample sizes were small during the 1980s, they were rounded (Table
1). Of the total of 2,058 single fetuses examined, 1,934 were sexed and among
these the sex ratio was even (females 50.2%, males 49.8%, y?-test, p >0.05). If
twins were added (7=1,946), the sex ratio was completely even (males and
females=50.0%).
Table 1. Number of pregnant females and sex of fetuses of sika deer on Mt. Goyo through
1981-1997. f: female, m: male.
Sex Single Twin
teat unknown female male f-f f-m m-m Ee
1981-89 5) 93 107 0) 1 1 207
1990 ) 38 52 0) 0) 0 90
1991 1 89 70 0) 0 0 160
1992 0) 87 96 0) 0) 1 184
1993 a 197 123 0 0) 0 Bl
1994 3 176 191 0) 0) 1 Sil
1995 28 102 102 0) 0) IL 233
1996 i 90 116 1 0) 0 214
1997 le 98 107 0) 0) 0 278
total 124 970 964 il 1 4 2,064
Takatsuki, twinning of stka deer 105
Table 2. Information of females carrying twins.
*Figures in parentheses are estimated age from wear.
No. Locality Date of sampling oan ee Wear class
83068 Ofunato Mar. 21,1983 = 5 II
87012 Ofunato Feb. 21,1987 49.5 ORS Ill,
92229 Kamaishi Feb. 29, 1992 52 C85) Ill,
94553 Sanriku Jan. 8,1994 45 OEs ) V
95186 Kamaishi Feb. 26,1995 50 (Gre?) ?
96220 Takada Feb. 1, 1996 45 ( 52) if
Among the 2,064 pregnant females examined, six (0.29%) were carrying
twins (Table 1), indicating that while twinning does occur, it is exceptional in
this population.
Records of twinning are very rare among wild sika deer. Suzuki (1995)
reported one example (1.1%) among 89 pregnant females in one Hokkaido
population, and Uno (personal communication) found two sets of twins (3.4%)
among 58 pregnant females in another, though he considered that this rate
might be high because of his small sample size. Feldhamer and Marcus (1994)
reported that a set of healthy sika deer twins was carried by one female among
54 females introduced to Maryland, USA. Five sets of twins (4.6%) among 108
births (Zuckerman 1953) and one set (1.20%) among 83 births (Haensel 1980)
have been reported from German zoos. The sample size of the present study
(2,064 females) was very much greater than in any of these cases thus the results
from this study may be more reliable.
Among both Eurasian red deer and North American wapiti (elk) popula-
tions, both close relatives (both Cervus elaphus) of sika deer, twinning is also
very rare (see review in Mitchell ef al. 1977 and Sadleir 1987). Guiness and
Fletcher (1971) recorded only one example among Scottish red deer, while other
studies have indicated that twin embryos among red deer occur at rates ranging
MmommlessstnamnO za to 20% (less tham 0.295 Mitehelll 1973 > 0295." 7— 1690;
Kittams 1953; 0.2%, ~=1,186, Flook 1970; 0.6%, ~=1,106, Greer 1968; 1.2%,
n=875, Korning and Vorreyer 1957), and 2.0% (~=97, Brna 1969).
During the present study, the combinations of twins were: one female-
female set, one female-male set, and four male-male sets (see Table 1). Male
and female twins were also reported among Hokkaido sika deer by Suzuki
(1993), further indicating that at least some conceptions are dizygotic.
The data collected during the present study of the Mt. Goyo population
provides no evidence for any particular tendency towards twinning in any
particular locality, period, body weight, or age (Table 2). Since pregnancy
among red deer is known to be affected by nutritional conditions (Mitchell et
al. 1977), further studies of other populations are required to clarify what
factors affect twinning in sika deer.
Acknowledgements : | thank the hunters of Ofunato, Kamaishi, and Rikuzen-
106 Mammal Study 23: 1998
Takada cities, and Sanriku, and Sumita towns for their co-operation. Stu-
dents of both Tohoku and Iwate Universities kindly assisted with fieldwork,
while S$. Miura, H. Takahashi, H. Uno and S. Tatsuzawa provided valuable
information on twinning. The Iwate Prefectural Government supported this
study.
REFERENCES
Asada M. and K. Ochiai. 1997. Analysis of captured sika deer. Jn Report on Conservation of Sika
Deer on Boso Peninsula of Chiba Prefecture. pp. 21—50. Chiba (in Japanese).
* Brna, J. 1969. Fertility of hinds and post natal mortality of young red deer Cervus elaphus in Belje.
Jelen 8: 69—72.
Eisenberg, J. F. 1981. The Mammalian Radiation. Athlone Press, London.
Feldhamer, G. A. and M. A. Marcus. 1994. Reproductive performance of female sika deer in Mary-
land. J. Wildl. Manage. 58 : 670—673.
Flook, D. R. 1970. Causes and implications of an observed sex differential in the survival of Wapiti.
Can. Wildl. Service Rep. Ser. 11, 71 pp.
* Fowler, C. W. 1987. A review of density dependence in populations of large mammals. Jn (Gas-
aways, H.ed.) Current Mammalogy. pp. 401—441. Plenum Press, NY.
Franzmann, A. W.1978. Moose. Jn (Schmidt, J. L.and D.L. Gilbert, eds.) Big Game of North
America. pp.67—81. Stackpole, Harrisburg.
Geist, V. 1981. On the reproductive strategies in ungulates and some problems of adaptation. Jn
(Scudder, G.G.E.and J. L. Reveal, eds.) Evolution Today. pp.111—132. Proc. Int. Congr.
Syst. Evol. Biol., 2, Univ. Brit. Col., Vancouver.
* Greer, K.R.1968. Special Collections Yellowsotne Elk Study 1967—1968. Job Completion
Report, Federal Aid Project No. W-83-R-11, 26p.
Guiness, F. E. and J. Fletcher. 1971. First ever recorded incidence of twins born to a red deer hind in
Britain. Deer 2: 680—682.
Haensel, J. 1980. Zur Biologie der Vietnam-Sikas (Cervus nippon pseudoaxis Eydoux & Souleyet,
1938) Untersuchungen an der Zuchtgruppe im Tierpark Berlin. Milu, Berlin, 5 :69—99.
* Harvey, P. H., A. F. Read and D.E. L. Promislow. 1989. Life history variation in placental mam-
mals: unifying the data with theory. Oxf. Surv. Evol. Biol. 6:13—31.
Kaji, K. 1995. Analysis of captured sika deer. Ju Report on Brown Bear and Sika Deer, I. pp. 85—
103. Sapporo (in Japanese).
Kittams, W. H. 1953. Reproduction of Yellowstone elk. J. Wildl. Manage. 17: 177—184.
Koizumi, T.1992. Reproductive characteristics of female sika deer, Cervus nippon, in Hyogo
Prefecture, Japan. Jn (Spitz, F., G. Janeau, G. Gonzalez and S. Aulagnier, eds.) Proceedings of
the International Symposium “Ongulés/Ungulates 91”. pp.561—563. S.F.E.P.M.and [.R.
G. M., France, 661 pp.
Korning, F. and F. Vorreyer. 1957. Untersuchunger tiber Vermehrungsraten und k6rpergewichte
beim weiblichen Rotwild. Z. Jagdwiss 3: 145—153.
Martin, R. D. and A. M. MacLarnon. 1985. Gestation length, neonatal size and maternal investment
in placental mammals. Nature 51 :81—117.
Millar, J.S.and R.M.Zammuto. 1983. Life histories of mammals: an analysis of life tables.
Ecology 64 : 631—635.
Mitchell, B. 1973. The reproductive performance of wild Scottish red deer, Cervus elaphus. J.
Reprod. Fert., Suppl. 19 : 271—285.
Mitchell, B., B. W. Staines and D. Welch. 1977. Ecology of Red Deer: a research review relevant to
their management in Scotland. Institute of Terrestrial Ecology, Banchory ; 74 pp.
Ohtaishi, N. 1976. Wear on insiform teeth as an index to the age of Japanese deer at Nara Park. In
Report on Nara Sika Deer for 1975. pp.71—82. Kasuga Kenshokai (in Japanese with English
Summary).
Takatsuki, twinning of stka deer 107
Sadleir, R. M. F. 1987. Reproduction of female cervids. Juz (Wemmer, C.M., ed.) Biology and
Management of the Cervidae. pp. 123—144. Smithsonian Inst. Press, WA.
Stearns, S.C. 1983. The influence of size and phylogeny on life history patterns. Oikos 41 :173—
187.
Suzuki, M. 1993. Reproduction of female sika deer (Cervus nippon Heude, 1881) in Ashoro District,
Hokkaido. J. Vet. Med. Sci. 55 : 833—836.
Suzuki, M. 1995. Fetal growth and estimation of copulation date. Ju Report on Brown Bear and
Sika Deer, I. pp.111—125. Sapporo (in Japanese).
Takatsuki, S. 1992. A Sika Deer Herd Living in the North. Dobutsusha Publ. Co., Tokyo, 262 pp (in
Japanese).
Wallmo, O. C. 1978. Mule and black-tailed deer. Ju (Schmidt, J. L. and D. L. Gilbert, eds.) Big Game
of North America. pp.31—41. Stackpole, Harrisburg.
Wootton, J. T. 1987. The effects of body mass, phylogeny, habitat, and trophic level on mammalian
age at first reproduction. Evolution 41 : 732—749.
Zuckerman, S. 1953. The breeding seasons of mammals in captivity. Proc. Zool. Soc. London 122:
827 — 950.
* Cited in Sadleir (1987).
(Accepted 16 September 1998)
a
4
rake i}
. Key : aoe
ee, ein
= eis 3:4 a ae
srl a o BEBE pitta , moe Pritt) oq,
v E 6 ‘ ig From Te Te ag Me ‘Ste
a ie Bia ic PSE ear opie ers” oan Fil ie
oi peR LAN § e i Y ;
ih thd 5 m9 ; . .
Ec. = ia wa i . r vs = a. ‘
; ¥ co f Cereal 1 ape ee eee yO i
a a a ; ot SS Ua!
* he ee ave ag ae F
— r) ae A Stl eae Oy
' , , ae ee Serie ; if
rh aa) ‘ ae oe vs éj "
Se ve ; = ‘ i) fl
‘ } H a
= ! _ -
a } ne cana ae
; A = )
oa. | ® mee Ses
. ( F > v
Z| Ma; i \ Poe
= vs os a) , f
j ; q Es
ie aye ¥,
e 3 oes r i
cy £ a 4
' ‘
ny
pot 4 4 o
= « ag Qe ,
Ms Zs =~
— 7 os 2
% ae Pen el
‘ ~ nes
= — + =
~ Safi r
t Ay ‘
is oo x
p 3 hh 4
eh 3 le er 4
=a : bs ae
= r vi
, #
ES i oe
a ge Laer 4
i ~ ca | tear
= ay f a
i > -*,
1: os = 4 me OTS =
S 1 Pris
; »
- a /
Mo y a ;
+ 5G) “A
~ AN o)
{ | +
2 Noe .
pe ; aa
/
é ip
Y, = s
1 ‘Z £ ’
7 ¥
ya Es , 1 . _
i ¥ F if “)
j se a j ia
Z 7 Eee
= x — at
= as,
_— 7 “4 rh
& c ~
B me
‘i 1 i i .
2 ates i
a 4 netie tt
\ os ‘ '
4 fete ;
BG : f
Mammal Study 23: 109-118 (1998)
© the Mammalogical Society of Japan
The “Trace Recorder”, a new device for surveying
mammal home ranges, and its application to raccoon
dog research
Yayoi KANEKO!, Takeyoshi SUZUKI*?, Naoki MARUYAMA, Oichi ATODA%*,
Nobuo KANZAKI and Masaki TOMISAWA*?
Wildlife Conservation, Department of Ecoregion Science, Faculty of Agriculture, Tokyo Noko Univer-
sity, 3-5-8 Saiwaicho, Fuchu, Tokyo 183-0054, Japan
* Graduate School of Bio-Applications and Systems Engineering, Tokyo Noko University, 2-24-16
Nakamachi, Koganeit, Tokyo 184-O012, Japan
1 Present address: Landscape and Ecology Division, Environment Department, Public Works Research
Institute, Ministry of Construction, 1 Asahi, Tsukuba City, Ibaraki 305-0804, Japan
2 Present address: Yokogawa Electric Corporation, 2-9-32, Nakamachi, Musashino, Tokyo 18O-O006,
Japan
3 Present address: Department of Information Engineering, Maebashi Institute of Technology, 460-1
Kamisatorit, Maebashi, Gunma 371-0816, Japan
Abstract. A new telemetric system known as the “Trace
Recorder” was developed in order to reduce labor costs and to
avoid radio-tracking location errors. It was first tested during
studies of habitat utilization by raccoon dog, WNyctereutes
procyonoides viverrinus, in Japan. The Trace Recorder (TR)
consists of four separate units: beacons, recording units (RU), an
automatic collar release system (ACRS) and a personal computer
for processing data. The beacons emit 8kHz magnetic signals
periodically. A total of 600 different magnetic codes can be used
in order to identify locations. The collar-based RU intercepts and
records signals when the study animal is within 3m of a beacon.
The ACRS installed on the collar alongside the RU allows the
collar to be released by a special code and recovered so as to
facilitate the retrieval of stored data. In order of evaluate the
capabilities of the trace recorder system, we used the TR in the
analysis of the habitat use of a raccoon dog for 25 days between 16
November and 10 December 1996 in Hinode Town, suburb of
Tokyo. Twenty-four beacons were set at along paths, at a gar-
bage site, and at badger setts and animal latrines. The RU
recorded 91 time units and durations of visits to trails and to some
cores sites were collected. The TR system is capable of recording
census data 24 hours every day for three months. The new TR
system proved to be more accurate than current radio-telemetry
equipment for recording frequency, duration and times of visits to
target sites by the study animal.
Key words: automatic collar release system, home range, raccoon dog,
telemetry system, trace recorder .
110 Mammal Study 23: 1998
The wireless radio-telemetry system currently used in the study of free-ranging
wildlife was first developed in the 1960s (Amlaner 1991). It has been widely
used in relocating individuals and in measuring physical conditions of wildlife
species (Mech 1983, Kenward 1987). Radio telemetry quickly proved a popular
technique for tracking and studying small nocturnal, forest-living carnivores in
Japan (Nakazono 1989, Ito 1992, Sasaki 1994, Tatara 1994, Yamamoto 1995).
Locating animals is, however, usually quite laborious because of rugged terrain
(Mech 1983, Ikeda 1985). In order to save on labor costs for relocating study
animals, an automatic tracking system was devised (Doi 1985, Yoneda e al.
1988), however its use has been restricted by topographic condition and by
access to electric power. Continuous location recording over-long periods of
time is impractical by this method, especially of active, wide ranging species.
Further, a triangular location technique of this current system could not avoid
big errors because of users and terrain (Mech 1983).
Because of the high labor costs incurred while radio-tracking free-ranging
animals, other methods have long been required by field researchers. In
response to this need, the authors devised a new telemetric system known as the
Trace Recorder or TR. The concept and the details of the circuitry involved
in the TR have been submitted elsewhere (Suzuki ef al. in press), hence in this
paper, we introduce the systems practical capabilities and describe its applica-
tion in a field study of the home range of a medium-size mammal, the raccoon
dog, Nyctereutes procyonoides viverrinus.
THE TRACE RECORDER SYSTEM
Devised in 1996, the TR system consists of beacons, recording units (RU),
automatic collar release system (ACRS) and a personal computer (Fig. 1). The
fundamental unit of this system is composed of beacons and the RUs. Each
beacon, set within a study area, emits 8 kHz magnetic field modulated by 14-
bit unique serial codes and covers a range of 3m radius. When six UM-1
batteries are connected in series, a beacon can emit signals for up to six months.
At present, 600 beacon codes are distinguishable.
Collars weighing 130 g, including an RU are attached around the necks of
animals. The RU is composed of a circuit board and two CR123A lithium
batteries, which are connected in series and give the RU a working life of at
least three months. Each collar’s RU is capable of receiving 0.25 sec long
magnetic signals from a beacon at 15 sec intervals, the RU records each signal
along with the time in the unit’s static random-access memory (SRAM). The
SRAM provides a capacity of 16,000 time units. A time unit is defined as the
duration of an RU’s recording of the same signals emitted by a certain beacon ;
this is the elapsed time between an RU-fitted animal arrival within the range of
a certain beacon, and the time when it leaves the beacon’s range. RU data
recorded in the format of the following example “120 970915072015-
970915185045” indicate that a study animal remained at beacon number 120 on
15th September 1997 from 07:20:15 (hours : minutes : seconds) to 18:50: 45.
Kaneko et al., Trace Recorder for raccoon dog study 111
BADGER'S
BEACON
LATRINE
RECORDING
UNIT (RU)
AOCELLISLI (LILLIA EELS 3
MAGNETIC FIELD
Fig. 1. Schematic outlining of the Trace Recorder system. When an animal equipped with
a Recording Unit (RU) enters a beacon’s 6 m in diameter magnetic field, the RU records its
time and location. These are recorded using the beacon’s unique ID number. At the
operator’s discretion, a special code will be sent via a beacon and the RU to the Automatic
Collar Release System (ACRS) thereby releasing the collar immediately for recovery. By
using a computer system, the accumulated information is downloaded from the RU.
The time unit are accurate to within 15 sec. After recovery of the RU, the
memory is transferred to a personal computer and converted using the C
language software for MS-DOS. The real time records of an animal’s stay
within the range of each beacon can then be reconstructed.
The ACRS is installed on collars along with RUs in order to be able to
recover the stored data. When the RU receives a special code from a beacon,
it transfers a special signal to the ACRS which then releases the collar immedi-
ately. The ACRS also triggers automatically releasing the collar when bat-
tery voltage falls so as to reduce any stress involved in carrying a collar toa
minimum.
1. Animals weight
Collars with RUs attached weigh approximately 130g, varying slightly
depending on battery weight. If an acceptable upper limit to collar weight is
5% of the weight of a study animal (Kenward 1987), then this system is of use
on any animal weighing more than 2.6 kg.
2. Applicability in home range research
When this system is applied to record home ranges, it is recommended to
112 Mammal Study 23: 1998
use a method to the repeated-capture-in-traps (Jewell 1966), rather than the
usual radio-tracking method. ‘That is, many beacons should be deployed in
order to cover the home range of the animal to be examined. The number of
beacons required accuracy of the study. The larger accuracy required, the
more beacons are necessary. Using this method, the primary issue is establish-
ing where best to place beacons so that an area is thoroughly covered. If
plenty of beacons are available, this problem is easily resolved, however using
many beacons is costly more than traditional radio-telemetry. At the begin-
ning of a research project, a home range should be roughly mapped based on
detection using may be set out at core sites within the presumed home range
such as at feeding sites, setts, latrines and animal paths in order to track the
study animal(s) in detail.
APPLICATION TO HOME RANGE UTILIZATION OF A RACCOON DOG
STUDY AREA
The study area was located in Hinode Town, about 50 km west of the
center of Metropolitan Tokyo. Situated within the Pacific Ocean climate
zone, the area has a mean annual temperature of 13.2°C, and a mean precipita-
tion of 1,500mm most of which falls in summer. The area has a gentle
topography of low hills covered with plantations of Japanese cedar, Cryptomer-
1a japonica and Japanese cypress, Camaecyparis obtusa. In the shallow valley
bottoms, there are residential areas and cropland. Other similar-sized mam-
mals occurring in the study area include the badger, Meles meles anakuma, red
fox, Vulpes vulpes japonica, and masked palm civets, Paguma larvata.
Some difficulties are experienced when using current radio-telemetry tech-
nique to track animals in such areas because of the reflection of radio waves by
the mountainous topography and because of interference from amateur ham-
radio communication systems.
METHODS
A young female raccoon dog, weighed 3.5 kg, was captured with a box trap
and immobilized by ketamin hydrochloride. A collar with both an RU anda
radio-transmitter was attached to her and she was released on 16 November
1996. From two to six radio-fixes were obtained each day using standard
radio-telemetry techniques. By 28 November, a total of 18 radio-fixes had
been obtained. Using the radio-fixes and the convex polygon method, the
animal’s home range was estimated to be of about 5.9ha. On 28 November 24
beacons were installed in and around this estimated home range at a feeding
site (a garbage site) at badger setts (badger setts and resting sites of may be
sometimes used by raccoon dogs), raccoon dog latrines and along animal paths
(aie. 2),
The authors interviewed local residents about frequency of waste disposal
Kaneko et al., Trace Recorder for raccoon dog study eles;
at the garbage site in order to assess its potential significance to raccoon dogs.
Since the tracking period by current radio-telemetry techniques was short and
because the study animal was first caught outside her estimated home range, it
was presumed that she might occasionally reappear outside the estimated
range. Therefore, beacons were set at several possible sites outside the
mapped range and she was also tracked using radio-telemetry techniques. The
animal was recaptured on 23 December 1996, and data were downloaded onto
a personal computer for analysis.
The daily activity period was defined as the period between the first and
last recording beacon signals recorded each night. The non-active period was
defined as the resting period. U and f-tests were used to compare the various
activity patterns of this individual.
RESULTS AND DISCUSSION
1. Trace recorder data
The RU attached to this female raccoon dog recorded 91 time units from
nine beacons over 12 days between 28 November and 10 December 1996. Six
@ Path
A Garbage site
O Raccoon dog's latrine —
m@ Badger's sett
QO Badger's resting site
A Capture site
C) Raccoon dog's range
= Road -. River
Fig. 2. The location of 24 beacons (with their IDs) in the range of a raccoon dog as defined
by radio-telemetry between 16 and 28 Nov. 1996 in Hinode Town, Tokyo. Figures represent
beacon IDs.
114 Mammal Study 23: 1998
Table 1. Locations and lengths of stay of a raccoon dog fitted with a recording unit in
Hinode Town, Tokyo, between November 28 and 10 December 1996.
: Duration of sta Number of
Beacon site (hr : min: aye time unit Beacon ID
Pail Os 10s 15 4 i
Path Os 04500 3 2
Path Qes O24 5 8 4
Path OR00R 30 3 if
Path Os OO 2 15 1 3
Path Os Os 5 IL 8
Badger’s sett 12 WD 5 aS 8 6
Raccoon dog’s latrine 0.5 0 6 BO Z, is
Garbage site ae, Cee kG) 61 9
Total Qe 30
beacons which were not recorded by RU
badger’s resting site: 5, 19, badger’s sett: 20, 23, path: 10, 11, 12, 14, 15, 16, 17, 18, 21, 22, 24
Ne}
my
of these beacons were located along the paths, and the others were at a garbage
site, a badger’s sett and a raccoon dog’s latrine (Table 1). Eight of the nine
beacons registered by the RU were from within the home range polygon
determined by 36 radio-fixes obtained during the same period, only one beacon
outside the range polygon was registered (Fig. 3). The new home range poly-
gon obtained during the TR study slightly north of that obtained prior to the
use of the TR (see Fig. 2).
The 91 time units recorded were converted to a total of nine hours, 58 min
and 30 sec. The earliest RU time was at 17:03 on a day when sunset was at
16 : 28, and the latest was 06:24 on a day when sunrise was at 06:31. During
the nights of 7/8 December 1996, for example, her RU recorded 11 time units
from three differrent beacons (Fig. 4). On that night the study animal first
appeared walking a path at 17:09 on 7 December, she then appeared at a
garbage site, which she visited eight times between 17:12 on 7 December and
05:14 on 8 December. She stayed there 15 sec to 42 min. She made no visits
other beacons while visiting the garbage site. Finally, she appeared a badger’
s sett between 05:35 and 05: 45 on 8 December.
The TR system clearly provided a very accurate method for recording the
presence or absence at a target site.
2. Activity pattern
This raccoon dog proved to be active at night from immediately after
sunset and just before sunrise throughout the 12-day study period. She was
active for 43.3487 (SD)% (range : 33:6-73.2%, n=12) of a 24 hour pemod, and
the rested for 56.4+8.4 (SD)% (range : 46.9-72.9%, m=12). The active period
was significantly shorter than the rest period (f-test, p<0.01).
The duration of time spent at the garbage site was 6.1+7.9 (SD) % (range:
0.1-23.7%, n=12) of the activity period, and the time spent at the badger’ s sett
Was WU GaAs Ceara: 05-402, w=).
Kaneko et al., Trace Recorder for raccoon dog study NS)
=.
@ Beacon which was recorded by RU
©) Raccoon dog's range
O Raccoon dog's resting site determined
by radio telemetory
= Road “w River
Fig. 3. The location of the nine Beacons recorded by a raccoon dog’s RU and her home range
drawn by 36 fixes with ten resting sites obtained by the radio-telemetry between 28 Nov. and
10 Dec. 1996 in Hinode Town, Tokyo. Figures represent beacon IDs.
Activity patterns varied at each of the sites where she was recorded (Fig.
9). Analyzing the data asa percentage of the total time spent at the badger’s
sett was divided into hourly intervals at the garbage site, the first peak in
activity was from 18: 00-19: 00, and again 22:00 and 02:00. Inthe earlymorn-
ing, she made fewer visits to the garbage site. The percentage of time spent on
paths reached a plateau between 21: 00 and 03:00 with two troughs. The time
spent at the badger’s sett peaked between 05:00 and 07:00. Thus, it seems
that this female raccoon dog first visited the garbage site, then walked through
paths and visiting the garbage site again, and finally visited a badger’s sett.
The TR system allows the collection of 24 hour-census data of target sites.
Whereas when we used the radio-telemetry in Hinode Town, we had to watch
and check the activity record on the recorder chart continuously because of
noise from amateur ham-radio communication. Thus, the TR system saves
considerable labor cost.
Beacon Site |Beacon ID Time of Day (hours)
17 22 23 )
Path
Garbage site
Badger's sett
Fig. 4. An example of time units from the RU on the night of 7/8 Dec. 1996 in Hinode Town,
Tokyo. Beacon ID 1, 2, 3, 7, 8 (path) and 13 (latrine) were not recorded.
116 Mammal Study 23: 1998
60 BADGER'S SETT
50
40
30
GARBAGE SITE
20
PERCENTAGE OF TOTAL DURATION OF STAY
15 18 21 24 3 6 9
TIME OF DAY (HOURS)
Fig. 5. Activity pattern of a female raccoon dog at target sites based on data from the Trace
Recorder system in Hinode Town, Tokyo between 28 Nov. and 10 Dec. 1996.
3. Target site usage patterns
Visits to the garbage site were made intermittently, but every day between
28 November and 10 December 1996 (Fig. 6) with an average of 4.7+3.9 (SD)
visits per day (range: 1-14, n=12), lasting on average §.3+12.1 (SD) min per
visit (range: 15-54 min, ~=61). Three peaks were found at intervals of a few
days during 12-day study period coinciding with when kitchen waste was
disposed of at the site. ~The animal seemed to stay at the garbage site in order
to search for food for significantly longer total periods on waste disposal days
(112.9+ 47.5 (SD) min, ~=4), than on non waste days (6.65.6 (SD) min, 7=8,
U-test, p<0.01). If she found no food, she left the garbage site after a short
stay of 15 sec to just a few minutes.
At the end of her period of nocturnal activity, she visited the same badger’s
sett eight times on 8 of the 12 days (Fig. 7). She did not visit the sett on four
mornings (3, 4,5 and 9 December). Her visits to the badger’s sett were usually
short (8.5+4.3 (SD) min, range: 3.0-16.5 min, ~=8). She was presumed to be
looking for an opportunity to use the badger’s sett as a resting site, but was
unable to do because the sett was in use year-round by an adult female badger
(Kaneko unpubl.).
For recording frequency, duration and time of the visit of an animal to
target sites and places within a core area, the new TR system is more accurate
than the current radio-telemetry systems. In particular, it is very useful in the
study of short-term activity. Using the TR system in this study revealed that
a female raccoon dog frequently checked the resources available to her such as
a garbage site and a badger’s sett. In the study area, an interval of radio-
fixing may be around 15 min may be shortest, which is impossible for the
current radio-telemetry to obtain the same accuracy. Furthermore, the new
TR system greatly reduces the number of participants required to obtain data.
Kaneko et al., Trace Recorder for raccoon dog study Hl
min. average range
60
DURATION OF STAY
w
.o)
28 29 30 #1 2 3 4 5 6 7 8 SO
November —k— December
DATE
Fig.6. The length of visits to the garbage site each night between 17:00 to 05:00 by a
raccoon dog in Hinode Town, Tokyo between 28 Nov. and 10 Dec. 1996. Each figure on the
vertical bar indicates the number of visits.
4. Detection of the opportunistic resting site
Radio-telemetry revealed that the study animal used ten resting sites in the
rough proximity of badger’s sett (Fig. 3). A careful search of the areas indicat-
ed by radio-telemetry, however, revealed no dens, and suggested that the study
animal slept directly on the ground with or without cover. Eight of the ten
resting sites were situated among bushes, one was located under a huge rock,
and one was on a footpath on the shoulder of a mountain.
In conclusion, in this preliminary trial of the applicability of the TR system
to wild animal studies, neither the number nor the density of beacons were
taken into consideration. For the future development of this system and the
methodology of its use, a spatial approach will be taken. It will be best to
DURATION OF STAY
0)
ZO Tee 30). cli: 529 OS a D6 i. = birt ager 10
November —pid-— December
DATE
Fig. 7. Visits to a badger’s sett by female raccoon dog in Hinode Town, Tokyo between 28
Nov. and 10 Dec. 1996. (Only one visit was made per day.)
118 Mammal Study 23: 1998
devise a grid system that will effectively cover the suspected home range of the
study animals. The working period of the RU needs to be decided as does the
best distance between the points of the grid in relation to animal home range
size. In addition to its advantages over current radio-telemetry techniques, a
further advantage of the TR system over the grid trapping system is that it is
less stressful to the study animals because they need only be trapped once.
Acknowledgment : We thank Mr Satoshi Ohori and Ms Sachiko Saito of the
Natural Environmental Research Laboratory, Waseda University and Ms
Yuko Fukue at Tokyo Noko University for their great help in preliminary
experiments of the Trace Recorder. We also appreciate Mr Eiji Kanda of
Tokyo Wildlife Research Center for his assistance with field work in Hinode
Town. We gratefully acknowledge the support of the Tokyu Foundation
which funded the Trace Recorder system, and the Toyota Foundation for the
field materials.
REFERENCES
Amlaner Jr, C. J.1991. Wildlife biotelemetry and radio tracking after several decades of electronics
evolution.Jn (Uchiyama, A and C. J. Amlaner Jr. eds.) Biotelemetry XI. 9-16, Waseda Univer-
sity Press. Tokyo.
Doi, A. 1985. Present status and future of the telemetry. Report of the Society of the Japan
Population Ecology. 40 : 35-41.
Ikeda, H.1985. Radio tracking on mammals in Japan. Jv (Kawamichi, T. ed.) Contemporary
Mammalogy in China and Japan. Pp. 191-194. Mammalogical Society in Japan.
Ito, Y. 1992. Social structure and habitat utilization of the Japanese badger in HinodeTown, Tokyo.
Master Thesis of Tokyo Noko University. 79pp (in Japanese).
Jewell, P. A. 1966. The concept of home range in mammals. Symposium of Zoological Society of
London. 18 : 85-109.
Kenward, R. 1987. Wildlife Radio Tagging. Academic Press, London. 222pp.
Mech, L. D. 1983. Handbook of Animal Radio-tracking. University of Minnesota Press, USA.
107pp.
Nakazono, T.1989. The habitat utilization pattern of Japanese red fox, Vulpes vulpes japonica, in
Kyusyu. Honyurui Kagaku (Mammalian Science) 29:51-62. (in Japanese with English
abstract)
Sasaki, H. 1994, Ecological Study of the Siberian weasel Mustera sibirica coreana related to habitat
preference and spacing pattern. Ph.D Thesis of the Kyushu University, 5lpp.
Suzuki, T., Y. Kaneko, O. Atoda, N. Maruyama, M. Tomisawa and N. Kanzaki. (in press) Existence
detection by on-off code of magnetic dipole field and its use in recording small wild animal’s
behavior. Transactions of the Society of Instrumental and Control Engineers, Tokyo (in
Japanese with English abstract).
Tatara, M.1994. Social System and Habitat Ecology of the Japanese Marten Martes melampus
tsuensis on the Islands of Tsushima. Ph.D Thesis of the Kyushu University, 79pp.
Yamamoto, Y. 1995, Home range and dispersal of the raccoon dog (Nyctereutes procyonotdes
viverrinus) in Mt. Nyugasa, Nagano prefecture. Japan. Nat. Envir. Sci. Res.7:53-61 (in
Japanese with English abstract).
Yoneda, M. and T. Iwano. 1988. A wildlife tracking system using the digital-code transmitter and
the auto azimuth finder. Honyurui Kagaku (Mammalian Science) 28 : 23-37 (in Japanese with
English abstract).
(accepted 27 November 1998)
Mammal Study 23: 119-122 (1998)
© the Mammalogical Society of Japan
Short Communication
Measurements of the nasal sacs of individual common
dolphin, Delphinus delphis, and Dall’s porpoise,
Phocoenoides dalli, by means of silicon
reconstruction
Koji NAKAMURA!, Tadasu K. YAMADA? and Kenji SHIMAZAKI'
1 Division of Marine Ecology, Research Institute of North Pacific Fisheries, Faculty of Fisheries,
Hokkaido University, 1-1, Minatocho 3-chome, Hakodate, Hokkaido 041-8861, Japan
Fax: +81-138-40-8860, e-mail: porpoise @ pop. fish. hokudai. ac. jp
2 Division of Mammals and Birds, Department of Zoology, National Science Museum, 3-23-1
Hyakunin-cho, Shinjuku-ku, Tokyo 169-0073, Japan
The toothed whales produce a wide range of species specific sounds with great
differences between certain families. The acoustic characteristics of the
echolocation sounds produced by the Phocoenidae and the Delphinidae are
especially different (Kamminga ef al. 1996). That of the delphinid common
dolphin, Delphinus delphis, for example, is a broad-band, high-frequency sound
of short duration; the peak frequency range is 20-100 kHz, and the signal
duration range is 50-150 ws (Evans 1973). In contrast, the echolocation signal
of the phocoenid Dall’s porpoise, Phocoenoides dalli, is a narrow-band, high-
frequency sound of long duration; the peak frequency range is 120-160 kHz,
and the signal duration range is 180-400 ws (Awbrey et al.1979, Hatakeyama
and Soeda 1990).
The physical properties of the sounds produced by toothed whales are
directly affected by the morphological characteristics of the air space in the
head and by the sound-production mechanism (Aroyan eft al. 1992). In order to
understand how sounds are produced, and why there are such different acoustic
characteristics between families, detailed information about the shape and
volume of the air spaces is needed. In this paper, we describe a new experimen-
tal technique making it possible to obtain this information.
We used a silicon injection technique in order to determine the shape and
dimensions of the air spaces in the nasal sacs of individual common dolphin and
Dall’s porpoise. Two specimens, one common dolphin (male, B. L.=157 cm,
M30116, National Science Museum, Tokyo) and one Dall’s porpoise (sex and B.
L. unknown, collected at Otsuchi, Japan) were examined. The heads of both
Specimens were frozen before examination. Prior to injecting silicon, the
larynx and the surrounding muscle complex of each animal was removed and
the head was turned upside down. We then poured 200 ml of KE12 silicon
(Shin-etsukagaku Kogyo Co., Tokyo, Japan) into the bony nares and kept the
heads in position for eight hours. KE12 silicon is relatively tough, polymerises
120 Mammal Study 23: 1998
at room temperature when mixed with one or more catalysts and solidifies after
approximately eight hours at 25°C.
The silicon is prevented from entering the air space between the external
nares and the blowhole by the nasal plug muscle. This muscle originates
chiefly on the premaxilla anterior to the premaxillary sac with a few fibers
arising in the connective tissue band along the margin of the premaxilla lateral
to the sac (Lawrence and Schevill 1956).
Following solidification of the silicon, the heads were returned to their
natural position with the blowhole pointing upwards in order to reconstruct the
air space between the external nares and the blowhole. This was done by
injecting 100 ml of silicon into the blowhole using a 200-ml plastic syringe with
a surgical tube inserted 2-3 cm into the nasal passage. Air in the deep nasal
sac was ejected by the pressure of the fluid silicon passing through the blow-
hole. ‘This second injection of silicon was also allowed to harden for eight
hours at room temperature. The hardened silicon was finally removed by
dissecting the heads.
Examination of the silicon cast of the nasal sacs of the common dolphin
specimen (see Fig. 1) revealed that the left vestibular sac measured 3.5 cm along
the anterior-posterior axis, and 2.9cm transversely, whereas the right ves-
tibular sac measured 4.0cm by 3.5cm. The anterior nasofrontal sac was 4.0
cm long, and the posterior nasofrontal sac 3.8cmlong. Eight small diverticula
were found between the anterior and posterior nasofrontal sacs. The right
accessory sac was 2.2cm long. The premaxillary sacs were measured 6.3 cm
by 2.5 cm (left), and 8.0 cm by 4.7 cm (right). Silicon was not injected into the
left nasofrontal sac. The total volume of the nasal air space of this individual
common dolphin was found to be 33.3 cm‘.
Examination of the silicon cast of the nasal sacs of the Dall’s porpoise
specimen (see Fig. 2) revealed that the left vestibular sac measured 4.5 cm along
the anterior-posterior axis and 4.2 cm transversely, and that the right vestibular
sac measured 7.5cm by 5.2cm. The left premaxillary sac measured 4.5cm
along the anterior-posterior axis and 2.4cm transversely, whereas the right
premaxillary sac measured 3.5cm by 2.3cm. Silicon was not injected into the
nasofrontal sac or the posterior nasal sac. The volume of the nasal air space
of this individual Dall’s porpoise was found to be 61.5cm*. The silicon injec-
tion technique proved an effective way of examining the nasal air spaces in two
different species of odontocetes, and revealed that the Dall’s porpoise has
almost twice the volume of nasal air space, and larger vestibular sacs than the
common dolphin.
The results from two-dimensional computer modelling suggest that the
source of echolocation signals may be the dorsal burse below the vestibular
sacs (Aroyan et al. 1992). Furthermore, in order to understand why different
toothed whale families produce sounds with different physical characteristics,
detailed measurements of the air spaces in their heads are needed. Reconstruc-
tion of the air spaces in the heads of odontocetes using silicon facilitates the
detailed measurement of both the shape and volume of spaces such as the small
Nakamura et al., Nasal sac of common dolphin Wl
Left vestibular sac
ht nee eontal sac
== ramaxillary sac
Fig. 1. Silicon reconstruction on the nasal sacs on a common dolphin skull. Skull width
(Zygomatic width)=16.9cm. Skull length (Condylobasal length) = 41.3 cm.
Right vestiluenikyle \Kaimuentibular sac
Fig. 2. Silicon reconstruction on the nasal sacs on a Dall’s porpoise skull. Skull width
(Zygomatic width)=18.6 cm. Skull length (Condylobasal length) =33.5 cm.
22 Mammal Study 23: 1998
nasofrontal diverticula, and this technique may prove valuable in studies of
sound production. In recent years, new medical imaging techniques such as
x-ray computed tomography (CT) and magnetic resonance imaging (MRI) have
been used to describe the internal details of the foreheads of toothed whales
(Cranford 1988, Amundin and Cranford 1990, Amundin 1991, Cranford ef al.
1996). Future research into the sound production mechanisms of odontocetes
may benefit from incorporating both silicon reconstruction of nasal regions and
CT and MRI medical imaging techniques along with three-dimensional com-
puter modelling.
Acknowledgments : We thank Dr Toshiro Kamiya of the Medical Section, The
University Museum, The University of Tokyo, and Dr Yutaka Yoshida of the
Medical Museum Medical Department, The University of Tokyo, for their
advice and co-operation. We are obliged to Dr Masao Amano of the Otsuchi
Marine Research Center, Ocean Research Institute, The University of Tokyo,
and Ms Azusa Amano of the Department of Zoology, Faculty of Science, Kyoto
University, for their kind help in acquiring the Dall’s porpoise head. Dr John
R. Bower of the Division of Marine Ecology, Research Institute of North
Pacific Fisheries, Hokkaido University, kindly reviewed the manuscript.
REFERENCES
Amundin, M.1991. Sound production in odontocetes with emphasis on The harbour porpoise
Phocoena phocoena. Ph.D. dissertation, University of Stockholm, 128 pp.
Amundin, M. and T. W. Cranford. 1990. Forehead anatomy of Phocoena phocoena and Cephalorhyn-
chus commersoni : 3-dimensional computer reconstruction with emphasis on the nasal diver-
ticula. Jn (Thomas, J. A. and R. A. Kastelein, eds.) Sensory Abilities of Cetaceans : Labora-
tory and Field Evidence. pp. 1—18. Plenum Press, N. Y.
Aroyan, J.L., T. W. Cranford, J. Kent, K.S. Norris. 1992. Computer modelling of acoustic beam
formation in Delphinus delphis. J. Acoust. Soc. Am. 92, 5: 2539—2545.
Awbrey, F. T., J.C. Norris, A. B. Hubbard, and W.E. Evans. 1979. The bioacoustics of the Dall’s
porpoise-salmon net interaction. Hubbs Sea World Research Institute Technical Report, 79—
1,0)
Cranford, T. W. 1988. The anatomy of acoustic structures in the spinner dolphin forehead as shown
by x-ray computed tomography and computer graphics. Ju (Nachigall, P.E.and P. W.B.
Moore, eds.) Animal Sonar: Processes and Performance. pp.67—77. Plenum Press, N.Y.
Cranford, T. W., M. Amundin, and K.S. Norris. 1996. Functional morphology and homology in the
odontocete nasal complex : Implications for sound generation. J. Morphology 228 : 223—285.
Evans, W. E. 1973. Echolocation by marine delphinids and one species of fresh-water dolphin. J.
Acoust. Soc. Am. 54, 1: 191—199.
Hatakeyama, Y. and H. Soeda. 1990. Studies on echolocation of porpoises taken in salmon gillnet
fisheries. Jn (J. A. Thomas and R. A. Kastelein,eds.) Sensory Abilities of Cetaceans: Labora-
tory and Field Evidence. pp. 269—282. Plenum Press, N. Y.
Kamminga, C., A.C. Stuart, and G. K. Silber. 1996. Investigations on cetacean sonar XI: Intrinsic
comparison of the wave shapes of some members of the Phocoenidae family. Aquatic
MEIC ZZ, je 4555.
Lawrence, B., and Schevill, W. E. 1956. The functional anatomy of the delphinid nose. Bull. Mus.
Comp) ZoolmiAal0 Se alea ile
(accepted 26 May 1998)
Mammal Study 23: 123-127 (1998)
© the Mammalogical Society of Japan
Short Communication
Bark-stripping of tankan orange, Citrus tankan, by
the roof rat, Rattus rattus, on Amami Oshima Island,
southern Japan
Tatsuo YABE
Kanagawa Prefectural Public Health Laboratories, Asahi-ku, Yokohama, 241-0815, Japan
MAX Ole At 0s= LUST
In 1997, roof rats, Rattus rattus, damaged the bark of cultivated tankan orange,
Citrus tankan Hayata, trees over a wide area of the central part of Amami
Oshima, an island in the Nansei Shoto archipelago of southern Japan. ‘This
was the first time that tankan farmers had experienced such damage in more
than 30 years of cultivation of the fruit. At first, it was believed that the
introduced mongoose, Herpestes sp., had damaged the trees, but later, from the
appearance of the tooth marks on the trees, it was surmised that the rats were
responsible. The damage which occurred from early April until early October
1997 was found in an area where other potential mammalian culprits such as R.
norvegicus, Tokudaia osimensis and Diplothrix legata were known to be absent.
Bark-stripping by FR. vattus has been reported elsewhere (e. g., Maeda 1982,
1985, Santini 1987), but has not previously involved the tankan orange, making
the damage caused on Amami Oshima Island notable. In this paper the
bark-stripping activity of the roof rat is described, and the data on their
movements around a tankan orchard, their food habits and their age composi-
tion are examined.
STUDY AREA AND MOTHODS
Amami Oshima Island is a 712 km? island situated at 28°10-30’ N, 129°10-45’
E (Fig.1). It is situated in the sub-tropical zone, and has a warm, humid
climate with mean monthly temperatures ranging from a low of 14.2°C in
January to a high of 28.4°C in July and an annual mean temperature of 21.3°C.
Rainfall amounts to 2,871 mm a year.
In mid-September 1997, I carried out a study in a tankan orchard where
severe damage occurred (Fig.1). The orchard situated in the Naze City
administrative district had a total area of about 1.2 ha, which was divided into
several plots by woods composed of evergreens such as Castanopsis cuspidata,
Symplocos spp., Melia azedarach and Pinus luchuensis.
Rats were studied by trapping and tracking. They were captured in 29
live traps set for one night at 3-5m intervals along the edge of a wood that
faced an orchard plot of about 400m’. They were tracked using fluorescent
124 Mammal Study 23: 1998
(y / Kyushu
325mg
é
a (
23° KR ¥ 2
129° 130°E
Fig. 1. Amami Oshima Island, showing the study site (asterisk) and the approximate area
including Naze City, Yamato Village and Sumiyo Village, where bark-stripping by rats
occurred (shaded).
pigments following the method described by Lemen and Freeman (1985).
Trapped rats were put into bags containing fluorescent pigments, gently shaken
and released in the morning. During the following night, from circa 23: 00
onwards, their trails were detected with a 4W UV-lantern.
Ninety snap traps were also set for one night at 3-5 m intervals along the
same woodland/orchard boundary near where the live traps had been set.
Snap traps were baited with sweet potatoes covered with peanut butter and
honey. Specimens were dissected in the laboratory, and their stomachs were
removed for closer examination under a stereoscopic microscope following the
method by Yabe (1979). The volume that different food items contributed to
each stomach’s contents (excluding bait) was estimated, and the mean volume
of each food item was calculated for all stomachs examined. Rats were aged
on the basis of their eye-lens weights using Tanikawa’s formula (Tanikawa
1993), and individuals three months of age or older were defined as adults.
RESULTS AND DISCUSSION
Bark-stripping by rats has previously been reported from both Europe and
Yabe, Bark-stripping by roof rat 125
Southeast Asia. In Central Italy, the roof rat was considered to be responsible
for heavy bark-stripping activity on Pittosporum tobira shrubs in urban parks
(Santini 1987), although the reason for the activity remained uncertain. Maeda
(1982, 1985) reported bark-stripping of ipil-ipil, Lewcaena leucocephala, trees by
R. vattus mindanensis, although in my opinion the species was identified errone-
ously given that the specimens collected had white tipped tails and weighed 250
-400 g, characteristics typical of R. everetti, not R. rattus.
In Amami Oshima Island, I confirmed that the species de-barking tankan
trees was the roof rat by finding their tooth marks on trees, their hairs in feces
found below trees as well as by direct trapping. The rats stripped bark mainly
from near the bases of the trunks of young trees less than five years old and
from the branches of older trees. Most of the damaged trees were completely
girdled (Fig.2A). The damage extended to all parts of the orchard surveyed,
even to trees at the center, some 20 m from the nearest forest edge.
Tracking of two rats dusted with fluorescent pigments revealed that they
had moved about 15-20 m through the woods along the edge of the tankan
orchard before turning into the orchard and attacking the tankan trees about
5-8m inside. The tankan orchard apparently provided the rats with little
shelters because there were no ground cover, whereas the surrounding woods
probably provided shelter, preferred runways, as well as foods such as acorns.
A total of 21 rats (18 females and 3 males) were collected over 90 trap-
nights around the tankan orchard. Seventeen of the 18 females were adult, but
Fig. 2. Bark-stripping of tankan orange, Citrus tankan, trees (A), and tooth marks on the
inside of fallen bark chips (B).
126 Mammal Study 23: 1998
Table 1. Age composition of roof rats trapped around a tankan orchard.
No. of individuals
Ee auever gly Males Females Total
2 0 1 1
3 0 0 0
4 0 2 Z
5 0) 1 if
6 1 0) 1
7 0) 4 4
8 if 3 4
9 0 3 3
10 0) 0 0
11 0 1 1
S17 I 3 4
Total 8 18 val
none were pregnant. The majority of individuals (52%, 11 of 21) were 7-9
months old (see Table 1) indicating that a major breeding season had lasted
from December 1996 to February 1997. S. Hattori (pers.comm.) was of the
opinion that the roof rat population had exploded during the previous winter
owing to a heavy crop of acorns.
Tankan phloem, which was identified by the characteristic sieve areas of
the tissue, was found in two (11%) out of 18 stomachs examined, however, no
trace of outer bark was found in those stomachs. Tooth marks left on the
inside of the bark chips clearly indicated that rats chewed the phloem contained
in the bark chips as well as on the tree surface (Fig. 2B). The fact that rat
feces were filled with phloem fibers indicated that they digested phloem incom-
pletely, and presumably absorbed only the sap. Seeds and fruits accounted for
30.1% of the stomach contents in volume, and phloem accounted for 8.9%
(Fig. 3):
Seeds
and Fruits
30.1 %
and Stalks
9.7 %
Unknown 7.2 °, Tankan Phioem 89 ‘%%
Fig. 3. The stomach contents of roof rats in Amami Oshima Island.
Yabe, Bark-stripping by roof rat Mail
The preferred diet of the roof rat has been shown to consist of seeds and
fruits in general (Yabe 1979), although it will switch to more succulent foods
such as herb stems in order to obtain moisture (Yabe 1982). Stomach analysis
of specimens trapped during this study confirmed that seeds and fruits were
primary food source of the roof rats, and showed that phloem was at most a
supplementary, not a substitute food source. I conclude that roof rats stripped
the bark of the tankan orange trees to obtain the sap in the phloem. The
reason for this activity remains uncertain, though they may have involved
accessing extra moisture and/or extra nutrients.
Acknowledgments : | am indebted to members of the Kagoshima Prefectural
Government, the Naze Municipal Government, and the Yamato Village Munici-
pal Government for their kind help during the field work.
REFERENCES
Lemen, C. A. and P. W. Freeman. 1985. Tracking mammals with fluorescent pigments: a new tech-
nique. J. Mammal. 66: 134—136.
Maeda, M. 1982. Tree damage by the roof rat (Rattus vattus mindanensis) in the northern area of
Mindanao. Monthly Bull. Overseas Agric. Dev. News 82: 15—27 (in Japanese).
Maeda, M. 1985. Rat control in an ipil-ipil plantation in Mindanao, the Philippines. Monthly Bull.
Overseas Agric. Dev. News 107: 12—17 (in Japanese).
Santini, L. A. 1987. Rodent debarking activity in urban and natural parks of central Italy : progress
towards integrated control strategies. Ju (Richards , C.G.J and T. Y. Ku, eds.) Control of
Mammal Pests. pp.55—64. Taylor & Francis, London.
Tanikawa, T. 1993. An eye lens weight curve for determining age in black rats, Rattus rattus. J.
Mammal. Soc. Japan 18: 49—51.
Yabe, T. 1979. The relation of food habits to the ecological distributions of the Norway rat (Rattus
norvegicus) and the roof rat (RF. vattus). Jpn. J. Ecol. 29: 235—244.
Yabe, T. 1982. Habitats and habits of the roof rat Rattus rattus on Torishima, the Izu Islands. J.
Mammal. Soc. Japan 9 : 20—24.
(accepted 10 August 1998)
A
hi
Be sy
. )
is
at MD ast 7
ae OF Pas
erg
= - a -
n
- pn
fa
_ Y
as
}
5 oe
noe v
——
a
5 4
‘ —
=) 5
e
4
oes
f5 §
ay Ba D)
my
Do
= x
Sey
~
$y
ee 1
ie .
3
2
i
)
; Z
eh;
4
>
]
ie
r i
i
v
>
p= \
4
co)
J
e Ai sad Menttiaciiah “pitt %
i ' in
3 ata? en. &
. were
Haye : inion hi.
1s
ryaeate)
E aah geiko dee doula nil one
a.
i wee oe )
incu apallt vette ¢ welt Bets, ‘ f
| niieee tei
ne eee OW bisa fly sian gee
Ye piece ain J hem tita ion ni hae i foal ” t
coe
Ba bar pens i
a, Fay
ahi viawig
7
‘4.
tees
ZA
2 sf ng ay.
i
ne
\;
eiehe '
Gain drat it My Olea rie dative dase, onntacen <
Be tives NGC HLT MIT? Vt (Be atc =i Ois wR a watt shgé posucs hit har
pence wiitete nahi ts orn eae ny
Oates aan acs Lh Et aie oe
Mr 18g sie rae a at vive
a
os |
=
£
>
".
rire lanai: } ie
6 ‘ahretts Ais)
Ny ; ty pe
y SNS Ls NOUR ERB way wd
S61 belie seni
2
ic
evita
.
nea AN
u > jee : yi ey ies i 4 bs
i ete a ‘aa iar alk es ey ee aes |
LEP ees oa Bay iW wees oi oe te hte Tae (ay eae
cies . i + AS ae Ant age ae e
, ne \ ae ¢ Vs Pony | Bt
a ; ah ane ior. « Aod of oy ee fe: sli. 3
ie, a 4 1 *
4 ( - rite E , “454.2 aA { ie
7 eat 5d | 5 Rat TEL TG 2 Ly USI. ewes k Ps
i / pe i ns : Uae ;
a ” ‘f
} : ~ ~ c
4 my —
(ere ; a
s 1 I ( er Lies
= ia (Wien
l j “het F e i
tanh Faby with Vi) ee
rig Fi aie ee % y NK ’
hits ~ ls ae ay {
rs i sd 4 i
) ~
5 iy AuPty i 5
Tiss
~ =A oad a,
— 7 s eal .
= =, ia os 7 . >
} ‘ ¥ i ne SY
z uf aes ¥ Ye ‘<_ oe
Nr ee Ke
j f, ;
~ a 3 > % Ss %
i : . ee ;
i. i 5 ~ = =ae ec
F ‘
ho
y
i fe 62
}
ne a \
4 7 s ‘ s a - n
. f i
= 4 j 5 No ¢ A
J
— < “ly 4% ”
j . a BS ee s
’ < See i
4
a ; -
(les
ul 3
Fa ~
x
ic i)
t a
Mammal Study 23: 129-132 (1998)
© the Mammalogical Society of Japan
Short Communication
The structure of the pawpad lamellae of four Rattus
species
Tatsuo YABE', Puangtong BOONSONG? and Sermsakdi HONGNARK*’
1 Kanagawa Prefectural Public Health Laboratories, Asahi-ku, Yokohama 241-0815, Japan
Dake wols45=309 1037
2 Entomology and Zoology Division, Department of Agriculture, P.O. Box 9-34, Bangkok 10900,
Thailand
The structure and function of the pawpad lamellae of Rattus species relate
directly to their behavior (Brooks and Rowe 1987). Thus the pawpads of
climbing species such as the roof rat, R. vattus, have evolved numerous lamellae
to provide better gripping and clinging power, whereas digging species such as
the Norway rat, R. norvegicus, have smooth pawpads. Pawpads have only
been described previously, however, as either finely lamellated or nearly
smooth (Musser 1973, Marshall 1977, Corbet and Hill 1992), and no detailed
studies of the structure of the lamellae have been carried out. In this paper, we
describe the histological features of the lamellae and relate them to the differ-
ing behaviors of two climbing Rattus species (R. vattus and the Polynesian rat,
Rk. exulans) and two digging species (the ricefield rat, R. avgentiventer and R.
norvegicus).
MATERIALS AND METHODS
Specimens of FR. vattus and R. norvegicus from Japan, and of R. exulans and
R. argentiventer from Indonesia and Thailand were used in this study. The
majority of these specimens were laboratory reared in Miyazaki Medical
College and Ikari Corporation with the remainder killed just after capture in
fields or buildings.
The largest pawpads were those of the outer metatarsals so these were
removed for lamellar analysis. Pawpads were surgically excised, fixed in 10%
formalin, washed in tap water and dehydrated in a graded series of ethanol.
Specimens were then immersed in isoamy] acetate and dried with liquid CO, in
a critical point dryer. They were mounted on a scanning peg using a piece of
conductive tape coated to 30 nm with gold-palladium in a DC sputtering appara-
tus, and observed at 10kV in a JSM 5400LV scanning electron microscope
(SEM). Microscopic photographs were taken at a magnification of 100.
Histological preparations were made from pads fixed in 10% formalin.
The fixed pads were removed from the hind feet and embedded in paraffin
using standard histological procedures. The pads were cut into serial sections
130 Mammal Study 23: 1998
vertical to the lamellae at 8-10 um intervals and stained with hematoxylin-
eosin. One serial section from the middle part of the pad was selected for
detailed examination and measurements. The height and width of the lamel-
lae were measured with an ocular micrometer. The image was then projected
onto a screen and the angle of the lamellae was measured with a protractor.
The maximum height of the stratum corneum was defined as Ch, the maximum
width of lamellae as Lw, and the average angle of 10 pits on corneous, lucid or
granular layers as @ in radians (Fig. 1). Because the pits on the corneous layer
were often split, those on the lucid or granular layers were more suitable for
measuring angles from. The lamellae on the front of the pawpads were
excluded from these measurements because they often had irregular pit angles,
width and height. Values of Ch, Lw and 6 from 10 specimens were averaged
for each species. Statistical analyses of these values were made by using the
Kruskal-Wallis analysis of variance of ranks followed by the Tukey test.
RESULTS AND DISCUSSION
Among mammals, the pattern of the peculiar outer surface of the corneous
layer is generally affected by the lower epidermal layers and the dermis (So-
kolov 1982). The four species of Rattus also have lamellae consisting of a
Superior corneous layer (stratum corneum) parallel to the underlying lucid
(stratum lucidum) and the granular (stratum granulosum) layers (Fig. 1). Pit
angles from the lucid or granular layers could therefore be substituted for those
from the corneous layer. Keratin plates of the corneous layer were found to be
arranged in columns as was suggested by Sokolov (1982), and each lamella was
distinguishable in the columns.
Both histological sections and SEM photographs showed that whereas RK.
vattus and R. exulans had extemely-developed lamellae, R. avgentiventer had
moderately-developed lamellae and R. norvegicus had only poorly-developed
lamellae (Figs. 1 and 2, Table 1). The Kruskal-Wallis analysis of the four
species revealed significant differences among them in Ch (d.f.=3, corrected
H =11.0, corrected p<0.05), Lw (ad.f.=3, corrected H =18.5, corrected p<0.01),
and 6 (d.f.=3, corrected H =31.6, corrected p<0.01). The Tukey tests showed
that FR. vattus had significantly greater Ch’s than the three other species
(Studentized range Q=3.80, d.f.=36, number of treatments a@=4, p=0.05,
significant difference D=81.4), while R. norvegicus had significantly greater
Lw’s than those of the other species (Q=3.80, d.f. = 36, a=4, p=0.05, D =30.5).
The mean pit angles (@) were in the order: R. vattus=R. exulans> R. ar-
gentiventer > R. norvegicus (Q=3.80, d.f.=36, a=4, p=—0.05, D=0.32), which
confirmed the observations made with the SEM.
Musser (1973) had noted that the pawpads of digging Rattus species were
flush, whereas those of good climbers such as FR. vattus protruded from the sole.
This study has confirmed that the prominent pawpads of R. vattus are due to
the thick corneous layer. It appears therefore that among Rattus spp. good
climbers have prominent pawpads or a thick corneous layer as well as finely
131
Structure of pawpad lamellae (100) of (A) Rattus rattus, (B) R. exulans, (C) R.
Yabe et al., Rattus pawpad lamellae
Fig. 1.
cus, showing measurements taken.
. norvegicus
argentiventer and (D) R
The scale indicates 100
height of
stratum lucidum, Ch
angle of pit on lucid or granular layers.
stratum corneum, SG: stratum granulosum, SL:
SC
corneous layer, Lw
yum.
dth of lamella, @
wi
The scale indicates 100 um.
SEM photographs (x 100) of pawpad lamellae of (A) Rattus vattus, (B) R. exulans, (C)
. norvegicus.
R. argentiventer and (D) R
Fig. 2.
32 Mammal Study 23: 1998
Table 1. Maximum height of corneous layer (Ch), maximum width of lamellae (Lw), and
average pit angle between lamellae (6) of the pawpads of four Rattus species.
(laae SID) Lw+SD Dae So,
Species ue (um) (um) (radian)
R. rattus 10 S03 26 13" Sifae ZI I OGae0). 17
R. exulans 10 200 +67 ABE Zl 1.08+0.16
R. argentiventer 10 20345 1534 20 Ee sae). 35°
R. norvegicus 10 216 == 69 IS az 32" Za Oo== OMe
* Significantly larger than the others except “b” in the same column; ° significantly larger
than “a” (Tukey test, =0.05).
lamellated pawpads. These finely lamellated pawpads have steep lamellar
pits and narrow lamellae: the steeper the lamellar pits and the narrower the
lamellae, the more grip they provide for clinging or climbing.
In conclusion, our examination of the histological features of Rattus
pawpad lamellae has shown that they differ in structure corresponding with the
behavior of the species. The pawpads of digging species such as Rk. norvegicus
are characterized by a thin corneous layer, shallow lamellar pits and broad
lamellae. In contrast, the pawpads of climbing species such as R. vattus are
characterized by a thick corneous layer, steep lamellar pits and narrow lamel-
lae.
Acknowledgments : We are particularly grateful to: Dr Kimiyuki Tsuchiya of
Miyazaki Medical College, Mr Mongkol Chenchittikul of the Department of
Medical Sciences of Thailand, Ms Piyanee Nookarn of the Department of
Agriculture of Thailand and Dr Tsutomu Tanikawa of the Ikari Corporation
for supplying us with rodent specimens, Mr Shin-ichi Ishiwata of Kanagawa
Environmental Research Center for helping us with the operation of the SEM.
REFERENCES
Brooks, J.E.and F. P. Rowe. 1987. Commensal Rodent Control. World Health Organization,
Vector Biology Control Division, Geneva, 107 pp.
Corbet, G. B. and J. E. Hill. 1992. The Mammals of the Indomalayan Region: A Systematic Review.
Natural History Museum Publications, Oxford University Press, Oxford, 488 pp.
Marshall, J. T., Jr. 1977. Family Muridae. Jn (Lekagul, B. and J. A. McNeely, eds.) Mammals of
Thailand. pp.397—487. Association for the Conservation of Wildlife, Bangkok.
Musser, G.G.1973. Zoogeographical significance of the ricefield rat, Rattus argentiventer, on
Celebes and New Guinea and the identity of Rattus pesticulus. Amer. Mus. Novitates 2511: 1—
30.
Sokolov, V. E. 1982. Mammal Skin. University of California Press, Berkeley, 695 pp.
(accepted 3 September 1998)
Mammal Study 23
© the Mammalogical Society of Japan 133
Editor’s Acknowledgments
The current editorial board has been responsible for editing Mammal Study
volumes 21-23. I, and the other members of the board, would like to thank
those people listed below who have reviewed manuscripts between January
1996 and December 1998. Special thanks are due to Dr Mark Brazil who has
contributed enthusiastically by improving the readability of the journal. We
also appreciate the efforts of Mr Yukihiko Hashimoto, the editorial secretary,
who assisted with various aspects of editing.
Seiki Takatsuki, Editor in Chief
Abe, Hisashi
Agetsuma, Naoki
Akamatsu, Tomonari
Amano, Masao
Ando, Akiro
Doi, Teruo
Endo, Hideki
Funakoshi, Kimitake
Ikeda, Hiroshi
Ishii, Nobuo
Iwasaki, Shinichi
Kaji, Koichi
Kaneko, Yukibumi
Kawamichi, Takeo
Kawamichi, Mieko
Kawamoto, Yoshi
Kasuya, Toshio
Kimura, Tadanao
Kishimoto, Mayumi
Kita, Isao
Kitahara, Eiji
Koizumi, Toru
Kurohmaru, Masamichi
Koganezawa, Masaaki
Maeda, Kishio
Masuda, Ryuichi
Matsumura, Sumiko
Manabe, Noboru
Maruhashi, Tamaki
Minami, Masato
Miura, Shingo
Miyazaki, Nobuyuki
Murakami, Okimasa
Mori, Takanori
Nagata, Junko
Obara, Yoshitaka
Ohdachi, Satoshi
Oishi, Takao
Sagara, Naohiko
Saito, Takashi
Sekijima, Tsuneo
Shioya, Katsunori
Shimada, Takuya
Shiraishi, Satoshi
Suzuki, Hitoshi
Suzuki, Masatsugu
Takada, Yasushi
Takatsuki, Seiki
Tamate, Hidetoshi
Tatsuszawa, Shirow
Tsubota, Toshio
Tsukada, Hideharu
Yamada, Fumio
Yokohata, Yasushi
Yoshiyuki, Mizuko
Wada, Kazuo
134
Index
Mammal Study 23: 1998
This index covers Mammal Study Vol. 21 (1996) to Vol. 23 (1998).
Subject
Abe, H.
acetylcholinesterase
acquisition
22, 1
23, 85
22, 71
age at sexual maturity 23, 19
age determination
age estimation
age variation
Amami Oshima
Aneurolepidium chinense
Apodemus
Apodemus agrarius
Apodemus argenteus
Apodemus speciosus
Arvicola
Arvicola sikimensis
Arvicolidae
Asahikawa
automatic collar
release system
bark-stripping
begging behavior
Boso Peninsula
bottle neck
breeding season
brown bear
cardiac musculature
cardiac myocyte
Cervus nippon
Cheju Island
Chiba
China
Citrus tankan
Clethrionomys
22, 49
22, 39
21,1
23, 123
23, 63
22, 27
21,125
22, 21, 23, 19
21,59, 22, 27
21, 161
21, 161
21, 89
22, 27
23, 109
23, 123
74) es
74) DS)
23, 99
23, 19
23, 41
21, 37
21, 37
alls Alle Ideas
23, 95, 103
ZAG ZS
2M, 1935235190
21, 89, 23, 63
Za wkZ3
22, 27
Clethrionomys glareolus21, 1
montanus
VCX
21,15
21, 15
rufocanus
rutilus
—— sikotanensis
coexistence
conception date
condylobasal length
Daikoku Islet
Delphinus delphis
den
digastric muscle
distribution
dolphin, common
dynamic interaction
enamel pattern
Eothenomys
Eothenomys andersont
——= = Chimensts
=a GUSUOS
ae UD
== OZ
== _ OaOw
———= | VOONIOW
—— vegulus
—— shanseius
—— smithii
——— a0
ane DVOGHON
ermine
error estimation
eye lens
fecal analysis
ferret
fiber types
field test
PATRAS JUS;
22, 95 27
21, 15,
ZOLA Geoe
21, 15
22, 11
Zl, Loe
21,1
21,15
23, 119
23, 31
23, |
21, 89
23, 119
21,27
21,1
22,9
21,1
21, 1,89
21, 1,39
21,1
21, 1
21, 89
Zileul
alle Ike IS
21,1
21, 1, 22, 45
2M A389
21, 89
21, 37
23, 41
22, 39
23, 49
alle Sil
23, 9
23, 41
index
flying squirrel
Japense giant 22,81, 23, 79
food begging behavior 22, 71
food habits
foraging behavior
forest structure
forestry
gait analysis
geographic variation
Geoje Island
golden hamster
Gompertz equation
Goto Archipelago
growth curve
habitat factor
habitat preference
habitat selection
haplotype
heterozygosity
histochemistry
Hokkaido
home range
Honshu
identification
Inner Mongolia
insectivorous bat
interference competition
Japan
Jindo Island
joint angle
Kanto
kinematic gait
analysis
Korea
Kyushu
21, 137,
23,9, 49
21,137
22, 21
22, 27
21, 43
21,71
7) Mey ZS)
235 9
22,09
alls ail
22,93
21,71
21,27
23, 31
21,15
235 99
2359
Zales MSs OD5 JOS
AAS (Ale
23, dl, 41, 95
21, 27, 23, 109
21,71
21, 89
23, 63
23, 49
225 Ul
alls WSs Allg MS
22, 11, 71
23, 31, 41
21,125
21, 43
2559
21, 43
21,15
21, 71, 23, 49
laboratory mouse
laboratory rat
limitation of
reproduction
locomotion
longevity
Malayan pangolin
mammal
mandible
Manis javanica
masseter muscle
masticatory muscle
Mesocricetus auratus
microsatellite DNA
Microtinae
Microtus
Microtus montebelli
—— pennsylvanicus
—— sikimensis
Miniopterus fuliginosus
mink, American
mitochondrial DNA
Mogera
Mogera imaizumit
=a MEMON
——— OMe
——— WOeia
molar
mole, Japanese
Mongolia
Mongolian gazelle
morphological variation
21, 43
23, |
23, |
23, 1, 85
23, 1,9
235 9
22, 9, 2a, 99
22, 45
22,9
21,59
ey D3) O's
23, 9, 89
21,1
21, 161
23, 49
21,37
21,15, 125
ali (Lg UMS:
2M, lS
ZS
21, 71
Jal (les SUS)
21, 1
Zale (ks ILD
23, 63
23, 63
21, 89
mouse, Japanese field 23, 19
mouse, Japanese wood 21, 59
mouse, striped field
Mt. Goyo
mtDNA
murids
Mus musculus
Musculi digastricus
Se NOSSO
—— mylohyoideus
21, 125
23, 105
ZS M5 ZS)
23,9
2359
23, |
23, |
23, |
136
—— temporalis
Mustela
Myotis macrodactylus
= ONC AD
Nara
Nara River
nasal sac
Nemuro Peninsula
Neodon sikimensis
neuromuscular junction
niche shift
Nozaki Island
Nyctereutes procyonotdes
optic lens
orange, tankan
Oshima
pangolin
pawpad lamillae
PCR primer
Petaurista leucogenys
Phocoenoides dalli
Pitymys stkimensis
polymorphism
population density
porpoise, Dall’s
235 |
21, 37
23, 49
23, 49
23, 19
ZN DS)
23, 119
23, 31
21, 161
23, 89
22, 11
21, 27
23, 109
22, 45
23, 123
23, 41
23, 1
23, 129
22,9
22, 81, 23, 79
23, 119
21, 161
Zl M5 WAS)
23, 19
23, 119
postnatal development 22, 53, 23, 85
prey selection
Procapra gutturosa
provisions
pulmonary vein
raccoon dog
radio-tracking
radiotelemetry
ANE, SOO
Rattus argentiventer
exulans
eerame LOMUCOICUS
rattus
rDNA
red fox
23, 49
23, 63
21, 137
21, 37
23, 109
‘all
23, 41
23, 123
23, 129
23, 129
23, 9, 129
23, 123, 129
21,15
Falls Mog 25 (lls
23, 31
Mammal Study 23: 1998
reproduction
resource partitioning
restoration
Rhinolophus cornutus
Serrumequinnum
ribosomal DNA
Rishiri Island
Russia
scrotum
sexual dimorphism
sexual maturity
Shikoku
Sacansian. S.
Shiretoko
shrew
Sichuan
sika deer
Sikkim
silicon reconstruction
Sorex caecutiens
gracillimus
ram LL UCUALUS
South Korea
spatial segregation
species diversity
Stipa
surface activity
Sympatric
Szechwan
Talpidae
taxonomic revision
taxonomy
telemetry system
temperature
temporal muscle
testis
trace recorder
triangle test
twin
twinning rate
23, 19
23, 49
21, 43
23, 49
JANE VB, WZ)
21, 15
23, 63
22, 81
22, 93
225 Olly Zag
21,71
22, 1
2A, 37522571,
23, 41
21, 65, 22, 11
21, 89
ZAG, Naas
235 99, 105
21, 161
23, 119
21, 65
21, 65
21, 65
21,125
21,59
22, 21
23, 63
Taj Mh
23, 49
21, 89
21,115
21,115
21, 89
23, 109
23, 19
23, 1
22, 81, 23, 79
23, 109
23, 41
23, 105
23, 105
index
ultrasonic vocalization 22, 53
ultrastructure 23, 85
undergroud activity 22,11
Ursus arctos 23, 41
vole, gray-sided Zon
, Japanese field 21, 59, 22, 53,
DIB (OD
mma LOLLMerml
red-backed ARS)
——, red-backed MAL 55 22> AS
Sy cean 21, 161
aE outils red-
backed 22545
Vulpes vulpes 7) bs SUBS es Paras, (Nl
Zaonl
wildlife conservation 23,63
Yunnan 21, 89
Ladi
138
Author
Abe, H.
Abe, S.
Agungriyono, S.
Ando, A.
Ando, K.
Asada, M.
Asakawa, M.
Atoda, O.
Boonsong, P.
Chancardr a:
Don, 1.
Endo, A.
Endo, H.
Cao, ZG
llann, S, Jal
Hayashi, Y.
lala, Se.
IOmenmnaigkens:
Inuzuka, N.
Ishibashi, Y.
Jiang, Z.W.
Jibay, IK,
Kay, IK,
ISBITEKO, SC
Kanzaki, N.
Kanvanoiclon di:
Kurohmaru, M.
Milzun©, IP,
Maruyama, N.
Masudameke
lore, IC.
Motokawa, M.
Nititealkcanaaied
Nadee, N.
Nacaitanule
Nakamura, K.
Nakatar ke
Nakatsu, A.
Nishiumi, I.
Nonaka, N.
Ochiai, K.
Nabhitabhaita: J
Al ea 7A) ALES)
22,9
23, 1
22, 49
23, 89
21, 153, 23, 95
ZA
23, 113
ZadyZ9
23, 1
21, 27
“alle Ad
74) ky Sig rag Il
23, 63
7a) ey Je J)
21,27
ZV 25
23, 129
21, 43
22,9
23, 63
23, 63
23, 99
Zale Mh Sl OIL
aps MALS
23, 13
23, 79
21, 27, 23, 1
23, 41
“ape WLS)
23, 95
23, 9, 2, 89
21, 115
23, 41
23, L
Za,
23, 95
23, 119
74) Ve MGi5 72055, JUS)
22, 27
23, 1
ZAMS)
ZAG MS 5 73%) 9D
Ohdachi, S.
Ohno, W.
Saucon, I,
Sakaizumi, M.
Salone ke
Shimazaki, K.
SJaregisian. S:
Smeenk, C.
Sugasawa, K.
Suzulay Ee
Suulletdle:
Rakalnashiahke
akatsuki S:
Tomisawa, M.
suclanyay 1
Tsukada, H.
Uraguchi, K.
Urayamia, ke
NWialxainiay oS:
Yale, a:
VWannadae
Vamadary wake
Yamagiwa, D.
Voshidam Wier:
Yoshinaga, Y.
Mammal Study 23
21, 65, 22, 11
22, 99
Jay Dt
21,15
22, 39
2a, 119
225 49; 09
21, 161
23, 9, 89
2A las lias
23, 113
22, 39, 235 31
2998
22, 1, 23, 63, 105
Mass IS
alle N55 ZS
Zale
23, 31
21, 59
PME MS, UZS
28, 123, 129
2a, |
23, 119
21, 27
22, D5 205 90
22, 93
INSTRUCTIONS TO CONTRIBUTORS
The Mammal Study (the continuation of the Journal of the Mammalogical
Society of Japan) publishes original Articles and Short Communications, written in
English, on all aspects of mammalogy. In principle, membership of the Society is
a prerequisite for the submission of papers, but non-members may be co-authors.
Manuscripts are submitted to qualified referees for critical scientific reviewing.
Authors are notified, with referees’ comments, on acceptance, rejection or need for
revision. The editor also customarily sends manuscripts to qualified reviewers for
English editing.
Manuscripts should be submitted typewritten on one side of the paper (use A4
21.0 cm X 29.7 cm paper), and double-spaced. An approximately 3 cm margin
should be left on all sides. Do not hyphenate words at the right margin. Manu-
scripts should be arranged in the following order: the title, name(s) of author(s)
and affiliation, fax number and E-mail number if available, abstract (fewer than
200 words) and key words (five words or fewer), main text, acknowledgments,
references, tables, figure legends, figures. Titles of papers must be accurate and
concise, and (for abstraction services) include any relevant taxonomic name. A
Japanese title and a Japanese abstract should be written on separate sheets. Text
pages should be numbered through from title to references. Manuscripts should be
line-numbered, every five lines, in the left margin. Short Communications do not
exceed four printed pages. Abstracts and key words are omitted from Short
communications.
Tables and figures should be simple and self-explanatory, and their preferred
locations should be indicated in the right margin of the text. The ratio of tables and
figures to text pages cannot exceed 1:2 and they should be as few as possible. The
author’s name and figure numbers should be written on the back of original figures
and on the surface of copies.
Scientific names should be underlined. All measurements should be in metric
units. The following abbreviations should be used. Length: km, m, cm, mm, etc. ;
area: km’, m’, etc.; volume: km’, m’, kl, 1, ml, etc.; weight: kg, g, mg, etc. ;
time: hr, min, sec, etc.; others: cal, kcal, C, Hz, p (probability), SD, SE, etc.
Arabic numerals should be used for numbers exceeding 10.
References in the text should follow the forms: “Uchida and Shiraishi (1985)
stated that ...” (Abe and Kawamichi 1990), and (Miura et al. 1993). More than one
reference within the same parentheses should be listed chronologically, alphabeti-
cally if of the same year. Full references cited must be listed alphabetically by the
first author according to the following examples:
Abe, H., S. Shiraishi and S. Arai. 1991. A new mole from Uotsuri-jima, the Ryukyu
Islands. J. Mamm. Soc. Japan 15: 47—60.
Eisenberg, J. F. 1981. The Mammalian Radiations. Univ. of Chicago Press,
Chicago, 610 pp.
Geist, V. 1982. Adaptive behavioral strategies. Jn (J.W. Thomas and D.E.
Toweill, eds.) Elk of North America. pp. 219—277. Stackpole, Harrisburg.
Obara, Y. 1991. Karyosystematics of the mustelid carnivores of Japan. Honyurui
Kagaku [Mammalian Science] 30: 197—220 (in Japanese with English
abstract).
Authors are recommended to refer to recent issues of the journal for details of style
and layout.
Manuscripts should be submitted in triplicate, with a separate sheet giving the
title, author(s) name(s) and address(es) for editorial correspondence, a running
head (fewer than 20 letters), the numbers of main text pages, tables and figures, and
the number of copies of reprints requested.
Galley proofs will be sent to the author. Reprints may be purchased in blocks
of 50.
Mammal Study
Vol. 23, No. 2 December 1998
CONTENTS
ORIGINAL PAPERS : | i: |
Sugasawa, K., K. Ando- and T. Mori: Postnatal development of the neuromus-
cular junction of the masseter muscles in the Japanese field vole, Microtus —
LOG | vette 5
Nagataz’ Je. R Masuda, Ke Kaji ok Ochiai, M. Adal and M. C. Yoshidae™
Microsatellite DNA variations of the sika deer, Cervus nippon, in Hokkaido isaM
and Chiba ie laierels/e/oj clea eselerevelalanelejeveterel ciciie elec alevefeteleloralsistetererctel stele varetererererclolstereisiercteieielotereteklenteterieteients ja) sis \o\'se loforerehetotatetenene 95 .
Takatsuki, S: The twinning rate of sika deer, Cervus nippon, on Mt. pee? aa
northern Japan 5S DOC COOOD ODD DO CED DCO bo DODD DDD OO DONO ODODDUDD DODO ONEODONONGS. -oonbooes5 ooo00ddcoonGCC0sS -103
Kaneko, Y., T. Suzuki, N. Maruyama, O. Atoda, N. Kanzaki and M. Tomisawa : |
The “Trace Recorder”, a new device for surveying mammal home ranges, and
its application to raccoon dog research eect cle cece cece cece e sce nsseereas we ccecce seers 19 ;
_ SHORT COMMUNICATIONS
Nakamura, K., T. K. Yamada and K. Shimazaki: Measurements of the nasal sacs .
of individual common dolphin, Delphinus delphis, and Dall’s porpoise, f
Phocoenoides dalli, by means of silicon reconstruction veseedeesauedeeceensnesensum 119
Yabe, T: Bark-stripping of tankan orange, Citrus tankan, by the roof rat, Rattus
rattus , in Amami Oshima Island, southern Japan chenetecees Levens 3 le Gti tia ia ieee
Yabe, -T., P. Boonsong and S. Hongnark: The structure of the pawpad lamellae of
four Rattus species alolielel s\iollelele/e/e|ejele) +, alelelele eles 0.9 for each comparison). In contrast, body weights increased
rapidly during November and December (68.4+4.7 kg, n=5), and December body weights
were significantly heavier than in November (P< 0.05).
Table 1. Body weight and the rate of weight increase (7,,) of seven captive female Japanese black bears.
May Jun. Jul. Aug. Sept. Oct. Nov. Dec.
Average (kg)* 46.23 50.42» S332 57/3 S732 58.8° 59.4¢ 68.44
SD 4.4 4.2 3.6 3.5 3355) 3.8 4.3 4.7
ime (ei a 9.2 5.8 Tes =(0)5) DI) 0.9 15 eZ
i» = Phase I Sf = Phase II = <— Phase III — y
* Values in the same row followed by different letters are significantly different (P<0.05).
mean body weight — mean body weight of last month
mean body weight of last month
** Rate of Weight Increase = x 100
4 Mammal Study 24 (1999)
Discussion
The body weights of seven captive female Japanese black bears increased gradually dur-
ing spring (Phase I), were stable during summer (Phase II) and increased rapidly in autumn
(Phase III). These changes were presumed to be related to annual changes in growth and to
seasonal changes in nutritional conditions. Because the body weights of the bears did not
differ between years, they were assumed to have been old enough to cease growing. We
conclude, therefore, that the weight changes of the bears examined were seasonal.
Seasonal changes in the nutritional conditions of animals are closely related to their
physiology. Nelson et al. (1983) defined four seasonal physiological stages in American
black bears and grizzly bears, U. arctos: hibernation, walking hibernation, normal activity
and hyperphagia. In our study of the Japanese black bears, we have shown that body
weights change during the stages of normal activity and hyperphagia. Phases I and II appear
to correspond to Nelson et al.’s (1983) stage of normal activity, and our Phase III to their
hyperphagia stage. The fact that the normal activity stage may be divided into two phases
was first recognized in the present study. Further study is required to elucidate the physio-
logical mechanisms separating Phases I and II. :
It is impossible to undertake the same kind of continuous study of the nutritional
conditions of wild bears as can be done in captivity. Nevertheless, some data on seasonal
changes in nutritional conditions of wild Japanese black bears from the post denning period
to the active period have been collected (Hazumi et al. 1985; Gifu Prefecture 1995). These
data, though not presented statistically, showed that nutritional condition as measured by
levels of marrow fat (Hazumi et al. 1985) and of kidney fat (Gifu Prefecture 1995) declined
from the post denning period (April to June) to the active period (July to September). These
results were opposite to those of the present study that revealed a gradual increase in the
body weights from May to August.
Also in contrast to our study are the results of Hellgren et al. (1989) who found that in
Virginia and North Carolina where environmental conditions such as day length, temperature
and vegetation are similar to those in Japan, the body weights of wild American black bears
decreased from early summer (mid June to July) to late summer (August to September).
In the wild, poor nutritional condition may result from food shortages from early to late
summer, whereas the body weights of captive bears increase because of the availability of
sufficient food and because of their lower energy expenditure during this season.
During the pre-denning period, the nutritional condition of wild Japanese black bears
seems to improve (Gifu Prefecture 1995). In this study, body weight increased rapidly
during Phase III. During the period of hyperphagia, the American black bears increase
both their food intake (Nelson et al. 1983) and digestion (Brody and Pelton 1988), both of
which are thought to be adaptive for storing energy prior to denning. In our study, both
factors might have contributed to the increases in body weight.
Although body weights tended to increase during a single year (Fig. 1), when the same
months were compared between different years, they did not differ. This indicates that body
weight decreases during winter. Body weight loss during hibernation has been reported for
captive American black bears (Watts et al. 1981; Watts and Cuyler 1988; Farley and Robbins
1995). Thus, it is probable that captive adult female bears lose weights during winter, and
it is plausible that bears repeat an annual cycle characterized by spring recovery, autumn
Hashimoto and Yasutake, Body weight of Asiatic black bears 5
increase and winter weight loss while denning.
Two methodological issues have been raised by this study, which require further study.
Firstly, in order to obtain weight data, we immobilized the bears. This is, however, not
good for their health, and it is also costly. In future, therefore, it is recommended that a
method not requiring immobilization be used. Secondly, as we did not measure the amount
of food, we were unable to relate food availability to changes in body weight. Studies under
controlled conditions are needed for a better understanding of the food-body weight rela-
tionship in the Asiatic back bear.
Acknowledgements: We thank M. Suzuki, Y. Uozumi and S. Takahashi for helping with
preparations and measurements, and H. Igota, K. Naganawa, S. Seki, Y. Suzuki and K.
Yamamoto for helping handle bears. We thank Professors T. Tsubota of Gifu University
and T. Komatsu of the Institute of Japanese Black Bear in Ani, Japan, who gave much
useful advice, and we also thank Associate Professor S. Takatsuki of Tokyo University for
kindly reading and giving comments on an early draft of the manuscript. This work was
partly supported by Ani Town and the Sasakawa Scientific Research Grant from the Japan
Science Society.
References
Brody, A. J. and Pelton, M. R. 1988. Seasonal change in digestion in black bears. Canadian Journal of Zoology
66: 1482-1484.
Farley, S. D. and Robbins, C. T. 1995. Lactation, hibernation, and mass dynamics of American black bears and
grizzly bears. Canadian Journal of Zoology 73: 2216-2222.
Gifu Prefecture. 1995. Research report on population index of Japanese black bears. Gifu. 35 pp. (in Japanese).
Hashimoto, Y. and Takatsuki, S. 1997. Food habits of Japanese black bears: A review. Honyurui Kagaku (Mam-
malian Science) 37: 1-19 (in Japanese with English abstract).
Hazumi, T., Maruyama, N., Mizuno, A., Torii, H. and Maita, K. 1985. Nutrient examination of Japanese black
bear. In (Environmental Agency, ed.) A Report on the Change of Forest and Large Mammal Ecology: pp. 80—
84. Tokyo (in Japanese).
Hellgren, E. C., Rogers, L. L. and Seal, U.S. 1993. Serum chemistry and hematology of black bears: physiology
indices of habitat quality or seasonal patterns. Journal of Mammalogy 74: 304-315.
Hellgren, E.C., Vaughan, M.R. and Kirkpatrick, R. L. 1989. Seasonal patterns in physiology and nutrition of
black bears in Great Dismal Swamp, Virginia-North Carolina. Canadian Journal of Zoology 67: 1837-1850.
Jonkel, C. J. and Cowan, I. M. 1971. The black bear in the spruce-fir forest. Wildlife Monograph 27: 1-55.
Mautz, W. W. 1978. Nutrition and carrying capacity. In (Schmidt, J. L. and Gilbert, D. L. eds.) Big Game of
North America, Ecology and Management. Pp.321—348. Stackpole Books, Harrisburg.
Nelson, R. A., Folk, G. E. Jr., Pfeiffer, E. W., Craighead, J. J., Jonkel, C. J. and Steiger, D. L. 1983. Behavior,
biochemistry, and hibernation in black, grizzly, and polar bears. Fifth International Conference on Bear
Research and Management: 284—290.
Robbins, C. T. 1993. Wildlife Feeding and Nutrition, 2nd edn. Academic Press, Sandiego, 352 pp.
Servheen, C. 1990. The Status and Conservation of the Bears of the World. International Conference on Bear
Research and Management Monograph Series. No. 2. 32 pp.
Tsubota, T. 1998. Biology of Mammals 3: Physiclogy. University of Tokyo Press, Tokyo, 125 pp. (in Japanese).
Watts, P. D. and Cuyler, C. 1988. Metabolism of the black bear under simulated denning conditions. Acta Physio-
logica Scandinavica 134: 149-152.
Watts, P. D., Oritsland, N. A. and Ronald, K. 1981. Mammalian hibernation and the oxygen consumption of a
denning black bear (Ursus americanus). Comparative Biochemistry and Physiology 69: 121-123.
Received I August 1998. Accepted 10 January 1999.
Mammal Study 24 (1999)
Appendix 1. Body weights (kg) of seven captive female Japanese black bears.
1994 1995
Bear Oct. May Jun. Jul. Aug. Sept. Oct. Nov. Dec.
W31 44.0 53.0 57.0 61.0 60.5 59.0 = 70:5
W32 S720 = 45.0 48.0 52.0 Silsd Soll) 58.0 60.0
W33 64.0 49.0 52.0 56.0 = 59.0 63.0 == 71.0
W34 54.0 41.0 47.0 50.0 55.0 54.0 56.0 54.0 —
W35 65.0 50.0 55.0 = 61.0 60.0 62.0 = 70.0
Y45 59.0* 42.0 as 54.0 58.0 60.0 = 62.0 a=
Y48 51.0 = 55.0 57.0 56.0 60.0 63.5 70.5
Mean 60.5 46.2 50.4 53.3 S763) 57.3 58.8 59.4 68.4
SD Sell 4.4 4.2 3.6 3D eM) 3.8 4.3 4.7
* weighed in September.
Mammal Study 24: 7-15 (1999)
© the Mammalogical Society of Japan
The distribution and habitat use of the Eurasian red squirrel
Sciurus vulgaris L. during summer, in Nopporo Forest Park,
Hokkaido
Tsung Hung Lee! and Hiromi Fukuda?
1,2Graduate School of Environment Earth Science, Hokkaido University, North 10 West 5, Sapporo
060-0808, Japan
Abstract. The distribution and habitat use of the Eurasian red squirrel Sciurus vulgaris L.
was studied in Nopporo Forest Park (43°20'N, 141°30 E), Hokkaido, Japan where a study
area consisting of a total of 401, 200m by 200m, grid squares was established. Observa-
tions were made of individuals, their dreys, their feeding signs, and their footprints (after
dusting with wheat flour). Squirrels were found to be widely distributed throughout the
study area, and to inhabit 45 of the 401 squares (11.2%). Squirrels occurred at high fre-
quencies in three areas within the forest. The percentages of squares in which squirrels lived,
differed significantly between different forest types, with 28.2% of squares in evergreen
coniferous forest used, 5.3% in deciduous coniferous forest; 5.2% in mixed forest; 3.9% in
deciduous broad-leaved forest, and 0% in other areas. We concluded that dusting with
flour was a useful method for revealing footprints, and that this facilitated the ease study of
squirrel distribution. The distribution of the red squirrel clearly depends on the forest type.
Coniferous forest areas were selected as habitat by squirrels during summer because they
provided good sources of food and ideal sites for building dreys.
Key words: distribution pattern, footprints revealed with flour, forest type, habitat use,
Sciurus vulgaris.
The Eurasian red squirrel, Sciurus vulgaris L., is widespread throughout Hokkaido, Japan
(Environment Agency 1983; Takaragawa 1996). Significant changes to the landscape, as a
result of human activities such as deforestation for agriculture and/or urbanization, have,
over the last century, cause a drastic reduction in the area of suitable forest habitat, which
has led to the isolation of squirrel populations. Such isolated populations are at risk from
the negative effects of isolation such as inbreeding depression (Wildt et al. 1987; Brewer et al.
1990) which may lead to the extinction of populations or even species. In England, where
the distribution range of the red squirrel has reduced and fragmented in this century, areas of
forest of more than 2,000 ha are now deemed necessary if they are to serve effectively as red
squirrel reserves (Gurnell and Pepper 1993).
Information on the local distribution and abundance of animal population is an im-
portant aspect of management-oriented investigations of wildlife. To that end, several cen-
'Present address: Rm. 2, 3rd Fl., 25, Lane 238, Szeping R., Taichung 406, Taiwan; E-mail: tsunghun@ms29.hinet.net
8 Mammal Study 24 (1999)
sus techniques have been evaluated for the red squirrel, including elaborate capture-recapture
programs (Moller 1986; Wauters and Dhondt 1990b); drey counts (Tittensor 1970; Wauters
and Dhondt 1988, 1990a; Van Apeldoorn et al. 1994); and counting tracks and food remains
(Andrén and Lemmell 1992; Kadosaki 1995). For this study we used a combination of direct
observations of individuals, and observations of dreys, feeding signs, and footprints dusted
with wheat flour, in order to study the distribution and habitat use of the Eurasian red
squirrel in Nopporo Forest Park during the summer from June to September 1996.
Study area
Research was conducted in Nopporo Forest Park (43°20 N, 141°30 E), which is situated
in west Hokkaido, 11-15 km east of central Sapporo. Nopporo Forest Park has an area of
2,051 ha, and stretches over parts of Sapporo, Ebetsu and Kitahiroshima administrative
areas. The forest is designated as a natural recreational forest, and the whole area lies
within a wildlife protection area. Nopporo forest has become completely isolated from
other areas of lowland forest as a result of the spread of both agriculture and urbanization.
The forest now consists mainly of natural deciduous forest, but has some areas of planted
conifers within it. The total area of our study, after excluding bogs, lakes, and buildings,
amounted to about 1,611 ha.
Materials and methods
This study was processed in three stages from 1 June to 15 September 1996.
During Stage I, from 1 June to 20 June 1996, a study area of 16 ha was established and
searched for squirrels, their dreys and their feeding signs, in order to obtain basic habitat
utilization information.
During Stage II, from 25 June to 15 July 1996, the following program was followed in
order to evaluate a method for studying squirrel distribution and habitat use. 1) A square
covering about 1 ha (100 m x 100m) was establish. 2) In the center of this area, a feeding
station with a radius of 60cm was establish on the ground. Approximately 300 g of wheat
flour was spread in the middle of the feeding station covering an area with a radius of 25 cm.
In addition, one walnut, one acorn, one peanut, one pistachio and ten sunflower seeds were
put on the feeding station for a whole day in order to attract squirrels to the area covered
with flour. 3) When squirrel, or other animals, visited the feeding station they picked up
flour on their feet, and left trails of footprints as they left. The species leaving footprints
could be identified on the basis of the shape of the hind foot and on the stride length. 4)
In order to distinguish between the individuals leaving footprints, we observed them with
binoculars (<7) at a distance of 20m from the feeding station. We were able to identify
three squirrels individually on the basis of their coat color, their size, the cuts of their ears,
and by the size of the footprints. 5) The day-range of the three known individuals was es-
tablished by setting eight new feeding stations to the north, south, east, and west of the main
feeding station and at distances of 100 m and 200 m away, in order to see whether the same
individual also visited there or not. All three squirrels visited the new feeding stations set
100 m away from the original site, but none visited feeders set 200m away. Therefore, the
home ranges of these squirrels were equal to or less than the size of the grid (200 m X 200 m).
Lee and Fukuda, Eurasian Red Squirrel Habitat Use 9
During Stage III, from 16 July to 15 September 1996, we investigated the distribution of
squirrels and their habitat use throughout the whole forest area. First we established 401,
200 m by 200m (4ha), grid squares in the study area. Each square was investigated every
two days. On the first day the feeding station was provisioned, and on the second day
footprints were followed. We also looked for nests, recording nesting tree details, searched
for feeding signs, and watched for individuals within a 50m radius of the feeding station.
The dominant tree species within a 50m radius of the feeding station were also noted. We
also investigated the distribution of squirrels (using the methods described in stage III above)
in four areas adjoining the main study area. These areas were: the Hokkaido Forest Tree
Breeding Institute (including the gene reservation region); Nopporo Prefectural General
Sports Park; the Historical Village of Hokkaido, and the campus of Rakuno Gakuen
University (Fig. 1).
Results
Distribution pattern
Eurasian red squirrels were found (on the basis of direct observation, or of finding their
footprints, their dreys or their feeding signs) in 45 (11.2%) of the 401 study squares. Occu-
pied squares were scattered around the study area. When the shortest distance between
squares being used by squirrels was equal to or less than 400m, we drew minimum convex
polygons and so were able to recognize three areas (A, B, and C) where squirrels were con-
centrated. Area A consisted of 18 squares (18/45; 40%); Area B consisted of 13 squares
(29%), and area C consisted of six squares (13%; see Fig. 1). In area A, squirrels were
scattered throughout a large area, and in area C they were scattered over a smaller area,
whereas in area B they were highly concentrated.
From additional research outside the main study area, in the Hokkaido Forest Tree
Breeding Institute, squirrels were found in four squares, and their distribution was concen-
trated in the gene reservation section (the distribution of squirrels in the three other areas can
be seen in Fig. 1).
A total of 25 individual squirrels was observed, in the 401 squares of the study area; 11
individuals were identified in area A; nine in area B; three in area C; and two in other areas.
We are confident that observations were of different individual squirrels because either
different squirrels were seen in the same squares simultaneously or they were seen in squares
separated by more than 400m. We concluded, therefore, that the squirrels in Nopporo
Forest Park were mainly distributed in area A, B and C during summer.
Squirrels were more often found in some tree species than in others, so for example,
twelve were seen on Abies sachalinensis; six on Pinus strobus; four on Larix leptolepis; two
on Picea glehnii, and one on Quercus mongolica.
A total of 28 dreys was found in just 15 squares, although in one square with a drey we
were unable to find either footprints, feeding signs or individuals, suggesting that the drey
may have been disused. Feeding signs were found in 24 squares, and in a further square we
found feeding signs but were unable to locate individuals, dreys, or footprints. Distinctive
feeding signs were recognize on walnuts, chestnuts, acorns and the cones of A. sachalinensis,
Pinus Koraiensis and P. strobus. Among the total of 45 squares showing signs of squirrels,
activity in 43 (95.6%) of them was detected using the floured footprint method.
10
Mammal Study 24 (1999)
II. Forest types
I. Distribution
Gene reservation region
Hokkaido Forest Tree
Breeding Institute
Evergreen coniferous
forest
Deciduous broad-leaved
roceeeines Dotted line: Concentrated forest
region (A, B and C) Mixed forest
Direct sbservati
s avon Deciduous coniferous
Solid line: study area forest
Dreys
: aa I Others
Broken line: adjoining area
peed nggsons a] Forest fragementation or
campus with many trees
Fig. 1. The distribution pattern of the red squirrel in the Nopporo Forest Park with 200 m grid squares (I. Dis-
tribution) and the vegetation of the Nopporo Forest Park and the adjoining areas (II. Forest types).
Lee and Fukuda, Eurasian Red Squirrel Habitat Use 11
Habitat use
According to the investigation of the dominant trees near the feeding stations, and on
the basis of published vegetation maps (Environment Agency 1981; Sapporo District Forestry
Office 1992), the forest vegetation could be divided into five broad types: 1) mixed forest,
consisting of a natural community of Picea jezoensis, A. sachalinensis, QO. mongolica, Tilia
japonica and Acer mono; 2) deciduous broad-leaved forest, consisting of a natural com-
munity of A. mono and T. japonica; 3) evergreen coniferous forest, consisting of a plan-
tation community of A. sachalinensis, P. glehnii and various exotic trees; 4) deciduous
coniferous forest, consisting of a plantation of Larix leptolepis; and 5) others vegetation
types including cultivated meadow, fields and young plantations (see Fig. 1). On the basis of
squirrels presence and on the forest community within each square, we were able to examine
habitat use in different forest types. Among squares where evergreen coniferous forest pre-
dominated 28.2% of squares were occupied by squirrels. Where deciduous coniferous forest
was dominant 5.3% of squares were occupied. In mixed forest 5.2% of squares were occu-
pied by squirrels, and in deciduous broad-leaved forest 3.9% of squares were occupied. In
the fifth category of vegetation, no squares (0%) were occupied. The differences in forest
use were statistically significant (P<0.001; Table 1). Squirrels were present in just 4.4% of
natural vegetation units, but were found in 25.7% of the squares where the forest consisted
of plantations. The difference in the rate of habitat use between natural vegetation and
plantations was also significant (y?=38.4, df=1, n=387, P<0.001).
In the three areas where squirrels were concentrated, area A region consisted of ever-
green coniferous forest, deciduous broad-leaved forest, mixed forest. Area B consisted
mainly of evergreen coniferous forest, with some deciduous broad-leaved forest. Area C
region consisted mainly of evergreen coniferous plantation, deciduous broad-leaved forest
and some planted deciduous conifers. Among these three areas, however, squirrels were
mainly distributed in areas with evergreen coniferous forest. Squirrels were less commonly
found in areas of deciduous broad-leaved forest, mixed forest, deciduous coniferous forest
or Others vegetation types. In terms of the total number of squares occupied by squirrels
(45), 33 (73.3%) were in evergreen coniferous forest, and 12 (26.7%) were in deciduous
coniferous, mixed and deciduous broad-leaved forests. Similarly, in the Hokkaido Forest
Tree Breeding Institute, adjoining the study area to the North, squirrels were mainly dis-
tributed in the gene reservation region, which consisted of various types of coniferous plan-
tation. More feeding signs (on 13 species) were found here than in other areas.
Further analysis of the distribution of dreys in relation to tree species, indicated that
Table 1. The number of grids with squirrel in different forest types.
Forest type Grids of presence(%) Total of grids
Evergreen coniferous forest 33(28.2) LIU
Deciduous coniferous forest 1(5.3) 19
Mixed forest 5(5.2) 97
Deciduous broad-leaved forest 6(3.9) 154
Others 0(0) 14
Total 45 401
72=50.689, n=401, df=4, P<0.001
12 Mammal Study 24 (1999)
Table 2. The numbers of the dreys built in different type of trees.
Hokkaido Forest Tree
N i i
opporo Forest Park Breeding Institute
Type of trees AB C Others Gene reservation region Total (%)
Evergreen coniferous trees 10 yD 4 8 33(89.2%)
Deciduous coniferous trees 0 eX) 0 1 3(8.1%)
Deciduous broad-leaved trees 1 0 O 0 0 1(2.7%)
Total Ul LI y, 4 9 31)
most dreys (89.2%) were built in evergreen coniferous trees, although some were built in
deciduous coniferous trees and some in deciduous broad-leaved trees (Table 2).
Discussion
Tracking footprints is a well-established means of confirming the presence of mammals.
Footprints are not always conspicuous, however Kadosaki and Inukai (1995) showed that it
was possible to use lime flour to make the footprints of brown bear Ursus arctos more con-
spicuous, and also to aid in their individual identification. In this study we used a similar
method, imprinting the footprints of Eurasian red squirrels with wheat flour, in order to
facilitate tracking and censussing them. This method enabled us to confirm that as squir-
rels will visit feeding stations up to 100m apart, but not 200m apart (see stage II above),
then 200 mx 200m grid squares can be used to study the distribution of the squirrels in
Hokkaido.
Seasonal and annual changes in habitat condition are known to affect the distribution
(Gurnell 1983), and the home ranges of males are known to be larger during the breeding
season (Wauters and Dhondt 1992). We conducted our study therefore during the three
months of summer when squirrels density was likely to be highest (Takaragawa 1980; Gurnell
1983), and used direct observation, flour print tracking, observations of dreys, and feeding
signs, in order to investigate the distribution pattern and habitat use of squirrels. During
this study, the presence of the footprints (in 43 squares) proved to be the best evidence of the
presence of squirrels in a given area, with direct observation of squirrels (in 11 squares) being
a somewhat less effective method of study them. The presence of footprints reflects activity
well, and as squirrels came to each feeding station voluntarily and without being disturbed,
their subsequent movements were considered to be natural.
Although red squirrels use two types of nests, spherical shaped nests built amongst tree
branches, and dens in tree-holes lined with nest material (Tittensor 1970; Wauters and
Dhondt 1990a), dreys are generally the commonest form of nest in both coniferous and
deciduous woodlands (Wauters and Dhondt 1990a). After the breeding season, and hence
during summer, dens are less important (Tittensor 1970), therefore, although we used dreys
as one means of confirming the distribution pattern of squirrels, we disregarded misshapen
dreys as it was unlikely that they were still in use.
The use of four different types of field signs enabled us to study the distribution pattern
of squirrels, though different method had widely differing degrees of success. The number of
grid squares where squirrels were detected on the basis of these different field signs was: 43
Lee and Fukuda, Eurasian Red Squirrel Habitat Use 13
for footprints > 24 for feeding signs > 15 for dreys > 11 for direct observation of
individuals. Squirrels were detected in 17 squares purely on the basis of tracing their foot-
prints. Their presence in one square was confirmed only by the finding of a drey, and in
another by the finding of feeding signs. Sightings of individuals were only made in con-
junction with other signs, and their presence was not confirmed in any squares by direct
observation alone. We suggest, therefore, that tracking footprints dusted in flour is a very
effective method for the study of the distribution and movements of the red squirrels.
As in Europe, many woodlands in Japan have become fragmented, so that where large
red squirrel populations used to occur, they have now been reduced to small populations in
isolated parts of their old range (Celada et al. 1994; Van Apeldoorn et al. 1994; Wauters et
al. 1994). Habitat fragmentation has been shown to have impacts on both the distribution
and probability of occurrence of this species (Van Apeldoorn et al. 1994), and it has been
recommended that forests larger than 2,000 ha are necessary as red squirrel reserves (Gurnell
and Pepper 1993).
In this study, the widespread distribution, with some areas of concentration, indicate
that squirrels are actively selecting their habitat. Additional research using radio-telemetry
showed that during the mating season, from February to June, males living in area A also
temporarily visited the Hokkaido Forest Tree Breeding Institute, while males from the ad-
joining areas (Hokkaido Forest Tree Breeding Institute, Nopporo Prefectural General Sports
Park, the Historic Village of Hokkaido and the campus of Rakuno Gakuen University) also
sometimes visited area A (Lee and Fukuda unpublished data). Thus the squirrels living in
these adjacent areas are also considered to belong to the same population as in Nopporo
Forest Park. In this area, totalling more than 2,000 ha of forest, red squirrels were con-
sidered to be actively selecting their habitat and concentrating in three high density areas.
During the mating season, however, males travel to other areas in order to mate, and hence
avoid the negative effects of reduced genetic variation (Wauters et al. 1994), and habitat loss
by the forest fragmentation (Andrén and Delin 1994). Whereas red squirrels were found
readily in the larger area of forest in Nopporo, none were found in small isolated urban
habitats such as on the Hokkaido University campus (182 ha) or in the Botanical Garden (20
ha), despite there being plentiful food resources in the form of walnut, acorns, and pine
cones. Their absence may have been because the areas of habitat were too small for them,
or because of the presence of too many predators such as cats and/or crows.
The coniferous community of the Nopporo Forest Park, produced by frequent cuttings
and by wind damage, has been maintained by planting A. sachalinensis, and P. jezoensis,
L. leptolepis and exotic trees such as Pinus koraiensis, and P. strobus. The natural mixed
forest community consisted mainly of Picea jezoensis, A. sachalinensis, T. japonica and
Acer mono, while the broad-leaved forest consisted mainly of A. mono and T. japonica.
Although, Juglans ailanthifolia was also present, it was scarce (Tatewaki and Igarashi 1973).
Eurasian red squirrels feed on a wide range of different food types, however tree seeds
form the most important part of their diet (Moller 1983; Gurnell 1987; Wauters et al. 1992),
and coniferous tree seeds can provide food year round (Wauters et al. 1992). Stomach
contents analysis has also shown that pine seeds are the most important component of their
diet (Gronwall and Pehrson 1984). In our study, red squirrels occurred more commonly in
evergreen coniferous forest than in either broad-leaved forest or mixed forest. Moreover,
red squirrels were also abundant in the part of the gene reservation region of the Hokkaido
14 Mammal Study 24 (1999)
Forest Tree Breeding Institute where a wide range of coniferous tree species occur, suggesting
that habitat selection may be made on the basis of the availability of good food resources.
The concentration of squirrels in three regions of Nopporo Forest Park is probably due
to habitat selection on the basis of good food resources and good locations for building
dreys. Furthermore, habitat selection may be one aspect of an adaptive breeding strategy, if
more squirrels can live in the same area, then perhaps their chances of finding a partner are
increased.
In conclude, tracking red squirrel footprints using flour is a very helpful method for
studying their distribution and their habits. Observations made on these basis indicate that
the red squirrel in Hokkaido selects coniferous forest habitats in summer because they pro-
vide good sources of food and good sites to build dreys. From the standpoints of conser-
vation of this species, maintaining large areas of forest which include or are connected to
areas of coniferous forests are very important. Further studies on impact of environmental
factors on squirrels, such as seasonal changes in habitat quality, predator distribution, and
the significance of forest floor vegetation (especially the presence of bamboo grass) are
needed.
Acknowledgements: We thank Dr. Masaaki Kadosaki for valuable advice and the kind help
during this study; Dr. Hidetsugu Sato for providing the walnuts; Dr. Mark A. Brazil for
critically reading and comments on the final manuscript.
References
Andrén, H. and Delin, A. 1994. Habitat selection in the Eurasian red squirrel, Sciurus vulgaris, in relation to forest
fragmentation. Oikos 70: 43-48.
Andrén, H. and Lemmell, P. A. 1992. Population fluctuations and habitat selection in the Eurasian red squirrel
Sciurus vulgaris. Ecography 15: 303-307.
Brewer, B. A., Lacy, R. C., Foster, M. L. and Alaks, G. 1990. Inbreeding depression in insular and central popu-
lations of Peromyscus mice. Journal of Heredity 81: 257-266.
Celada, C., Bogliani, G., Gariboldi, A. and Maracci, A. 1994. Occupancy of isolated woodlots by the red squirrel
Sciurus vulgaris L. in Italy. Biological Conservation 69: 177-183.
Environment Agency. 1981. Vegetation map, Sapporo and Ebetsu, Tokyo.
Environment Agency. 1983. The foundation investigation of nature conservation: the distribution of wildlife
(mammal) (3). Tokyo, 126 pp. (in Japanese).
Gronwall, O. and Pehrson, A. 1984. Nutrients content of fungi as a primary food of the red squirrel (Sciurus
vulgaris L.). Oecologia 64: 230-231.
Gurnell, J. 1983. Squirrel numbers and the abundance of tree seeds. Mammal Review 13: 133-148.
Gurnell, J. 1987. The Natural History of Squirrels. Christopher Helm, London, 201 pp.
Gurnell, J. and Pepper, H. 1993. A critical look at conserving the British red squirrel Sciurus vulgaris. Mammal
Review 23: 127-137.
Kadosaki, M. 1995. The investigation of an environmental impact statement in RTN region of Ebetsu. Report of
mammals. Ebetsu-shi (in Japanese).
Kadosaki, M. and Inukai, T. 1995. Brown Bear. The Hokkaido Shimbun Press, Sapporo, 365 pp. (in Japanese).
Moller, H. 1983. Foods and foraging behaviour of red (Sciurus vulgaris) and grey (Sciurus carolinensis) squirrels.
Mammal Review 13: 81-98.
Moller, H. 1986. Red squirrel (Sciurus vulgaris) feeding in a Scots pine plantation in Scotland. Journal of Zoology
209: 61-84.
Sapporo District Forestry Office. 1992. Vegetation map of Nopporo Forest Park, Sapporo.
Lee and Fukuda, Eurasian Red Squirrel Habitat Use 5)
Takaragawa, N. 1980. A study on Sciurus vulgaris orientis in a Quercus forest and its neighboring forests in
Obihiro city. M.S. thesis, Obihiro University of Agriculture and Veterinary Medicine, Obihiro, 82 pp. (in
Japanese).
Takaragawa, N. 1996. Eurasian red squirrel. In (T. Kawamichi ed.) The Encyclopaedia of Animals in Japan, I
Mammals 1. Pp. 68-69. Heibonsha, Tokyo (in Japanese).
Tatewaki M. and Igarashi, T. 1973. Botanical survey on the Nopporo National Forest — with special reference to
the forest vegetation. Sapporo Regional Forestry Office, Sapporo, Japan (in Japanese).
Tittensor, A. M. 1970. Red squirrel dreys. Journal of Zoology 162: 528-533.
Van Apeldoorn, R., Celada, C. and Nieuwenhuizen, W. 1994. Distribution and dynamics of the red squirrel
(Sciurus vulgaris L.) in a landscape with fragmented habitat. Landscape Ecology 9: 227-235.
Wauters, L. A. and Dhondt, A. A. 1988. The use of red squirrel Sciurus vulgaris dreys to estimate population
density. Journal of Zoology 214: 179-187.
Wauters, L. A. and Dhondt, A. A. 1990a. Nest-use by red squirrel (Sciurus vulgaris Linnaeus, 1758). Mammalia 54:
377-389.
Wauters, L. A. and Dhondt, A. A. 1990b. Red squirrel (Sciurus vulgaris Linnaeus, 1758) population dynamics in
different habitats. Zeitschrift fiir Sdugetierkunde 55: 161-175.
Wauters, L. A. and Dhondt, A. A. 1992. Space behaviour of red squirrels, Sciurus vulgaris: variation between
habitats and the sexes. Animal Behaviour 43: 297-311.
Wauters, L. A., Hutchinson, Y., Parkin, D. T. and Dhondt, A. A. 1994. The effects of habitat fragmentation
on demography and on the loss of genetic variation in the red squirrel. Proceedings of the Royal Society of
London B 255: 107-111.
Wauters, L. A., Swinnen, C. and Dhondt, A. A. 1992. Activity budget and foraging behaviour of red squirrel
(Sciurus vulgaris) in coniferous and deciduous habitats. Journal of Zoology 227: 71-86.
Wildt, D. E., Bush, M., Goodrowe, K. L., Packer, C., Pusey, A. E., Brown, J. L., Joslin, P. and O’Brien, S. J. O.
1987. Reproductive and genetic consequences of founding isolated lion populations. Nature 329: 328-331.
Received 27 April 1998. Accepted 19 January 1999.
: ziti #3 ienceaieres ae Sonirt
xa hid 7 SS ear prs Paap:
eT sii nd tans Heres
a ‘aye et) nis
u ate f '
s a
oa i
i y e
ar i ee F si
\ ta ty ;
Zt eatin i ee
a ™ ‘i
She ere omc 7 + =
r 1 ra i 4
Mn oy P “ z
ws eh het ive. Ons =
wy eet ‘ - a a -
=) bs
“
i f a
a
i g
‘See 1 3 7 ‘
= 1 z - ‘!
, i. ‘ -
1 a : F; : 7
7 My CA Py
a ; ls
i ‘ i
te 2 Ne < ‘
1 ‘ 7 Ne
j So gahbel }
2) xo ae :
Ni H fi
- ~ AS 2
| ay
« fe >
ao - 2 nea A ees
5 = if i ts :
. :
ans , Lo ei.
3 \ a 24 woe
= =, 4 Hl Y f
j . s
ie vi
¥
J * ©
= tr : ‘
=) a = a
3 ;
, f x
e t
Ri
i s u
- i 1 S
F Te > ’ Fe
4 4 1
= X% >
= Ti
is a ia [aes
= i 2
a a i “
= aly .
i
2 7 2
- ed
ee | € 5 )
= ; é _
a is ~ Z
= ,
{
ay
: ( = \
= prs
f
; ; 4 2
eo
- C PE £
= = %
a= \ x
x i
x % i
= 5
= =
£ - J
£ ~ “Za
3 e
i
a y 7 j
re £ be {
4 ~
y 4 =
P) a, + =
Mammal Study 24: 17-23 (1999)
© the Mammalogical Society of Japan
Molar wear rates in Sika deer during three population phases:
increasing versus decline and post-decline phases
Hiroshi Takahashi!, Koichi Kaji? and Toru Koizumi?
1Graduate School of Environmental Earth Science, Hokkaido University, Sapporo 060-0810, Japan
Hokkaido Institute of Environmental Sciences, Sapporo 060-0819, Japan
3Kyushu Research Center, Forestry and Forest Products Research Institute, Kumamoto 860-0862,
Japan
Abstract. Wear rates of lower first molars (M;) in Sika deer, Cervus nippon, were compared
among the increasing, declining and post-decline phases of population dynamics on Nakano-
shima Island, Hokkaido, Japan, to evaluate the effects of food limitations on deer feeding
ecology. Teeth specimens were collected also from a population in eastern Hokkaido, as
a control, where foods were abundant. The maximum length and width of M, were not
different among the three phases. A linear regression coefficient for log-transformed M,
height against age was not different between males and females, but significantly smaller in
the post-decline phase population than in the increasing phase and the control populations.
The results suggest that M, wear rates increased as food declined.
Key words: Cervus nippon, food limitation, molar wear rates, Nakanoshima Island, popu-
lation phase.
Food limitation influences life history characters of mammals through its effects on their
physical conditions (Fowler 1987). Since tooth wear of ungulates reflects food quality
(Morris 1972; Fortelius 1985) and affects physical condition by its influence on ingestion and
mastication (Skogland 1988), tooth wear rate can be used as an index of life history charac-
ters. For example, female reindeer, Rangifer tarandus, in a low density population showed
lower wear rates of molars than in a high density population (Skogland 1988). Similarly,
tooth wear was related to survival rates of roe deer, Capreolus capreolus (Gaillard et al.
1993) and kudu, Tragelaphus strepsiceros (Owen-Smith 1993). These results suggest that
tooth wear patterns are related to the demography of ungulate species.
Three individuals of Sika deer, Cervus nippon, were introduced to Nakanoshima Island
in Lake Toya, Hokkaido, Japan from 1957 to 1965 (Kaji et al. 1988). The population in-
creased to 299 (57.5/km_2) in 1983, and grazing effects on vegetation became apparent (Kaji et
al. 1991). The population crashed under food limitations in 1984, and gradually recovered
to approximately 180 (34.6/km7?) in recent years (Hokkaido Institute of Environmental
Sciences, hereafter HIES 1997). The dynamics of this population and its impacts on vege-
tation have followed the typical pattern of introduced ungulates (Caughley 1970). We had
‘E-mail: yuji@ees.hokudai.ac.jp
18 Mammal Study 24 (1999)
the opportunity to test the influence of food limitations on tooth wear rates during different
population dynamic phases. Since life history parameters such as fecundity decreased as
food availability declined (Kaji et al. 1988), tooth wear rates may also be an indicator of
population quality if they vary with population phases.
Materials and methods
Tooth samples were collected from naturally dead deer on Nakanoshima Island from
1980 to 1984, and from 1992 to 1997. These were divided into the increasing (1982 or
before), the decline (1983 and 1984) and the post-decline (1985 or after) phase groups accord-
ing to the year of death for each sample (hereafter INC, DEC and POST, respectively). A
control group (CONT) was sampled from the deer killed in pest controls in 1990 in eastern
Hokkaido, where the population showed high fat reserves (Yokoyama et al. 1996) and high
reproductive rates (Suzuki and Ohtaishi 1993), which indicate good nutrition.
Age of each sample was determined by cementum annuli from the first incisors or the
first molars after Ohtaishi (1980). The lower first molar (M,) was used to measure wear rates
because it has the longest exposure to wear. Morris (1972) recommended measuring the area
of exposed dentine to assess tooth wear because of ever-increasing quantity. However, in
many of our samples, wear extended over the entire occlusal area, and the area of dentine
exposed reached the ceiling. Therefore, we measured the crest height from the cervical line
to the postloph lingual crest (Ohtaishi 1980) to the nearest 0.01 mm with a caliper. The
maximum M, length and width were also measured for samples from Nakanoshima Island in
order to compare M, size among the different phases.
We obtained samples ten years old and older from the POST, but not from other
phases. To compare wear rates in equivalent age classes, only samples under ten years of
age were used in the analysis. The M, length and width were compared between sexes and
among the phases by two-way ANOVA. Linear regression coefficients for the log-trans-
formed crest height against age were compared between sexes and across phases. If ANOVA
for parallelism of regression lines proved significant, multiple comparisons of regression
coefficients were carried out using the Tukey-Kramer method (Sokal and Rohlf 1995).
Results
The means of the maximum M, length and width of the three phases are shown in Table
1. Both the length and width were significantly different between sexes (two-way ANOVA:
Table 1. Mean (+SD) of maximum M, length and width by sex in each phase.
Phase Sex n Length (mm) Width (mm)
Increasing Female 6 16.14+0.28 11.09+0.61
Male 7 16.37+0.65 11.56+0.33
Decline Female 18 16.28 +0.64 11.39+0.40
Male 30 16.33 +0.56 11.49+0.44
Post-decline Female 22 16.12+0.54 11.14+0.60
Male 14 16.66+0.43 11.44+0.45
Takahashi et al., Molar wear rates in Sika deer 19
length, F;,9,=4.013, P=0.048; width, F;,9;=5.459, P=0.022), but not among phases
(length, F>,5,=0.641, P=0.529; width, Fy 9,=1.265, P=0.287), and sex-phase interaction
was not significant (length, Fy, 9,=1.796, P=0.172; width, F,,5,;=0.807, P=0.449). This
suggests that M, size is a sexually dimorphic character unrelated to food limitation.
Increasing
phase
@ Male
O Female
Decline
phase
Log M1 height (mm)
1 3 5 7, 9
Age (year)
Fig. 1. Changes in log-transformed M, height with age in Sika deer during three population phases on Nakano-
shima Island and in deer from eastern Hokkaido (control).
20 Mammal Study 24 (1999)
Table 2. Regression coefficients for log M, height against age (b) by sex in each sample group.
Female Male Carnal
Sample group SaaS
n b SE P n b SE P difference
Increasing phase 7 —0.033 0.009 ‘3 10 —0.030 0.005 es ns
Decline phase 18 —0.053 0.004 we 30 —0.047 0.005 ae ns
Post-decline phase 22 —0.053 0.004 oe 14 —0.056 0.008 ao" ns
Control 55 —0.040 0.002 ea 109 —0.036 0.004 cs ns
P (two-tailed): *, <0.05; **, <0.001.
Table 3. Regression coefficients for log M, height against age (b) in each sample group con-
taining both sexes.
Sample group n b SE P
Increasing phase 17 = 02032 0.004 <0.001
Decline phase 48 —0.050 0.003 <0.001
Post-decline phase 36 —0.054 0.004 <0.001
Control 164 ami) .039 0.002 <0.001
Changes in log-transformed crest height with age are shown in Fig. 1. Sexual differences
in regression coefficients of log M, height against age were not detected within each phase
group nor in the mainland control group (ANOVA for parallelism of regression lines: F; 3
=0.083, P=0.219 for INC; F,, 16=0.605, P=0.448 for DEC; F;, }>=0.066, P=0.199 for
POST; F,, 2=0.553, P=0.472 for CONT; Table 2). Therefore, data of both sexes were
pooled to increase sample sizes, and regression coefficients were recalculated (Table 3).
ANOVA detected significant differences among the three phases (F3, 4.=4.880, P=0.006),
and multiple comparison showed significant differences between INC and POST (P< 0.05)
and between POST and CONT (P<0.05). These results suggest that wear rates of M, in
INC were equivalent to those in CONT, and that the wear rates in POST were higher than
those in INC.
Discussion
On Nakanoshima Island, food resources were abundant in 1980, but the deer began to
consume more tree bark as palatable plants declined in 1982 and 1983 (Kaji et al. 1991).
Thereafter, production in short-grass communities during summer decreased from 198.6
g/m? in 1984 to 63.9 g/m? (average, 1992-1994, Miyaki et al. 1995). Available understory
plants were scarce and the deer were obliged to consume short greens and fallen leaves. The
production of fallen leaves was estimated to be 28.7 kg/ha/month in July 1994, while that of
the short-grass communities was simultaneously estimated to be 144.4 kg/ha/month (Miyaki
et al. 1995). However, due to the limited area of short-grass communities (0.4% of the is-
land), and the fact that deer can use them only during the snow-free season (late April to
October), the short greens could support only 29 deer (14% of the population) even in sum-
mer, and the deer would depend mostly on fallen leaves (Miyaki et al. 1995). Thus, high
quality forage was not available in either DEC which experienced sudden food shortage, or
Takahashi et al., Molar wear rates in Sika deer 21
in POST which faced continuous food limitations. Consequently, wear rates in DEC were
not apparently different from INC, while those in POST were significantly higher than in
INC and CONT. In addition to experiencing changes in food quality, deer were often ob-
served to ingest soil when grazing. Similar reports have been made of higher tooth wear
rates associated with soil ingestion by white-tailed deer, Odocoileus virginianus (Rue 1978)
and with the presence of abrasive elements in the diet of Spanish ibex, Capra pyrenaica
(Fandos et al. 1993). Previous studies demonstrated that food limited populations showed
higher wear rates than food rich populations in reindeer (Skogland 1988) and Spanish ibex
(Fandos et al. 1993). In this study, we found that a deer population under food limitations
showed higher wear rates than when under food rich conditions.
On Nakanoshima Island, body size of Sika deer and degree of sexual dimorphism were
reduced by the effects of food limitation (Kaji et al. 1988). In this study, however, M, sizes
(length and width) were different between sexes but not among the three phase groups. Since
M, reaches a given size before skeletal growth is completed (Fortelius 1985), M, sizes may not
be as influenced by food limitation as skeletal sizes are. Tooth size appears not to affect
wear rates.
Some studies have suggested that higher teeth wear rates in males are a result of the
male’s greater food consumption associated with larger body size (black-tailed deer,
Odocoileus hemionus columbianus, Thomas and Bandy 1975; Sika deer, Ohtaishi 1976;
Takatsuki 1998), although statistically significant differences were either unexamined or
equivocal. Takatsuki (1998) showed that wear rates of first incisor were higher in male sika
deer than in females on Kinkazan Island, where males consumed foods of lower quality, but
not obviously different in Mt. Goyo, where higher quality foods were available to both
sexes. Since tooth wear reflects diets of animals for a given period, sexual differences in wear
rates might arise when sexual differences in food habits occur and continue for certain
periods. Under food rich conditions, high quality foods may be consumed by both males
and females. On the other hand, under the food limitations on Nakanoshima Island, both
sexes were forced to consume low quality foods. These situations would make sexual
differences in food habits unclear, consequently obscuring sexual differences in wear rates.
In addition, the patterns of sexual differences in molar wear may differ from that in incisor
wear.
The results of the present study rely on the accuracy of age estimation. McCullough
(1996) pointed out that the cementum aging technique in white-tailed deer sometimes failed
because the cementum annuli disappeared when a population density was low and available
forage was relatively abundant. If our age estimates are similarly biased, older animals of
INC and DEC would have had more years during times of relative food abundance.
Similarly, samples of the CONT were collected in 1990 when the deer were well nourished
irrespective of age (Yokoyama et al. 1996). In these cases, since the regression slopes may
become less steep in INC and DEC or be unchanged in CONT, differences between regression
slopes of INC and POST would be even greater. Thus, our conclusion that wear rates
increased substantially during the post-decline phase would not be affected greatly by
underestimates of age.
In conclusion, both the duration and the extent of food limitations clearly contribute
to differences in tooth wear rates. Tooth wear seems to be not only population-specific as
Fandos et al. (1993) suggested, but also population phase-specific. Tooth wear rates could
22 Mammal Study 24 (1999)
be a relative indicator of population health and food conditions.
Acknowledgements: We are grateful to Mr N. Hachiya, Drs M. Suzuki, H. Tsuruga, and
Mr K. Yoshida for technical consultation and assistance in age determination, and to Ms C.
Katsuta for help to measure the specimens. We thank Drs S. Higashi, D. R. McCullough,
N. Tyler, N. Ohtaishi and Mr M. Miyaki for useful comments on the earlier draft, Mr J. P.
Moll for helping with English. Two anonymous referees improved the manuscript. We are
also indebted to Toya-Ko Kisen Co. Inc., and Toya Lake Station for Environmental Biology,
Hokkaido University for supporting during the field study.
References
Caughley, G. 1970. Eruption of ungulate populations, with emphasis on Himalayan thar in New Zealand. Ecology
SS 538} 7/72,
Fandos, P., Orueta, J. F. and Aranda, Y. 1993. Tooth wear and its relation to kind of food: the repercussion on
age criteria in Capra pyrenaica. Acta Theriologica 38: 93-102.
Fortelius, M. 1985. Ungulate cheek teeth: developmental, functional, and evolutionary interrelations. Acta
Zoologica Fennica 180: 1-76.
Fowler, C. W. 1987. A review of density dependence in populations of large mammals. In (H. H. Genoways, ed.)
Current Mammalogy 1. Pp. 401-441. Plenum Press, N.Y.
Gaillard, J. M., Delorme, D., Boutin, J. M., Van Laere, G., Boisaubert, B. and Pradel, R. 1993. Roe deer survival
patterns: a comparative analysis of contrasting populations. Journal of Animal Ecology 62: 778-791.
Hokkaido Institute of Environmental Sciences. 1997. Results of a survey related sika deer and brown bear in
Hokkaido III. 100+6 pp. (in Japanese).
Kaji, K., Koizumi, T. and Ohtaishi, N. 1988. Effects of resource limitation on the physical and reproductive
condition of Sika deer on Nakanoshima Island, Hokkaido. Acta Theriologica 33: 187-208.
Kaji, K., Yajima, T. and Igarashi, T. 1991. Forage selection by introduced deer on Nakanoshima Island, and its
effect on the forest vegetation. In (N. Maruyama et al. eds.) Proceedings of the International Symposium on
Wildlife Conservation, in INTECOL 1990. Pp. 52-55. Japan Wildlife Research Center, Tokyo.
McCullough, D. R. 1996. Failure of the tooth cementum aging technique with reduced population density of deer.
Wildlife Society Bulletin 24: 722-724.
Miyaki, M., Hori, S., Nishikawa, Y. and Kaji, K. 1995. A research on carring capacity for Sika deer on
Nakanoshima Island, Lake Toya. In Landscape Ecological Study for Basin Management. Pp. 143-147.
Hokkaido Technical Center of Forest Management (in Japanese).
Morris, P. 1972. A review of mammalian age determination methods. Mammal Review 2: 69-104.
Ohtaishi, N. 1976. Wear on incisiform teeth as an index to the age of Japanese deer at Nara Park. Annual Report
of Nara Deer Research Association 2: 71-82 (in Japanese with English summary).
Ohtaishi, N. 1980. Determination of sex, age and death-season of recovered remains of Sika deer (Cervus nippon)
by jaw and tooth-cement. Koukogaku to Shizenkagaku (Archaeology and Natural Science) 13: 51-74 (in
Japanese with English summary).
Owen-Smith, N. 1993. Comparative mortality rates of male and female kudus: the costs of sexual size dimorphism.
Journal of Animal Ecology 62: 428-440.
Rue, L. L. 1978. The Deer of North America. Times Mirror Magazines, Inc., N.Y. 463 pp.
Skogland, T. 1988. Tooth wear by food limitation and its life history consequences in wild reindeer. Oikos 51:
238-242.
Sokal, R. R. and Rohlf, F. J. 1995. Biometry, 3rd edn. Freedman and Company, N. Y. 887 pp.
Suzuki, M. and Ohtaishi, N. 1993. Reproduction of female sika deer (Cervus nippon yesoensis Heude, 1884) in
Ashoro District, Hokkaido. Journal of Veterinary Medical Science 55: 833-836.
Takatsuki, S. 1998. The life of Sika deer read from a tooth. Iwanami Shoten Press, Tokyo. 143+3 pp. (in
Japanese).
Takahashi et al., Molar wear rates in Sika deer 23
Thomas, D.C. and Bandy, P. J. 1975. Accuracy of dental-wear age estimates of black-tailed deer. Journal of
Wildlife Management 39: 674-678.
Yokoyama, M., Maruyama, N., Kaji, K. and Suzuki, M. 1996. Seasonal change of body fat reserves in sika deer of
east Hokkaido, Japan. Journal of Wildlife Research 1: 57-61.
Received 31 August 1998. Accepted 16 April 1999.
Pa
‘he
iy
*
3 .
a s
oie Sian
r es ¥
=~ u aa
oa Sat
{ F y
A Os
e Roa! <
ay : gy , if
i - fy fa vias =) fo a
J i Spr Ae : i
SS Paleo . _ es
sy A i i ee ae
—aow,s ) ‘i = 2
" = a i +! ; 7 i ‘eal ;
° ae Shae i - ;
iy i cee si 4 Ba if
: | , ‘
A vue H i ye Al \ i
= ? > ee . i
Tora J ’ x
4 mel sa 7 -
5 - Ges
N ;
. = oe ak ; ;
* tS r x a Oa ry
elias \, i
t Sth Sn) es fl 2 = ;
4 ia.
4 P % fe AS 4 F
tie
4 aes eer : Wy
2 ) i y as
{ ae & : “ >
f en Sos ei :
i } eG: A oe ae i vas
Bi 5 5
i y a 7 - - \\ i
. , \
Lr : a
- 7 t bere 3 =f
% ; s ‘
Wit = ta "
S >
s een 7 A eroed oy » :
Me 1 ; mo
a7 F
che ree 3 2
raed Ae f .
~ M
7 } 4 =
= eile
, = << see =—
) d We :
t hy =
s iy <
s oat ‘ 3 ek 4 p
fé a 2 Que . “ ‘
Y td 7 M y
N a } 7 ae:
; é oars 4
fae ears a ’ n sexs
. — 3 Beer
A = : Z Ss
L , .
nd ee * } i ¢ i
zs ene
i, { ) uJ i ’ we
‘ ( - Me) 3} j r
”, # 4
Jak , 2 iy 4, 3
(eget . Re)
= ra NP) j =
emai * F
‘
# § '
‘ a G és
C t Bon, i
- \ 1 =
)
rn See Sy /
i= i
s a "
= / ‘ ak
2 q 7 jf faa
: one A - ~
regen ef *
\ E
Mammal Study 24: 25-33 (1999)
© the Mammalogical Society of Japan
Genetic relationships within and between the Japanese marten
Martes melampus and the sable M. zibellina, based on variation
of mitochondrial DNA and nuclear ribosomal DNA
Tetsuji Hosoda!, Hitoshi Suzuki?, Masahiro A. Iwasa?, Mitsuhiro Hayashida‘,
Shigeki Watanabe*, Masaya Tatara® and Kimiyuki Tsuchiya’
1Gobo Shoko High School, 43-1 Komatsubara, Yukawa, Gobo 644-0012, Japan
2,3Graduate School of Environmental Earth Science, Hokkaido University, North 10, West 5, Kita-ku,
Sapporo 060-0810, Japan
4Faculty of Agriculture, Yamagata University, Tsuruoka 997-8555, Japan
52-24-5 Ao-madanihigashi, Mino 562-0022, Japan
6Wildlife Conservation Centre of Tsushima, Nature Conservation Bureau, Environment Agency,
Saozaki, Kami-agata, Nagasaki 817-1600, Japan
1Miyazaki Medical College, 5200 Kihara, Kiyotake-cho, Miyazaki 889-1692, Japan
Abstract. We examined the intra- and inter-specific genetic relationships of the Japanese
marten Martes melampus and the sable M. zibellina using cytoplasmic and nuclear DNA
markers. The interspecific sequence divergences in the 402 base pairs of the mitochon-
drial cytochrome b gene averaged 3.3%. The extent of the divergences among thirteen indi-
viduals of M. melampus collected from Honshu, Shikoku, Kyushu and Tsushima was small
(S0.5%), irrespective of their fur color variation. A somewhat higher degree of intra-
specific variation (up to 1.3%) was observed among M. zibellina specimens, but the extent of
inter-populational variation between Primorye, Russia, and Hokkaido, Japan, was not so
high (minimum 0.2%), suggesting that there has been recent genetic communication between
Hokkaido and the continent. Among the 24 restriction sites of the nuclear ribosomal DNA
spacer, there was no difference within either species, however one site differed between the
two species. Using these molecular markers we confirmed that an amimal from Hokkaido,
showing the typical morphological characteristics of M. melampus, possessed the same
genotype as M. melampus from Honshu. From these results and descriptions in the litera-
ture, we presumed that the animal in question could be a descendent of M. melampus intro-
duced to Hokkaido from Honshu by fur farmers about 50 years earlier. Eight animals
examined from Hokkaido showed no indication of hybridization between the two species.
Key words: Japanese marten Martes melampus, sable Martes zibellina, geographic varia-
tion, mitochondrial cytochrome Db, ribosomal DNA.
Two species of martens, the sable Martes zibellina, and the Japanese marten M. melampus,
occur naturally in the Japanese archipelago. The sable ranges across the northern part of
1E-mail: tehosoda@wakayamanet.or.jp
26 Mammal Study 24 (1999)
the Eurasian Continent, and the population occurring on Hokkaido, Japan, is described as
the endemic subspecies M. z. brachyura. Martes melampus occurs in the main Japanese
archipelago, southern Hokkaido, and the Korean Peninsula. Three separate subspecies are
recognized on the basis of differences in their coat coloration (Anderson 1970; Corbet 1978):
M. m. melampus on Honshu, Shikoku, and Kyushu; M. m. tsuensis on Tsushima Island;
M. m. coreensis on the Korean Peninsula (although the reliability of its identity is still con-
troversial). Martes zibellina shows within population, regional, and seasonal variation in fur
color and quality (Ognev 1931; Stroganov 1962; Anderson 1970). In winter, the sable’s fur
color ranges from light yellow or grayish brown, often with a russet tinge, to dark blackish-
brown. A very dark and silky fur characterizes the sables occurring in Transbaikalia and
southern Yakutia, Russia, while from the west to east the color gradually becomes paler, and
the fur becomes coarser. In general, however, there is considerable fur color variations
within populations (Stroganov 1962).
Martes zibellina of Hokkaido also shows fur color variation, from pale yellow, to cork
colored, and to dark brown (Imaizumi 1986). The color of those with yellowish fur is
indistinguishable from yellow specimens of M. melampus from northern Honshu. Martes
melampus from Kyushu and Honshu (except for the southern part of the Kii Peninsula),
having body fur which changes from dark brown to yellow in winter, tends to show some
regional variation in fur color (Hosoda and Oshima 1993). The head remains light gray, and
the legs are dark brown. Individuals from the the Tohoku region of northern Honshu are
a particularly vivid yellow. In contrast, individuals from the southern Kii Peninsula, from
Shikoku and Tsushima, remain dark brown throughout the winter, although the throat is
either yellow or pale yellow (Hosoda and Oshima 1993). The evolutionary history of these
two closely related species remains largely unknown, and no evaluations of genetic differen-
tiation among the regional populations based on fur-color variation have been made.
Martes melampus have been introduced to various parts of Japan where this species did
not occur naturally, in particular to Sado Island and Hokkaido. Just before World War II,
M. melampus was introduced from the Tohoku region to a breeding farm near Sapporo,
Hokkaido. When feed became unavailable during the war, the animals were released into
the wild (Inukai 1975). That they and their descendants survived, and are still being ob-
served in southern Hokkaido has been noted by Inukai (1975) and Kadosaki (1996). Given
that the two species are thought to have a similar chromosomal constitution, with the same
diploid number and fundamental arm number, then hybridization may have occurred or be
occurring between the Hokkaido native M. z. brachyura and introduced M. melampus
(Tsuchiya 1979; Obara 1982, 1991; Tsuchiya unpublished). Natural hybrid between the two
sympatric Martes species, M. zibellina and the pine marten M. martes in the Pechora Basin
and the trans-Urals of Russia, have been reported (Ognev 1931; Novikov 1962; see for review
Anderson 1970; Corbet 1978). Thus hybridization between sympatrically occuring closely
related Martes species is not only possible, but also perhaps even likely.
Two molecular markers have been used so far in evaluating the genetic relationship
between M. melampus and M. zibellina, firstly the restriction fragment length polymorphism
(RFLP) of the nuclear ribosomal DNA (rDNA) spacer (Hosoda et al. 1993, 1997), and
secondly the mitochondrial cytochrome b (cyt b) gene sequences (Masuda and Yoshida
1994b). We used these markers to reveal the extent of intra- and inter-specific variation
between the two species. We also examined one M. melampus from Hokkaido genetically,
Hosoda et al., Genetic relationships of martens in Japan 27
and discussed the possibility of interspecies hybridization in nature.
Materials and methods
DNA samples
DNA was extracted from liver tissues of M. zibellina and M. melampus from a range of
localities, using the method described by Maniatis et al. (1982) (see Table 1 and Fig. 1).
Direct sequencing of cyt b gene
Semi-nested polymerase chain reactions (PCRs), and direct sequencing were performed
following methods previously described by Suzuki et al. (1997). The universal primers
L14724 and H15915 (Kocher et al. 1989) were used for the first PCR, and R-L14724 and U-
H15155 (Suzuki et al. 1997) were used for the second PCR. Then both strands of the second
PCR product were sequenced directly by an automated sequencer (model 373A; ABI).
Table 1. Profiles of samples used and specific types of mtDNA.
Genus Species Serial no. and locality Sample no. Sex Type of mtDNA
Martes
M. zibellina
1. Khabarovsk, Russia VK183 unknown Mzil
HS949 unknown Mzi2
2. Hokkaido, Japan TH043 male Mzi3
TH044 male Mzi3
TH045 male Mzi3
TH047 male Mzi3
TH053 male Mzi3
TH107 male Mzi3
HEG293 male Mzi3
M. melampus
3. Hokkaido, Japan TH048 male Mmel
4. Tochigi, Japan THO17 female Mmel
5. Niigata, Japan THO006 male Mmel
6. Wakayama, Japan TH020 male Mmel
7. Shimane, Japan THO18 male Mmel
8. Miyazaki, Japan HS862 male Mmel
9. Tokushima, Japan TH131 male Mmel
TH176 male Mmel
THO10 male Mme2
TH175 female Mme2
10. Tsushima Is., Japan TH004 female Mme3
THO005 male Mme3
THO007 male Mme3
Mustela
M. itatsi
11. Aomori, Japan THO089 male Mit
M. sibirica
12. Vladivostok, Russia HS1223 male Msi
28 Mammal Study 24 (1999)
Russia
Sado Island
1
ae. 5
a
Kui Peninsula
125° E 130° 135° 140° 145°
Fig. 1. Localities from which individuals of Martes zibellina (closed circles) and M. melampus (open circles) were
collected for this study. (Numbers beside collection points refer to Table 1).
Construction of phylogenetic trees
We produced a matrix of sequence divergence for all possible combinations of mtDNA
sequences (Table 1) using the computer program DNADIST in PHYLIP 3.5 (Felsenstein
1993) and Kimura’s two parameter method (Kimura 1980). We constructed a phylogenetic
tree using the neighbor-joining (NJ) method (Saitou and Nei 1987) using the computer pro-
gram NEIGHBOR in PHYLIP 3.5. Confidence levels for each grouping were calculated
using the bootstrap program SEQBOOT (with 1,000 replications) in the PHYLIP package.
The tree was produced using the CONSENCE program in the PHYLIP package.
Analysis of rDNA RFLP
Variations in rDNA were examined using Southern’s blot analysis (Southern 1975).
For the construction of restriction maps of the various types of rDNA repeating units, the
genomic DNAs were digested with twelve restriction enzymes: Aatl, BamHI, Bcll, Bell,
Dral, EcoRI, HindIll, Kpni, PstI, Pvull, Sacl and Xbal. The digested DNAs blotted on
nylon filters were hybridized sequentially with three 32P-labeled rDNA probes as described by
Hosoda et al. (1993).
Hosoda et al., Genetic relationships of martens in Japan
Results
Variations in mtDNA
We determined partial sequences (402 base pairs (bp)) of cyt b genes of 22 martens, and
two weasels (Mustela sibirica and M. itatsi) as an outgroup (Table 1, Fig. 2), and calculated
the sequence divergence. Based on the extent of the sequence divergence, we constructed a
phylogenetic tree using the NJ method (Fig. 3). The sequence divergence between Martes
melampus and M. zibellina was 2.6-3.9% (3.3% on average), which was similar to the
degree of divergence found between M. sibirica (Msi) and M. itatsi (Mit), 4.3%. Both M.
melampus (Mme) and M. zibellina (Mzi) had three haplotypes (Mmel, Mme2, Mme3 and
Mzil, Mzi2, Mzi3). Martes melampus of Honshu (Niigata, Tochigi, Shimane and Wakayama
prefectures) and Kyushu (Miyazaki) were monomorphic (Mmel only), while the Shikoku
population had two haplotypes (Mmel and Mme2), and two individuals from Tsushima
10 20 30 40 50 60 70 80
Mzil ATGACCAACA TTCGTAAAAC TCACCCACTA GCTAAAATCA TCAACAATTC ATTCATCGAC TTACCTGCCC CATCAAACAT
[MP2ILZ):. igs GIGUCECE CRORE RRC RCE RRO
MZOOMMEMEEONcislecc los heice eee e sweenls gues 6 Ba Giore evade ely Tete altete Goetare el Yaie oreo ew Se esse miele’ ue: avaetheterie ere
90 100 110 120 130 140 150 160
170 180 190 200 210 220 230 240
250 260 270 280 290 300 310 320
330 340 350 360 370 380 390 400
Fig. 2. Partial sequences of the mitochondrial cytochrome b gene for martens and the outgroup, Mustela. The
abbreviations of the gene types are as in Table 1.
30 Mammal Study 24 (1999)
Aomori (TH089) Mit Mustela itatsi
Russia (HS1223) Msi Mustela sibirica
Hokkaido (TH048)
Niigata(TH006)
Tochigi (TH017)
Wakayama (TH020)
Shimane (TH018)
Tokushima (TH131)
Tokushima (TH176) Martes melampus
Miyazaki (HS862)
Tokushima (TH010)
631 Tokushima (TH175) | Mme2
Tsushima (TH004)
100 70] Tsushima (TH005) Mme3
Tsushima (TH007)
Mmel
97
Russia (VK183) Mzil
Russia (HS949) Mzi2
99 Hokkaido (TH043)
Hokkaido (TH044)
Hokkaido (TH045)
Hokkaido (TH047) Mzi3
Hokkaido (TH053)
Hokkaido (TH107)
Hokkaido (HEG293)
0.01 93
Martes zibellina
Fig. 3. A neighbor-joining tree constructed from the cytochrome b gene sequences (402 bp) of 22 individuals of
Martes. Two species of Mustela were used as an outgroup. The bootstrap scores above each branch are expressed
in percentages of 1,000 replicates.
possessed one specific type, Mme3. All seven animals of M. zibellina from Hokkaido shared
a common sequence (Mzi3), while two individuals from Khabarovsk had different types
(Mzil and Mzi2) revealing a rather considerable extent of intra-population variation (1.0%
sequence divergence). There was, however, only 0.2% (1/402 bp) sequence divergence be-
tween one of the continental types, Mzi2, and the Hokkaido type, Mzi3.
Variation in rDNA
We examined the nuclear rDNA-RFLP with 12 restriction enzymes and compared 24
restriction sites along with the external spacer regions of rDNA from 14 M. melampus and
M. zibellina (Table 1). As Hosoda et al. (1993) reported, only the BglII site(s) located up-
stream from the 5’ end of the 18S rRNA gene differs between the two species: 19 kb for M.
melampus and 15 kb for M. zibellina. We found no variation within the species.
Martes melampus in Hokkaido
Since one yellow animal, obtained from Sapporo, was morphologically similar to M.
melampus, we examined genetic characteristics of the two molecular markers. It proved to
have a cyt b sequence Mmel specific to M. melampus (Table 1). With the 18S rDNA probe,
the 19kb Beg/II band was detected, but the 15 kb band, which is specific to M. zibellina, was
definitely absent. Since patterns of nuclear rDNA may reflect a specific kind of genomic
status (i.e., the band represents a hundred copies of repeating units that are generally dis-
Hosoda et al., Genetic relationships of martens in Japan 31
persed among different chromosome loci), the rDNA profile is likely to indicate the status of
most of the other nuclear genes in this individual.
Discussion
Interspecies relationships
One of our aims in this study was to evaluate the genetic relationship between M.
melampus and M. zibellina in Hokkaido, from both evolutionary and current perspectives.
The extent of the divergence of the cyt b gene (3.3%) between these two species was almost
the same as the divergence between the Japanese and Siberian weasels (Fig. 3; Masuda
and Yoshida 1994a). Masuda and Yoshida (1994a) estimated, on the basis of the sequence
divergence of the cyt b gene region (375 bp) is 4.0-4.3%, that the split between the two
weasel species occurred some 1.6-1.7 million years ago. The differentiation of the two
marten species is also evident from the rDNA-RFLP data (Hosoda et al. 1993), leading us to
presume that these two species have also genetically differentiated considerably, during the
last one or two million years. Although the existence of land bridges between Honshu and
Hokkaido during recent ice ages may have presented several opportunities for hybridization,
it is also possible that the two species could have maintained their own genetic independence
without exchanging genetic elements.
In order to evaluate the possibility of genetic hybridization between the two species
under natural condition, it was necessary to examine individuals from a site where both
species occur. Considering the limited literature available (Inukai 1975) and the patterns
of mtDNA and rDNA, it seemed most likely that M. melampus from Sapporo, in western
Hokkaido, would be the descendants of translocated martens from Honshu which were
then released or escaped from fur farms half a century ago. We did not find any sign of
interspecific hybridization in this sample, or among seven sable from Teshio (northern
Hokkaido), indicating that hybridization between these two species is unlikely. As there
have been, however, several cases of natural hybridization between continental martens, such
as between M. zibellina and M. martes (Anderson 1970; Corbet 1978), a continuous survey of
a suitable sample size is necessary to finally conclude the possibility of natural hybridization
between M. melampus and M. zibellina. Such a study would also be useful for estimating
the risk of genetic contamination through introduced animals.
Geographic variation
Mitochondrial DNA sequence variation within each species was not great (Fig. 3).
Martes melampus tsuensis from Tsushima are distinguishable as a separate subspecies from
other geographic populations on the basis of their morphological differences (see Introduc-
tion, Anderson 1970). The types of mtDNA differed only slightly between the subspecies,
with only one base substitution among the 402 bp sequence. This result suggests that there
has been some recent (in geological terms) genetic exchange between the Tsushima and
mainland Japanese populations of this species, probably during the late Pleistocene.
We examined M. zibellina from just two localities, Teshio, in Hokkaido (seven indi-
viduals), and Khabarovsk, Russia (two individuals); and found no substantial differences in
the cyt b of the two populations. The Hokkaido type Mzi3 differed from the Russian type
Mzi2 by only one base among the 402 sites (Fig. 2), indicating that there has been recent
25 Mammal Study 24 (1999)
divergence between Hokkaido and the Russian Far East populations. In the case of the red
fox, Vulpes vulpes, the mtDNA D-loop sequences of individuals from Hokkaido and from
the Russian Far East are involved in a clade with a small extent of polymorphism (Tsuda et
al. 1997). These results, for both fox and sable, are consistent with the fact that Hokkaido
was periodically connected to the continent by ice age land bridges, and only finally isolated
within the last 10,000 years (e.g. Oshima 1990). It is now evident that carnivorous mammals
ranged across both the Russian Far East and Hokkaido exchanging genetic elements between
these now isolated geographic regions, during a geologically recent period.
Acknowledgements: The authors are very grateful to Drs. Alexei P. Kryukov, Sang-Hoon
Han, Vladimir P. Korablev, Toru Ikeda, Koji Uraguchi, Hisashi Yanagawa and Mr. Mitsuru
Mukoyama for supplying tissue samples and morphological information on specimens. We
also thank Dr. Hisashi Abe and Mr. Masayoshi Tawara for providing information on the
history of the Japanese marten introduction to Hokkaido. We are very grateful to Dr. Mark
Brazil for improving the English manuscript. This study was partly funded by Grants-in-Aid
for Scientific Research from the Ministry of Education, Science and Culture, Japan. The
nucleotide sequences can be reached in the DDBJ, EMBL and Gen Bank with following
accession numbers: AB029420-AB029422, AB029424-AB029428.
References
Anderson, E. 1970. Quarternary evolution of the genus Martes. (Carnivora, Mustelidae). Acta Zoologica Fennica
130: 1-133.
Corbet, G. B. 1978. The mammals of the Palaearctic Region: a taxonomic review. British Museum Natural History
London, 314 pp.
Felsenstein, J. 1993. PHYLIP: Phylogenetic inference package, version 3.5. Department of Genetics, University of
Washington, Seattle.
Hosoda, T., Suzuki, H., Yamada, T. and Tsuchiya, K. 1993. Restriction site polymorphism in the ribosomal DNA
of eight species of Canidae and Mustelidae. Cytologia 58: 223-230.
Hosoda, T. and Oshima, K. 1993. Color variation of the fur of Japanese marten (Martes melampus melampus
Wagner) in Japan. Nankiseibutu 35: 19-23 (in Japanese with English summary).
Hosoda, T., Suzuki, H., Tsuchiya, K., Lan, H., Shi, L. and Kryukov, A. P. 1997. Phylogenetic relationships
within Martes based on nuclear ribosomal DNA and mitochondrial DNA. In (G. Proulx, H. N. Bryant, and
P.M. Woodard., eds.) Martes: Taxonomy, Ecology, Techniques, and Management. Pp. 3-14. Provincial
Museum of Alberta, Edmonton.
Imaizumi, T. 1986. Weasels and Martens. Jiyukokuminsha, 126 pp. (in Japanese).
Inukai, T. 1975. Animals in the Northernmost Japan, Hokuensha, 152 pp. (in Japanese).
Kadosaki, M. 1996. Wild Traces in Hokkaido, Hokkaido-shuppan, 303 pp. (in Japanese).
Kimura, M. 1980. A simple method for estimating evolutionary rates of base substitutions through comparative
studies of nucleotide sequences. Journal of Molecular Evolution 16: 111-120.
Kocher, T. D., Thomas, W. K., Meyer, A., Edwards, S. V., Paabo, S., Villablanca, F. X. and Wilson, A. C. 1989.
Dynamics of mitochondrial DNA evolution in mammals: amplification and sequencing with conserved primers.
Proceedings of National Academy of Science, USA 86: 6196-6200.
Maniatis, T., Fritsch, E. F. and Sambrook, J. 1982. Molecular Cloning. Cold Spring Harbor. New York, 545 pp.
Masuda, R. and Yoshida, M. C. 1994a. Nucleotide sequence variation of cytochrome b genes in three species of
weasels, Mustela itatsi, Mustela sibirica, and Mustela nivalis, detected by improved PCR product-direct se-
quencing technique. Journal of the Mammalogical Society of Japan 19: 33-43.
Masuda, R. and Yoshida, M. C. 1994b. A molecular phylogeny of the family Mustelidae (Mammalia, Carnivora),
based on comparison of mitochondrial cytochrome b nucleotide sequences. Zoological Science 11: 605-612.
Hosoda et al., Genetic relationships of martens in Japan 33
Novikov, G. A. 1962. Fauna of the U.S.S.R.62. Carnivorous mammals. Israel Scientific Translations Program,
Jerusalem, 816 pp.
Obara, Y. 1982. C- and G-banded karyotypes of the Japanese marten, Martes melampus melampus. Chromosome
Information Service 33: 21-23.
Obara, Y. 1991. Karyosystematics of the mustelid carnivores of Japan. Honyurui Kagaku [Mammalian Science] 30:
197—220 (in Japanese).
Ognev, S. I. 1931. Mammals of Eastern Europe and Northern Asia. Vol. II. Carnivora (Fissipedia). (1962, Israel
Scientific Translations Program, Jerusalem), 589 pp.
Oshima, K. 1990. The history of straits around the Japanese islands in the Late-Quaternary. The Quaternary
Research 29: 193-208 (in Japanese with English abstract).
Saitou, N. and Nei, M. 1987. The neighbor-joining method: a new method for reconstructing phylogenetic trees.
Molecular Biology and Evolution 4: 406-425.
Southern, E. M. 1975. Detection of specific sequences among DNA fragments separated by gel electrophoresis.
Journal of Molecular Evolution 98: 503-517.
Suzuki H., Minato, S., Sakurai, S., Tsuchiya, K. and Fokin, I. M. 1997. Phylogenetic position and geographic
differentiation of the Japanese dormouse, Glirulus japonicus, revealed by variations among rDNA, mtDNA and
the Sry gene. Zoological Science 14: 167-173.
Stroganov, S. U. 1962. Carnivorous Mammals of Siberia. (1969, Israel Scientific Translations Program, Jerusalem),
522 pp.
Tsuchiya, K. 1979. A contribution to the chromosome study in Japanese mammals. Proceeding of the Japan
Academy 55(B): 191-195.
Tsuda, K., Kikkawa, Y., Yonekawa, H. and Tanabe, Y. 1997. Extensive interbreeding occurred among multiple
matriarchal ancestors during the domestication of dogs: Evidence from inter- and intraspecies polymorphisms in
the D-loop region of mitochondrial DNA between dogs and wolves. Genes and Genetic Systems 72: 229-238.
Received 21 August 1998. Accepted 12 May 1999.
ieee
Gir alt
eau =
ay
‘he
y
i]
‘ .
}
ed z
N) a }
Par
ane nes
“
mid ae
¥ 9
Rs
X pes
a saa i
i
}
“
- \=
- i
Wh XK
a i
SN Pcs he ‘Sion yrlialay vai
ry. oT ae anus,
Mammal Study 24: 35-41 (1999)
© the Mammalogical Society of Japan
A karyological analysis of the Korean red-backed vole,
Eothenomys regulus (Rodentia, Muridae),
using differential staining methods
Masahiro A. Iwasa!, Sang Hoon Han? and Hitoshi Suzuki?
130 aboratory of Ecology and Genetics, Graduate School of Environmental Earth Science, Hokkaido
University, Sapporo 060-0810, Japan
Ecosystem Conservation Division, Ministry of Environment, 1, Joongang-dong, Kwacheon, Kyunggi-
do 427-760, Korea
Abstract. The conventional and G- and Q-banded karyotypes of the Korean red-backed
vole Eothenomys regulus (2n=56) are described here for the first time. The autosomes were
found to be composed of 26 pairs of acrocentrics and one pair of metacentrics, as in other
species of red-backed voles. Side-by-side pair-matching analysis revealed that the G-band-
ing patterns of E. regulus were essentially identical to those of the grey red-backed vole
Clethrionomys rufocanus, and therefore the karyotype of E. regulus was of a “rufocanus”
type, not of a “glareolus” type, which is characterized by 1-9 translocation. The sex chro-
mosomes of FE. regulus were found to be composed of a large subtelocentric X chromosome
and a medium-sized subtelocentric Y chromosome, closely resembling those of FE. smithii in
both size and morphology. Both X and Y sex chromosomes were indistinguishable between
these species, as far as conventional staining is concerned. Further analysis indicated, how-
ever, that E. regulus’ Y chromosome has a large C-band area on the terminal half of its
long arm, whereas E. smithii has a large C-band area on the proximal half of its long arm.
Such C-band patterning implies the involvement of the Y chromosome in paracentric inver-
sion during the course of speciation.
Key words: karyotype, Eothenomys regulus, the Korean red-backed vole, sex chromosomes.
The Korean red-backed vole was first described as Craseomys regulus by Thomas (1907), on
the basis of the type specimen collected at Min-gyong, Korea. Now, this species is widely
regarded as belonging to the genus Eothenomys (Corbet 1978; Kaneko 1990; Corbet and Hill
1991; Musser and Carleton 1993), although on the basis of molecular data from mitochon-
drial, and nuclear ribosomal DNA, its inclusion in the genus Clethrionomys has also been
proposed (Wakana et al. 1996; Suzuki et al. 1999). Thus the taxonomic status of this vole
remains uncertain. With the exception of the Korean species, the karyotypes of all of the
East Asian red-backed vole species have been studied. Differential staining methods have
shown that all of them share the same diploid number 2n=56 with essentially 26 pairs of
1F-mail: masahiro@ees.hokudai.ac.jp
2Present address: Wildlife Information and Research Centre, Chongnyang, Tongdaemun-ku, Seoul 130-011, Korea
36 Mammal Study 24 (1999)
acrocentrics (or subtelocentrics) and one pair of metacentrics, showing a high degree of
karyotypic similarity (Tsuchiya 1981; Ando et al. 1988; Kashiwabara and Onoyama 1988;
Yoshida et al. 1989; Sokolov et al. 1990; Obara et al. 1995; Kitahara and Harada 1996).
Detailed G-banding analysis has revealed, however, that the red-backed vole species complex
can be divided, karyologically, into two groups, the “glareolus” and the “rufocanus” groups
(Gamperl 1982; Iwasa 1998). The “glareolus” group is characterized by the 1-9 translocation
which can be seen in C. glareolus, C. rutilus, C. gapperi and C. californicus (Modi 1987;
Modi and Gamperl 1989; Obara et al. 1995), whereas the “rufocanus” group (C. rufocanus,
C. rex (dealt with as a synonym of C. montanus) and two Japanese species E. andersoni and
E. smithii) shows no such translocation (Obara 1986; Ando et al. 1988; Kashiwabara and
Onoyama 1988; Yoshida et al. 1989; Sokolov et al. 1990; Obara et al. 1995; Kitahara and
Harada 1996).
The purpose of this study was to make the first examination of the karyotype of E.
regulus, and to compare it with those of related species, so as to be able to ascertain, from a
cytogenetic perspective, the phylogenetic position of E. regulus among the East Asian red-
backed vole species.
Materials and methods
Two male Eothenomys regulus were captured, using Sherman live-traps, at Tonmyon-ri,
Sesanmyon, Ponghwa-gun, Kyongsangbuk-do, Korea. They were identified on the basis
of their cranial and dental characteristics as described by Kaneko (1990) (see Table 1 and
Fig. 1), and preserved in 70% ethanol as specimens HEG22-97 and HEG49-97. Six
HEG22-97
=
HEG49-97
Fig. 1. Enamel patterns of the right upper molars of the Eothenomys regulus specimens examined in this study.
(Arrowheads indicate the fourth outer small salient angle. Bar=1mm. See Table 1 for specimen number).
Iwasa et al., Karyotype of Eothenomys regulus 37
Table 1. Morphological measurements of the Korean red-backed vole, Eothenomys regulus, examined in this study.
Specimen No. Sex Capturing date T.L. (mm) T. (mm) T.R. (%) H.F. (mm)
HEG22-97 male 25 Apr. 1997 142.5 36.0 33.8 19.3
HEG49-97 male 24 Apr. 1997 141.0 40.0 39.6 18.2
T.L.: Total length; T.: Tail length; T.R.: Tail rate; H.F.: Hind foot length.
Table 2. Number of cells observed.
Specimen No. Conv. Giemsa G-band Q-band C-band
HEG22-97 30 15 28 16
HEG49-97 62 36 115 2D
total 92 51 143 38
Clethrionomys rufocanus collected in Hokkaido, and six E. smithii collected in Shikoku,
were used for a comparison of the sex chromosomes.
Chromosome preparations were made from bone marrow cells after short-term culture
(40 min at 37°C) in MEM containing 15% fetal calf serum and colchicine (final concentration
0.025 g/ml). The bone marrow cells were treated in 0.075 M KCI at 37°C for 18 min,
followed by fixation with Carnoy’s fixative (methanol: acetic acid = 3:1). Cell suspensions
were dropped on slides and air-dried. Chromosomes were analyzed by both conventional
and differential staining methods. For the latter staining method C-, Q- and G-bands were
examined following methods described by Caspersson et al. (1971), Sumner et al. (1971) and
Sumner (1972; see Table 2).
Results and discussion
Two red-backed vole specimens collected from the Korean Peninsula were examined in-
tensively in order to determine their specific identification on the basis of their morphological
features since two very similar species of voles, E. regulus and C. rufocanus, have been
reported from the region (Corbet 1978). The two species closely resemble each other in
morphology, but E. regulus has a specific “complex form” of enamel patterning on the upper
third molar (Kaneko 1990), which is distinguishable from that of C. rufocanus. Our two
specimens both had “complex form” upper third molars (Fig. 1), and so were confirmed as
E. regulus (Kaneko 1990).
Eothenomys regulus was confirmed as having 26 pairs of acrocentrics and one pair of
metacentrics, which was the smallest pair in the complement (Fig. 2a). The autosomes and
the X chromosome (excluding its short arm) had G-banding patterns identical with those of
C. rufocanus (Fig. 3) and other Japanese red-backed vole species. Thus, karyologically, E.
regulus belongs to the “rufocanus” group, which has no 1-9 translocations (Gamperl 1982;
Obara et al. 1995). As expected, the Q-banding patterns (Fig. 2b) were almost identical to
the G-banding patterns (Fig. 3); the bright bands basically corresponded to G-positive bands.
Centromeric regions showed dull fluorescence in all chromosomes after Q-banding.
In contrast to the highly consistent constitution of the autosomes of red-backed vole
species, the sex chromosomes showed both inter- and intraspecific variation. The sex chro-
38 Mammal Study 24 (1999)
=o
eee
MoM ton
Orsay
Ab Ah Oh Wk Oe
Fig. 2. Conventionally stained (a) and Q-banded (b) karyotypes of Eothenomys regulus.
mosomes of E. regulus proved to be composed of a large subtelocentric X and a medium-
sized subtelocentric Y chromosome. Such a combination is markedly different from the XY
chromosomes of C. rufocanus, which has a large acrocentric X and a small acrocentric Y
chromosome (Fig. 4). Two distinct karyological forms of E. smithii have been reported, one
with a small Y chromosome (the so-called smithii form of south-western Honshu and
Shikoku (Fig. 4; Ando et al. 1988), and the other with a large Y chromosome the kageus
form of central Honshu (Ando et al. 1988). The Y chromosome of E. regu/us was equiva-
lent in length to that of the small smithii form of E. smithii. A detailed comparison of the
C-bands of E. regulus and E. smithii indicated, however, the possibility of a structural rear-
Iwasa et al., Karyotype of Eothenomys regulus 39
He Ne
1 2 3
NS
O1
(@p)
>, “ae
OO
— 2
O <=
fs 0! Of ff ga Oh bt Bh oe
11 12 13 4 +15 +=t6 =~ 617f—h618—6~—=619)— 20
fy Wa Sh #6 Bh Oa we i of
Z| 22 23) 24 25 26 27 X Y
Fig. 3. Composite karyotype of Clethrionomys rufocanus and Eothenomys regulus prepared by side-by-side
arrangement on the basis of G-band homology. (Left = C. rufocanus. Right = E. regulus. The asterisk indi-
cates overlapping chromosomes).
rangement of the Y chromosome. The Y chromosome of FE. regulus has a large C-band area
on the terminal half of its long arm, whereas that of E. smithii has a similarly sized C-band
on the proximal half of its long arm (Fig. 5). Similar C-band patterns in E. smithii have also
been described by Ando et al. (1988) and Yoshida et al. (1989). Such interspecific differences
in C-banding patterns can be explained by the occurrence of paracentric inversion involving
most of the long arm of the Y chromosome during the course of speciation (Fig. 5).
The Y chromosome morphology suggests a closer relationship between E. regulus and E.
smithii than with C. rufocanus, in which the Y chromosome is small and metacentric in the
Primorskyi region of Russia, and small and acrocentric in Hokkaido, Japan (Vorontsov et
Lt
Crf Erg Esm
Fig. 4. Conventionally stained X and Y chromosomes of Clethrionomys rufocanus (Crf), Eothenomys regulus
(Erg) and E. smithii (Esm).
40 Mammal Study 24 (1999)
paracentric
Inv.
E. regulus : E. smithit
Fig. 5. C-banding patterns in the X and Y chromosomes of Eothenomys regulus and E. smithii shown by photo-
graphs and ideograms.
al. 1980; Tsuchiya 1981; Obara 1986; Yoshida et al. 1989). This chromosomal evidence is
consistent with the fact that adult E. regulus and E. smithii both have rootless molars. In
contrast, however, molecular phylogenetic data, on the variation of nuclear ribosomal and
mitochondrial DNA, suggests a closer relationship between FE. regulus and C. rufocanus,
than with E. smithii (Wakana et al. 1996; Suzuki et al. 1999). The Shikoku E. smithii
population, however, has specific mitochondrial sequences that differ from those of the
Honshu and Kyushu populations, but which show affinities with those of both C. rufocanus
and E. regulus (Suzuki et al. 1999). Thus, the phylogenetic relationships of these three red-
backed voles, E. regulus, E. smithii and C. rufocanus are extremely complicated and as
yet unresolved. Our cytogenetic and molecular findings indicate that interspecific genetic
exchange may have played at least a partial role in complicating the genetic constitution of
these three red-backed vole species. An analysis of the sequence variations in the genes
specific to the X and Y chromosomes, and molecular cytogenetic analysis of the Y chro-
mosomal C-heterochromatin, is considered likely to yield valuable information towards a
more precise understanding of the phylogenetic relationships of these species. We are cur-
rently in the process of examining the relationships between the red-backed voles from these
standpoints.
Acknowledgements: The authors are grateful to Dr. Yoshitaka Obara of Hirosaki Univer-
sity for his continuous encouragement throughout this study. We also thank Mr. C.C.
Yoon for his kind co-operation in collecting animals at Tonmyon-ri, Kyongsangbuk-do,
Korea. This study partly supported by a Grants-in-Aid for Scientific Research from the
Ministry of Education, Science and Culture, Japan.
Iwasa et al., Karyotype of Eothenomys regulus 41
References
Ando, A., Shiraishi, S., Harada, M. and Uchida, T. A. 1988. A karyological study of two intraspecific taxa in
Japanese Eothenomys (Mammalia: Rodentia). Journal of the Mammalogical Society of Japan 13: 93-104.
Caspersson, T., Lomakka, G. and Zech, L. 1971. The 24 fluorescence patterns of the human metaphase chro-
mosomes-distinguishing characters and variability. Hereditas 67: 89-102.
Corbet, G. B. 1978. The Mammals of the Palaearctic Region: a Taxonomic Review. Brit. Mus. (Nat. Hist.) &
Cornell Univ. Press, London & Ithaca, 314 pp.
Corbet, G. B. and Hill, J. E. 1991. A World List of Mammalian Species, 3rd edn. Oxford University Press,
Oxford, 243 pp.
Gamperl, R. 1982. Chromosomal evolution in the genus Clethrionomys. Genetica 57: 193-197.
Iwasa, M. A. 1998. Chromosomal and molecular variations in red-backed voles. Honyurui Kagaku [Mammalian
Science] 38: 145-158 (in Japanese with English abstract).
Kaneko, Y. 1990. Identification and some morphological characters of Clethrionomys rufocanus and Eothenomys
regulus from USSR, northeast China and Korea in comparison with C. rufocanus from Finland. Journal of the
Mammalogical Society of Japan 14: 129-148.
Kashiwabara, S. and Onoyama, K. 1988. Karyotypes and G-banding patterns of the red-backed voles,
Clethrionomys montanus and C. rufocanus bedfordiae (Rodentia, Microtinae). Journal of the Mammalogical
Society of Japan 13: 33-41.
Kitahara, E. and Harada, M. 1996. Karyological identity of Anderson’s red-backed voles from the Kii peninsula
and central Honshu in Japan. Bulletin of the Forestry and Forest Products Research Institute No. 370: 21-30.
Modi, W.S. 1987. Phylogenetic analyses of chromosomal banding patterns among the Nearctic Arvicolidae
(Mammalia: Rodentia). Systematic Zoology 36: 109-136.
Modi, W.S. and Gamperl, R. 1989. Chromosomal banding comparisons among American and European red-
backed mice, genus Clethrionomys. Zeitschrift fiir Sdugetierkunde 54: 141-152.
Musser, G. G. and Carleton, M. D. 1993. Family Muridae. In (D. E. Wilson and D. A. Reeder, eds.) Mammal
Species of the World. A Taxonomic and Geographic Reference. 2nd edn. Pp. 501-755. Smithsonian Institution
Press, Washington and London.
Obara, Y. 1986. G-band homology between the Japanese red-backed vole, Clethrionomys a. andersoni and the grey
red-backed vole, C. rufocanus. Chromosome Information Service 40: 7-9.
Obara, Y., Kusakabe, H., Miyakoshi, K. and Kawada, S. 1995. Revised karyotypes of the Japanese northern red-
backed vole, Clethrionomys rutilus mikado. Journal of the Mammalogical Society of Japan 20: 125-133.
Sokolov, V. Ye., Aniskin, V. M. and Serbenyuk, M. A. 1990. Comparative cytogenetics of 6 species of the genus
Clethrionomys (Rodentia, Microtinae). Zoologicheskii Zhurnal 69: 145-151 (in Russian with English summary).
Sumner, A. T. 1972. A simple technique for demonstrating centromeric heterochromatin. Experimental Cell
Research 75: 304-306.
Sumner, A. T., Evans, H. J. and Buckland, R. A. 1971. New technique for distinguishing between human chro-
mosomes. Nature New Biology 232: 31-32.
Suzuki, H., Iwasa, M., Harada, M., Wakana, S., Sakaizumi, M., Han, S.H., Kitahara, E., Kimura, Y.,
Kartavtseva, I. V. and Tsuchiya, K. 1999. Molecular phylogeny of red-backed voles in Far East Asia based
on variation in ribosomal and mitochondrial DNA. Journal of Mammalogy 80: 512-521.
Thomas, O. 1907. The Duke of Bedford’s zoological exploration in eastern Asia. II. List of small mammals from
Korea and Quelpart. Proceedings of Zoological Society of London, 1906: 858-865.
Tsuchiya, K. 1981. On the chromosome variations in Japanese cricetid and murid rodents. Honyurui Kagaku
[Mammalian Science] 42: 51—58 (in Japanese).
Vorontsov, N. N., Lyapunova, E. A., Borissov, Y. M. and Dovgal, V. E. 1980. Variability of sex chromosomes in
mammals. Genetica 52/53: 361-372.
Yoshida, I., Obara, Y. and Matsuoka, N. 1989. Phylogenetic relationships among seven taxa of the Japanese
microtine voles revealed by karyological and biochemical techniques. Zoological Science 6: 409-420.
Wakana, S., Sakaizumi, M., Tsuchiya, K., Asakawa, M., Han, S.H., Nakata, K. and Suzuki, H. 1996.
Phylogenetic implications of variations in rDNA and mtDNA in red-backed voles collected in Hokkaido, Japan,
and in Korea. Mammal Study 21:15 —25.
Received 17 February 1999. Accepted 20 May 1999.
Me
> = int >:
<
sce! ' carpi de weuid A ic set.
an oa et . bie.
sos
onal i
Hea
Mammal Study 24: 43-50 (1999)
© the Mammalogical Society of Japan
The genetic status of two insular populations of the endemic
spiny rat Tokudaia osimensis (Rodentia, Muridae) of
the Ryukyu Islands, Japan
Hitoshi Suzuki!, Masahiro A. Iwasa?, Nobuo Ishii*?, Hiroko Nagaoka‘ and
Kimiyuki Tsuchiya?
1,2Graduate School of Environmental Earth Science, Hokkaido University, North 10, West 5, Kita-ku,
Sapporo 060-0810, Japan
3,4Japan Wildlife Research Center, Yushima 2-29-3, Bunkyo-ku, Tokyo 113-0034, Japan
Experimental Animal Center, Miyazaki Medical College, 5200 Kihara, Kiyotake-cho, Miyazaki 889-
1692, Japan
Abstract. We examined the geographic variation of Zokudaia osimensis through the analy-
sis of mitochondrial cytochrome b (cyt b) gene sequences and the restriction fragment length
polymorphism (RFLP) in the nuclear ribosomal RNA gene (rDNA), using samples collected
from Tokuno-shima and Amami-oshima in the Ryukyu Islands. The two populations
show intrinsic karyological variation (Tokuno-shima, 2n=45; Amami-oshima, 2n=25).
Sequences of the cyt b gene differed considerably between the two island populations. The
extent of the sequence divergence among 1,140 bp of the gene was calculated to be 0.088
using the Kimura two parameter method, and was comparable to those between related
species of rodents such as within genus Mus or Rattus. The extent of the differentiation in
the rDNA-RFLP was also high. Three out of 22 restriction site variants were found to be
fixed in the nuclear rDNA arrays of hundreds of copies in either one of the two island
populations. These intensive inter-populational differences indicate that the two island
populations may have been isolated for a considerable period of evolutionary time, probably
several millions of years, despite there having been several opportunities for renewed genetic
contact during the Pleistocene ice ages. Our data strongly suggest that the current taxo-
nomic status of the populations of the two islands, Amami-oshima and Tokuno-shima,
which regards them conspecific, should be reviewed.
Key words: geographic variation, cytochrome Db gene, nuclear rDNA-RFLP, Ryukyu
Islands, Tokudaia osimensis.
The Nansei Shoto or Ryukyu Islands, Japan’s southernmost islands, harbor a unique
fauna and flora, and the central region, consisting of the three islands of Amami-oshima,
Tokuno-shima and Okinawa and adjacent islets, is especially rich and a center of endemism.
Three genera of the following mammals are endemic to this small area of islands: the Ryukyu
spiny rat Tokudaia osimensis; the Ryukyu long-haired rat Diplothrix legata; and the Amami
1E-mail: htsuzuki@ees.hokudai.ac.jp
44 Mammal Study 24 (1999)
rabbit Pentalagus furnessi (Corbet and Hill 1991; Musser and Carleton 1993; Hoffmann
1993; Abe 1994; Kaneko and Murakami 1996). Because of their uniqueness and zoological
importance, all three are protected as natural monuments by the Japanese government and
also regarded as endangered species (IUCN 1996; Kawamichi 1997). These three species are
also considered to be symbolic of the significant biodiversity of the Central Ryukyus, and
for the conservation of the fauna of the islands. Moreover, their distribution and status
provides invaluable information towards an understanding of the historical episodes of the
Ryukyu fauna as well as contributing to an understanding of general evolutionary issues.
Tokudaia osimensis, in particular, raises various interesting scientific issues. The species
shows intrinsic karyological features in its autosomes and sex chromosomes, with the diploid
numbers of both females and males being 44 in Okinawa, 45 in Tokuno-shima, and 25 in
Amami-oshima (Honda et al. 1977, 1978; Tsuchiya et al. 1989). Since the Y chromosome
in the Tokuno-shima and Amami-oshima island populations disappears (Honda et al. 1977,
1978), and the animals from Amami-oshima are shown to lack the Sry gene (Soullier et al.
1998), an unusual sex-determining system must have been evoked in these populations
(Honda et al. 1977; Tsuchiya et al. 1989; Soullier et al. 1998; Xiao et al. 1998). However,
neither the evolutionary process leading to these differences, nor the biological implications
of the differences have been elucidated.
The evolutionary history of the populations of 7. osimensis and the origin of this lineage
have long been debated (for review see Kawamura 1989). A recent molecular phylogenetic
study (Suzuki et al. 1999b) has revealed that 7. osimensis’ lineage is distinct from the other
members of the subfamily Murinae examined so far, including Apodemus, which had been
considered a likely candidate for the sister lineage of Tokudaia based on molar morphology
(Kawamura 1989). An assessment of the genetic diversity within this species is inevitably
needed for back ground information to elucidate the above biological problems, and to
resolve the unsettled taxonomic status of the three island populations of 7. osimensis.
Although recently each of the three populations is presumed to be a distinct species (Honda
et al. 1977; Tsuchiya et al. 1989; Musser and Carleton 1993), there has only been limited
research on this species with such complicated genetic property using molecular markers
(Tsuchiya et al. 1989).
In a preliminary study using a limited number of restriction enzymes we found sub-
stantial genetic differences between populations of 7. osimensis from Tokuno-shima and
Amami-oshima, based on restriction fragment length polymorphisms (RFLP) of mitochon-
drial DNA (mtDNA) and nuclear ribosomal RNA genes (rDNA) (Tsuchiya et al. 1989). This
study was conducted therefore to improve our knowledge of the molecular phylogeny of the
Tokuno-shima and Amami-oshima island populations, by examining a whole sequence for
the mitochondrial cytochrome b (cyt b) gene and the rDNA-RFLP with more additional
restriction enzymes.
Materials and methods
Animals
We have tentatively followed Abe’s (1994) classification and accepted that Tokudaia
consists of just one species (T. osimensis) with three island populations. Five individuals of
T. osimensis were examined, two from Tokuno-shima and three from Amami-oshima. With
H. Suzuki et al., Genetic diversity in Tokudaia osimensis 45
the exception of one sample from Amami-oshima, the samples were the same as those
previously used by Tsuchiya et al. (1989). The new sample (sample no. HS1142) from
Amami-oshima was collected at Tatsugo, 28 February 1996 through a wildlife survey con-
ducted by Japan Wildlife Research Center (Environment Agency of Japan 1995).
Sequencing and phylogenetic analysis
Nuclear DNA extraction, Southern blot analysis and the construction of restriction maps
for the rDNA repeating unit type (repetype), were all carried out following Suzuki et al’s
(1994a) methodology. The cyt b region was analyzed using nested polymerase chain reac-
tions and a direct sequencing method as described previously by Suzuki et al. (1997, 1999b).
In order to estimate the sequence divergence from restriction site variation among rDNA
repetypes, we compared the arrangement of the restriction sites between the pairs of repe-
types and then counted the common and divergent sites (Suzuki et al. 1994a). To do this, we
used Gotoh et al’s (1979) method, in which backward mutations and parallel mutations are
taken into account, to produce a matrix of sequence divergence among all possible combi-
nations of repetypes.
To estimate the sequence divergences from sequences of the cyt b gene, we used the two
parameter method (Kimura 1980) and MEGA (Kumar et al. 1993).
Results
Cyt b sequences
Fragments of the cyt b gene, from each of the five specimens, consisting of 402 bp
were determined, and it was found that each island population had unique sequences. We
then sequenced the entire gene region of the cyt b gene of one individual from Tokuno-shima
(the nucleotide sequence can be reached in the DDBJ, EMBL and GenBank with follow-
ing accession number: AB029429) and compared it with that of the previously described
sample from Amami-oshima (Suzuki et al. 1999b), calculating sequence divergences (see
Kimura 1980) taking into consideration complete substitution (d), and only transversional
substitution (dv; see Table 1). The extent of transversional substitution amounted to 0.026,
which is comparable to that between species of Rattus-Diplothrix and Mus (dv =0.014-0.016;
Table 1). The extent of complete substitution (d=0.088) was also extremely high when
compared with other cases of intraspecific sequence divergences within mammalian species
(Avise et al. 1998; Johns and Avise 1998; Table 1 for the case of Glirulus japonicus) and
rather comparable to those among congeneric mammalian species (Johns and Avise 1998).
Such high degrees of divergence in the cyt b sequences were congruent with our previous
study with the mtDNA-RFLP (Tsuchiya et al. 1989).
rDNA-RFLP
We carried out Southern blot analysis with the two island samples using 12 restriction
enzymes. Among the enzymes examined the KpnI bands, with both the 18S and 28S probes,
remained at higher molecular weight position without any indication of digestion with this
enzyme in samples from both islands. Thus, we considered there to be no KpnI site located
in the spacer region in these populations. Restriction maps were constructed taking into
consideration the banding patterns (Fig. 1). Interestingly, the Amami-oshima sample’s
46 Mammal Study 24 (1999)
Table 1. Comparison of sequence divergences between related species and among geographic popula-
tions in small mammals. Sequence divergences in the cytochrome b gene (1,140 bp) were calculated
using Kimura’s (1980) two parameter method considering all substitutions at all codon positions (d) and
transversions at all codon positions (dv).
Substitution considered
Taxa compared
d dv
Between geographic populations
1. Tokudaia osimensis
‘Amami-oshima’ vs ‘Tokuno-shima’ 0.088 0.026
2. Mus musculus*
M. m. domesticus vs M. m. musculus 0.024 0.004
3. Glirulus japonicus**
‘Wakayama’ vs ‘Yamanashi’ 0.075 0.012
Between species within Mus and Rattus*
4. M. musculus vs M. spretus 0.091 0.014
5. R. rattus vs Diplothrix legata 0.102 0.016
Between genera Mus and Rattus*
6. M. musculus vs R. norvegicus 0.186 0.082
* Suzuki et al. (1999b). The genus Diplothrix is a member of a Rattus group in the molecular
phylogenetic view.
** Suzuki et al. (1997; unpublished data)
repeating type was heterogeneous within a genome as depicted in the HindIII and Xbal sites
upstream of the 18S rRNA gene and EcoRI, and Dral sites downstream of the 28S rRNA
gene (Fig. 1). In contrast, the banding patterns of the Tokuno-shima specimens were
monotypic within a genome at each restriction site. These phenomena can be explained
either by there being a large population on Amami-oshima or by some prevention of the
homogenization process (including DNA recombination) within a genome in the Amami-
oshima population. The former postulates that the banding patterns of individuals from a
large population size tend to show polymorphic state rather than those from a small popu-
lation size (Suzuki et al. 1994b). Although there is no substantial data on population size
of this species, the area of Amami-oshima is about three times as large as that of Tokuno-
shima. In the latter case, if rDNA clusters coexist onto terminal and interstitial regions of
chromosomes, recombination between non-homologous chromosomes would be unfavorable
since it may cause abnormal chromosomal changes with serious damage to the cell. We just
presume a possibility that a rDNA cluster(s), which often locate distal portions of chromo-
somes accompanied by heterochromatic regions but not euchromatic one, as in the cases of
Mus and Rattus (Babu and Verma 1985), incorporated into inside chromosomes by chro-
mosomal rearrangement in the Amami-oshima population (2n=25).
The difference between the geographic populations became more conspicuous during
examination of the rDNA-RFLP. According to Gotoh et al’s (1979) method, inter-popu-
lational sequence divergence was calculated to be approximately 2.3%. This extent was
considered likely to be as high as between distantly related local populations such as of the
Japanese dormouse Glirulus japonicus (2.9-3.3%, Suzuki et al. 1997), and between closely
related species of red-backed voles (genera Clethrionomys and Eothenomys) in Japan (1.9-
2.3%, Wakana et al. 1996; Suzuki et al. 1999a). Since each variant spreads over the arrays
H.. Suzuki et al., Genetic diversity in Tokudaia osimensis 47
Xi Bi X3D2 Li B2 B3 Vi E2 1 kb
i
18S 28S
5.88
X2DiPi1 E:Hi AiD3Gi $1 _—‘S2
I SS SSE EE
18SB INT 288
18S upstream internal 28S downstream
SSeS Ie eT
a a aaaaaaa aa aaaa aaaa a a
13, Jal LAG XS PV DB AEDS VGP B x
a a bb AAAAAR A aa babaa bp aaa a
E Hee He xemel AG XSIPE DB BALDS PE HVG x
Amami-oshima I
* *
b
2 kb BD
——l
Fig. 1. Restriction maps of the rDNA repeating units of Tokuno-shima and Amami-oshima populations of
Tokudaia osimensis. Each rDNA repeating unit is composed of three rRNA genes (28S, 5.88, and 18S rRNA)
which are separated from each other by spacers. With respect to the restriction sites on the flanking spacers, only
those nearest to the distal end of the genes for 18S or 28S rRNA are shown. The upper diagram shows the con-
served restriction sites in the coding and the internal spacer regions of the genes for 18S and 28S rRNA, which are
not represented in the lower maps. The positions of the probes are also shown by arrows. Letters with super-
scripts represent specific types of restriction sites identified after comparison with the restriction maps. Types of
Tokuno-shima are treated as a. Asterisks indicate polymorphic sites within individuals. A=Aatl; B=BamHI;
D=Dral; E=EcoRI; G=Beglll; H=Aindill; K=KpnI; L=Bcll; P=Pstl; S=Sacl; V=Pvull; and X=Xbal.
of rDNA within a population through certain homogenization mechanisms (Coen et al.
1982), the presence of several distinct variants between the two islands clearly indicates that
the two populations have been isolated for a considerable period of time. The amount of
the sequence divergence, 2.3%, corresponds to a divergence time of 1.2-2.3 million years, if
we assume that the divergence rate is 1-2% per million years (Suzuki et al. 1994a, 1999a).
Discussion
During this study we detected considerable differences in the cyt b sequences and the
rDNA-RFLP between populations of 7. osimensis from the islands of Tokuno-shima and
Amami-oshima, as previously predicted by karyological analysis (Honda et al. 1977, 1978;
Tsuchiya et al. 1989) and our preliminary molecular analysis (Tsuchiya et al. 1989). The
difference between the populations, and the extent of the divergence in the two molecular
markers, has greatly improved our knowledge of the evolutionary processes of these island
populations. Our data will be helpful in assessing the evolutionary history and in recon-
sideration for taxonomic status of this species.
The extent of the inter-populational variation in the cyt b sequences between the two
island populations was comparable to that between Rattus species and Diplothrix legata
(Table 1). These results suggest that certain kinds of populational differentiation began a
very long time ago. Differentiation of genes under the ordinal inherited mode, however,
does not always reflect populational differentiation. Furthermore, in the case of mtDNA,
48 Mammal Study 24 (1999)
the differentiation patterns do not reflect the movement of males. For example, the
differentiation patterns of mtDNA in geographically separate populations of the Japanese
dormouse Glirulus japonicus, and Smithii’s red-backed vole Eothenomys smithii, are not
congruent with those of nuclear genes and morphological types (Suzuki et al. 1997, 1999a;
Iwasa et al. unpublished). In contrast, data sets of the nuclear rDNA, a member of
multigene families, would provide more useful information on the genetic status of given
populations. The rDNA consists of several hundred copies within a genome, and a given
variant extends to all of the units by certain homogenization mechanisms, and to all of
the genomes of the same population as a result of mating (Dover 1980; Ohta 1980). In
the case of 7. osimensis, of the 22 restriction sites examined, three sites were completely
differentiated, and four more were under differentiation between the rDNA repeating units of
the two islands (Fig. 1). This data implies that the two island populations of T. osimensis
have been reproductively isolated for some million years, despite there having been many
chances to exchange genetic elements during the Pleistocene ice ages when falling sea levels
led to land bridges existing between the islands (Kimura 1996). We could conclude, there-
fore, that these two island populations are already genetically differentiated to such an extent
that there is little or no probability of future genetic contact. Consequently, the spiny rats
from the two islands of Amami-oshima and Tokuno-shima may be better regarded as two
independent species.
This assumption is congruent with the observed karyological differentiation between the
island populations in which the diploid numbers are 2n=45 (Tokuno-shima) and 2n=25
(Amami-oshima). From the karyological perspective (Honda et al. 1977; Tsuchiya et al.
1989), such populations would not be expected to produce fertile progeny, that is they have
been reproductively isolated through certain post-mating isolation mechanism. Such infor-
mation clearly brings into question the current taxonomic status and suggests that the status
of 7. osimensis as a monotypic species should be reconsidered (Honda et al. 1977; Tsuchiya
et al. 1989; Musser and Carleton 1993; Kaneko and Murakami 1996).
Interestingly, the extent of the cyt b divergence between these two island populations
is somewhat similar to the level of distinctness of D. /egata (Suzuki et al. 1999b; Table 1).
This may imply that some geological event was attributable to both the geographical diver-
gence of 7. osimensis and to the migration and colonization of D. /egata in the Okinawa
Islands. The most simple explanation for such differentiation is that it was triggered by the
disappearance of land bridges that once connected the islands of the region. Our rough time
estimation predicts that divergence occurred 3.8-4.9 million years ago (Mya), taking into
account the extent of transversional substitution (Table 1) and using the “standard” time
estimation of the rat-mouse split as 12-14 Mya (though others have estimated the rat-mouse
split to be more ancient (20-29 Mya, O’hUigin and Lee 1992; 40 Mya, Kumar and Hedges
1998)). If the time frame is estimated on the basis of a total-substitution rate of 2% per
million years (Brown et al. 1979), then divergence is estimated to be 4.4 Mya. Both of these
estimates related well to the geological view that the Ryukyu Islands were once connected
to the Asian continent but became disconnected during the beginning of the Pleistocene,
around 1.7 Mya (Kimura 1996). It may be postulated that such geological changes affected
the differentiation of D. /egata from other continental sister Rattus lineages, and simul-
taneously triggered the geographic divergence of the mtDNA haplotypes in 7. osimensis.
In order to fully understand the various important issues related to the status of 7.
H. Suzuki et al., Genetic diversity in Tokudaia osimensis 49
osimensis, comparable data for 7. osimensis from the Okinawa, is required. Karyologically,
the Okinawan population represents the normal type, and may represent the ancestral situa-
tion of the unusual karyotypes. Studies of the Okinawan population are essential for the
investigation of other issues such as the geographical differentiation of genes, and the taxo-
nomic reconsideration of the island populations. Despite the scientific importance, all three
populations of this taxon, especially in Okinawa, are thought to have already decreased to a
point where those are seriously endangered possibly due to habitat destruction, predation by
and competition with introduced species such as the Javan mongoose Herpestes javanicus,
the feral cat Felis catus and the feral dog Canis familiaris, and the black rat Rattus rattus.
The Environment Agency (1995) listed the Okinawan population as critically endangered and
the populations of Amami-oshima and Tokuno-shima as endangered in the national Red
List. Given the current status of 7. osimensis in the wild in Okinawa, and given the
remarkable biological importance of this taxon, effective conservation efforts are required,
and these may include a research project to promote their reproduction in captivity while the
issue of alien predators is dealt with.
Acknowledgements: We are grateful to Drs. M. Brazil, M. Izawa, Y. Sawashi, M. Takaku,
K. Minato, and Y. Arakawa for their valuable suggestions. We wish to thank the Environ-
ment Agency of Japan who funded the wildlife survey providing a part of materials of this
study. This study was supported in part by Grants-in-Aid for Scientific Research from the
Ministry of Education, Science, Sports and Culture, Japan. This study was also supported
in part by a grant from the Environment Agency.
References
Abe, H. (ed.) 1994. A pictorial guide to the mammals of Japan. Tokai University Press, Tokyo, 195 pp. (in
Japanese).
Avise, J.C., Walker, D. and Johns, G.C. 1998. Speciation duration and Pleistocene effects on vertebrate
phylogeography. Procceeding of the Royal Society of London B 265: 1707-1712.
Babu, K. A. and Verma, R.S. 1985. Structural and functional aspects of nucleolar organizer regions (NORs) of
human chromosomes. International Review of Cytology 94: 151-176.
Brown, W.M., George, M. Jr. and Wilson, A.C. 1979. Rapid evolution of animal mitochondrial DNA.
Proceedings of the National Academy of Sciences USA 76: 1967-1971.
Coen, E.S., Thoday, J. M. and Dover, G. 1982. Rate of turnover of structural variants in the rDNA gene family
of Drosophila melanogaster. Nature 295: 564-568.
Corbet, G. B. and Hill, J. E. 1991. A World List of Mammalian Species, 3rd edn. Oxford University Press,
London, 243 pp.
Dover, G. 1980. Molecular drive: A cohesive mode of speces evolution. Nature 299: 111-117.
Environment Agency. 1995. A Report of Biodiversity Survey on Amami Islands. Japan Wildlife Research Center,
Tokyo, 108 pp. Gin Japanese).
Gotoh, O., Hayashi, J., Yonekawa, H. and Tagashira, Y. 1979. An improved method for estimating sequence
divergence between related DNAs from changes in restriction endonuclease cleavage sites. Journal of Molecular
Evolution 14: 301-310.
Hoffmann, R.S. 1993. Order Lagomorpha. In (D. E. Wilson and D.M. Reeder, eds.) Mammal Species of the
World, 2nd edn. Pp. 807-827. Smithsonian Institute Press, Washington and London.
Honda, T., Suzuki, H. and Itoh, M. 1977. An unusual sex chromosome constitution found in the Amami spinous
country-rat, Tokudaia osimensis osimensis. Japanese Journal of Genetics 52: 247-249.
Honda, T., Suzuki, H., Itoh, M. and Hayashi, K. 1978. Karyotypical differences of the Amami spinous country-
50 Mammal Study 24 (1999)
rats, Tokudaia osimensis osimensis obtained from two neighbouring islands. Japanese Journal of Genetics 53:
297-299.
IUCN. 1996. IUCN Red List of Threatened Animals. IUCN, Gland, 448 pp.
Johns, G.C. and Avise, J.C. 1998. A comparative summary of genetic distances in the vertebrates from the
mitochondrial cytochrome b gene. Molecular Biology and Evolution 15: 1481-1490.
Kaneko, Y. and Murakami, K. 1996. The history of taxonomy in Japanese small rodents. Honyurui Kagaku
[Mammalian Science] 36: 109-128 (in Japanese with English summary).
Kawamichi, T. 1997. Red List of Japanese Mammals by the Red Data Committee of the Mammalogical Society of
Japan. Bunichisougou-shuppan, Tokyo, 279 pp.
Kawamura, Y. 1989. Quaternary rodent faunas in the Japanese Islands (Part 2). Memoirs of the Faculty of Science,
Kyoto University, Series of Geology and Mineralogy 54: 1-235.
Kimura, M. 1980. A simple method for estimating evolutionary rates of base substitutions through comparative
studies of nucleotide sequences. Journal of Molecular Evolution 16: 111-120.
Kimura, M. 1996. Quaternary paleogeography of the Ryukyu Arc. Journal of Geography 105: 259-285 (in
Japanese with English summary).
Kumar, S. and Hedges, S. B. 1998. A molecular time scale for vertebrate evolution. Nature 392: 917—920.
Kumar, S., Tamura, K. and Nei, M. 1993. MEGA: molecular evolutionary genetics analysis, version 1.01. The
Pennsylvania State University, University Park, Pa.
Musser, G. G. and Carleton, M.D. 1993. Family Muridae. In (D. E. Wilson and D. M. Reeder, eds.) Mammal
Species of the World, 2nd edn. Pp. 501—806. Smithsonian Institute Press, Washington and London.
Ohta, T. 1980. Evolution of Multigene Families. Lecture Notes in Biomathematics 37. Springer-Verlag Berlin, 131
pp.
O’hUigin, C. and Li, W-H. 1992. The molecular clock ticks regularly in muroid rodents and hamsters. Journal of
Molecular Evolution 35: 377-384.
Soullier, S., Hanni, C., Catzeflis, F., Berta, P. and Laudet, V. 1998. Male sex determination in the spiny rat
Tokudaia osimensis (Rodentia: Muridae) is not Sry dependent. Mammalian Genome 9: 590-592.
Suzuki, H, Kawamoto, Y., Takenaka, O., Munechika, I., Hori, H. and Sakurai, S. 1994a. Phylogenetic relation-
ships among Homo sapiens and related species based on restriction site variations in rDNA spacers. Biochemical
Genetics 32: 257-269.
Suzuki, H., Tsuchiya, K., Sakaizumi, M., Wakana, S. and Sakurai, S. 1994b. Evolution of restriction sites of
ribosomal DNA in natural populations of the field mouse, Apodemus speciosus. Journal of Molecular Evolu-
tion 38: 107-112.
Suzuki, H., Minato, S., Tsuchiya, K. and Fokin, I. M. 1997. Phylogenetic position and geographic differentiation
of the Japanese dormouse, Glirulus japonicus, revealed by variations in rDNA, mtDNA and the Sry gene.
Zoological Science 14: 167-173.
Suzuki H., Iwasa, M., Harada, M., Wakana, S., Sakaizumi, M., Han, S-H., Kitahara, E., Kimura, Y., Kartavtseva,
I. and Tsuchiya, K. 1999a. Molecular phylogeny of red-backed voles in Far East Asia based on variation in
ribosomal and mitochondrial DNA. Journal of Mammalogy 80: 512-521.
Suzuki, H., Tsuchiya, K. and Takezaki, N. 1999b. A molecular phylogenetic framework for the Ryukyu endemic
rodents Tokudaia osimensis and Diplothrix legata (Muridae: Murinae). Molecular Phylogenetics and Evolution.
(in press).
Tsuchiya, K., Wakana, S., Suzuki, H., Hattori, S. and Hayashi, Y. 1989. Taxonomic study of Tokudaia
(Rodentia: Muridae): I. Genetic differentiation. Memoirs of the National Science Museum, Tokyo 22:
227-234 (in Japanese with English summary).
Wakana, H., Sakaizumi, M., Tsuchiya, K., Asakawa, M., Han, S-H., Nakata, K. and Suzuki, H. 1996.
Phylogenetic implications of variations in rDNA and mtDNA in the red-backed voles collected in Hokkaido,
Japan, and in Korea. Mammal Study 21: 15-25.
Xiao, C., Tsuchiya, K. and Sutou, S. 1998. Cloning and mapping of bovine ZFX gene to the long arm of the
X-chromosome (Xq34) and homologous mapping of ZFY gene to the distal region of the short arm of the
bovine (Yp13), ovine (Yp12—-p13), and caprine (Yp12—p13) Y chromosome. Mammalian Genome 9: 125-130.
Received 7 June 1999. Accepted 24 June 1999.
Apology and exchange
In acknowledging those persons who had kindly reviewed manuscripts for Vol. 23 (2) of
Mammal Study, Dr. M. Motokawa’s name was unintentionally omitted. I would like to
deeply appologize to Dr. Motokawa for that oversight.
As there were also several mistakes in the index in Vol. 23 (2), please exchange it for the
revised index attached to Vol. 24 (1).
Seiki Takatsuki (The former Chief in Editor)
5 i ok
I ey
Teg ie a
Mee bags wer ”
~ = a : ;
ala”
ate
_ yr i , et hi 7 i 4 i ages i f nes a eh ey A epee i it a ; 8% "era ae
i ee im Ply! arated) c ee ae a Za are tate : bi (4
‘ Soe + >
. “ ‘Ss fi i
i = — -
: ; ss : f : .
1 BEA th f q i= = } i 1 a
Fs he Cee =
oh) ; i t 2 % / ‘im
‘) 7 ee - & f ' i +,
“a pe , ‘ Das
x 7 re eee ‘
= iy) ’ & = - am
~
= x *. a = rd me
i wu “4 “ Ne 4
oa = > A Cae
) x " . %. eS = = =
~! \e & bs — =
> ) 5 a Pa = SPs ; ay 4)
* A ra — ! a
— "7 ¥ 5
: ws 5 ;
j t } ‘ rane
aah = , i,
es 4 ae ; ; S F oe
De seks ‘ r ; ‘ tr
“ C= x i] ‘a! i Ag i
ah —
= =) & Rs \ it
a oo a rire o =
= = ; 2 = ey 3
. ¢
t FN, = ey i z i 5
- < 7h L as bs 2 =
t 4 4:
m ae ber a ty, '
i a ‘ > ¢ \ We
ic rs = ‘ae
1 ree ~ eA
3 me
7 : ; - Pipe bd >
or a
: = rele ; = i
e = ; i , us ; mes ‘
y cf = x e .
im — iL = =. a H
R, , E } 3
{ at
} - 4 A t “
ies ‘ ri i - i i
Sy 2
; ce 1 f 7 ; al ; Hs €
: ; j oy ‘
a ef a & Ka =
. i 4 a “s 5
7 A ¥ PhS Ase By 7
z a 7 Ne d i OR f
= » el 7 ¥
p=\
Si / 2 ai) 5
hie = p
, ' f Ni
at y i
< nN Y ‘
=; 5 =
XY ’ My = =
¢ : s on ( Uae,
4 ree a } A ¢
5 reay = } : =
Q Sue
oA = , Re 2 .
x ~ = cs
ey am 3 a: 5 2
1 +
. E :
# % u a 1
- Y, Bf )
{ } ie i
4 =
)
t ; 3.6 ;
\ = 3
— a ne > “
- i
= a) in
= % 7 i
= 4 ; ;
j
~ ‘ Ve {
ee aes fa
Li -
: é 5 = = :
EAS 1 2 i i} te
ACTA
THERI OLOGICA Auctore Augusto Dehnel condita
Founded by August Dehnel in 1954 is an international journal of mammalogy, covering all
aspects of mammalian biology. It publishes original research reports, short communications
(Fragmenta Theriologica), and book reviews. The journal also includes review papers.
Editor-in-Chief: Zdzistaw PUCEK
Assistant Editors: Anna M. WOJCIK, Jan M. WOJCIK
Current Editorial Board: Roman Andrzejewski (Warszawa), Wiestaw Bogdanowicz (Warszawa),
Gilbert L. Dryden (Ashland), Jifi Gaisler (Brno), Joanna Gliwicz (Warszawa), Ilkka Hanski (Helsinki),
Lennart Hansson (Uppsala), Kazimierz Kowalski (Krakow), William Z. Lidicker (Berkeley), Sandro
Lovari (Sienna), Brian K. McNab (Gainesville), Gerhard Storch (Frankfurt am Main), Peter Vogel
(Lausanne), Nikolay N. Vorontsov (Moscow), January Weiner (Krakow).
e Among subjects included are ecology, behaviour, bioenergetics, morphology, development,
reproduction, nutrition, paleontology and evolution of mammals. Papers demonstrating a comparative
perspective in anatomy and physiology of mammals are also welcomed.
Papers represent mammalogical research in over 40 countries, including Eastern Europe and the
Commonwealth of Independent States.
Published now quarterly, in English.
Exchanged or subscribed in 63 countries.
Indexed in: Biological Abstracts, Elsevier BIOBASE/Current Awareness in Biological Sciences,
Current Contents A, B & ES, Ecological Abstracts, Polish Scientific Journals Contents—Agric. &
Biol. Sci., Referativnyi Zhurnal, Science Citation Index, Wildlife Review, Zoological Record.
e@ Edited since 1958, and now also published by the Mammal Research Institute, Polish Academy of
Sciences, Biatowieza, Poland.
Special emphasis is payed on a series of papers
e Bisoniana — over 110 papers devoted to anatomy, physiology, ecology, behaviour, of the European
bison and its hybrids with domestic cattle.
e Studies on the European hare — over 50 papers have been published on hare morphology,
reproduction, and different aspects of population ecology.
e Monothematic issues or supplements — Ecology of the bank vole (1983), Ecological genetics in
mammals I (1993), II (1995), II (1998), Developmental homeostasis in natural
populations of mammals: phenetic approach (1997).
More information are available on Internet: http://bison.zbs.bialowieza.pl/acta/acta.html
Manuscripts for consideration should be sent to:
The Editor, Acta Theriologica, c/o Mammal Research Institute, Polish Academy of Sciences,
17-230 Biatowieza, Poland
e@ Manuscripts are peer-reviewed e@ No page charges e Fifty reprints free of charge
Subscribe today or request a free sample copy by filling in the order form
Subscription rates: Institutions 102.00 USD per volume, Individuals 68.00 per volume
Postage included. Full air mail delivery (on request) is possible.
Back issues are available.
ORDER FORM for PERSONAL/INSTITUTIONAL SUBSCRIPTION
Please tick appropriate box and send an order card to: Polish Academy of Sciences,
Mammal Research Institute,
17-230 Bialowieza, Poland,
e-mail: acta@bison.zbs.bialowieza.pl
LJ Please enter my subscription, beginning with: Volume 42/1997, Volume 43/1998, Volume 44/1999
LI Please accept my cheque for
CL} Please send me a sample copy. U) Please send me instructions for contributors.
EVOLUTION OF SHREWS
Edited by JM. WOJCIK and M. WOLSAN
In spite of an apparent recent increase of interest in shrews (Soricidae) and an impressive bibliogra-
phy on the evolution of this fascinating group of mammals, until now there has been no compre-
hensive work that deals with current problems in shrew evolutionary research. This book represents
an attempt to redress this omission, by offering a volume that seeks to review the present state
of our knowledge of shrew evolutionary biology.
CONTENTS: Introduction; A Classification of the fossil and Recent shrews; Fossil history of shrews in
Europe; Fossil history of shrews in Asia; Fossil history of shrews in Africa; Fossil history of shrews in North
America; Dental adaptations in shrews; Chromosomal evolution in shrews; Chromosomal evolution: the
case of Sorex araneus; Protein evolution in shrews; Mitochondrial DNA evolution in shrews; Evolution of
energetic strategies in shrews; Evolution of social systems in shrews; Shrew mating systems; Appendix: A
list of the living species of shrews; Taxonomic index.
Published by Mammal Research Institute, Polish Academy of Sciences
Date of publication: May 1998
Number of pages: xii + 458
ISBN 83-90752 1-0-7
Cover: hardback
Price: 38 USD + postage
To order and for further information please contact: Library, Mammal Research Institute, Polish
Academy of Sciences, 17-230 Biatowieza, Poland; Tel./Fax (+48) 85 6812289
E-mail: evolbook @bison.zbs.bialowieza.pl
To order by Internet see: http://bison.zbs.bialowieza.pl/evol/evol.htm
ORDER FORM
Please fill in this order card and send it to the above address.
Ci Yes, | would like to order... copy/ies of Evolution of Shrews
E} Please bill Me/MYy IMSUITUION 0... cede cee eee tect tear crinleniegtie eae ie
TE aa Sai (eV 13 eee mr ln CO Oe OC TN EC. ssacconanosanovtccorcwone
PNGOTOSS oo csko.coeci So ick heat eee ee ee oe NEE ee
(2
SY
(3)
(4)
(5)
(6)
(7)
BBHICBd bP, ARS GH) RBCt. lho Ch, RBC RHBELCG
BIMBGiLd: 0 Clk HO KA. [BIO LD Te RPBDMRORS RAD! ERAALTWT
WADE EVECA. Ee RY CimiICBmMTsCECH.
Ay Ove ep Fd. 2-34 AD bY+-+2v-—Y av (circulation BN) DHAnNCKS
BO ete S hn, B, BASmensa
CMS ZRBARPROMAAN CAM SNSZLICH. BRSERSS Ci-TANe Has LK CA
Vt as Y) ear
bo—K, BEC OMBMBCH. TAFVAKSTI, [4HEHBO—i], PREBO—MRI, [5
ER OCA |, (REBOZ#| & 4 BORER bh, CHEN20K Fr, 220K Fr, 160
KEV, MOK RUC LE. SOC PSs cE OH LH), MAlLARHOSMAD AE S
Hhiboct. SBMCIIMAICTA, BMBHEROKDOFRE LCILAWCL: 5. BRD
BSbrsAckteab, BMBCKSEMRMCEAROTT.
2 RED 2 HO
HACEHEDZS Lieb 1F20054 (64K) COA, DP LORRNITCRH HS SDT CLD YD E
ah. ZHEKSCAMABbonNIT RIE Bes L, 1 EU ACRES SST ODE DD
xD teititte 0 EA (2000EORS CRAL, AK ITC HH MICHET OUR YE
+). Et, ARENAS OAMERLEZ Sie bit, 20028¢ CHE, 2H, BITS, F
SHH CvADS CR. DED OED (BRHRITBAHED 3468). ty YavV7-T7Yay
SOR-HHA RRFELC SSB SV VEER BY RAH SAIL, 20014FD ITC K
A (M77 A) CBML, Bonxe SBME IDEPHOS TL: D.
4. BRSHoncn
ZOEH, KLA, KER, Ball, ABR, Hae
1. HRS LIRE SWS &OP
FCiCBIMeERSAKAEEROAGYV bo LeSERVETA, BRABICOUTE IWS
RCH a BH bCL 1 oD. ITC AABIELRRT FIC4RD, COBRCDE DBZ
TBD NICES Tho ROI, BE PROA« 3A, BRARICHIR LCR RI - BCR -
H)|, ¥ PC RPSABMICMT SMA CLA bh SAFO i SY VE CHR LCE 6
FECH. BBBL UTC, JEM OMIJAMROBBICMIC, Say vReU-ATHS<
OSA ITC BAER A RICH CK hhld, EBACE.
Et, HRAROM CHD RERE RH DOAD DL BMMMGS LEVER ETM, BH
SR DPEVW bo Le brwk 3s CH Q0058CIL, ABBE L TH ZH4LNEEA).
2. RIASSEL Ae > D>
(1) ROMEO ) — FLOSS OMA DEM LED. MOICC EEC La
A> Pe MEP REED ) —F- LAR DKS IF 4 YATH. ADOMHICMTS7 FT
A RAROSZSMDYRLHUERAL, Ek, BAMHCBEOS oD eEGONSDSELNE
+f /.
a
Ay ATV 32 CHAnNS ITC C, KREIOKAV AA CHI DEO ERHDS EBbnae,
AADHELR FAILED LOCAL SD, bat bne LK. “4, NR SAIt ITC OBBBAX
LOBbh, TOBRIC ITC #BDSHBEOEeZIK Lo CT.
Ses BmiiaC, SA CARAORARIMLELK. CORR, BLACOBRAD, FP
BX GFORBOF » VAIS, FROVANT y TICORDS, BRYCRED DAE EOR
HC, ITC REX BR ENICAZCWUSZCEMDDVELK. Lael, PMNITCHBRECHSS
EDR ZTE, EWS RAED RA bTHSV ELK.
COE CBB vt, OMCHEeSIXSG SIC LCEUPRAS, KET EZHDEDDS, @c
DLO AMBX 1EORACRETAZCELHLY, EDF Db, 4 FRORILEINICA
WBE CHL LBZ, TATVAKSE ITC BBBARICH LT, | 2001F- KAO RA COBH EIL
eID <<, APTHE CHS. ORO RRIICRN LCA, Foci z brig &
eae oe Ne 1 Lie.
TATVAKSER, PRAS CHROME AICO Cam L, ITC RNBASLED SIA
Tal pec BEMIS OV CRATSZCLICLELK. RNBBSITHR, FL, BSPEHK OBAEDS ay
fe CHS CEXRAL, SbICR ANT RNITA RAR SI AMCCLICEOELK.
BIALETA, FAT AKSOBAIC ANAS SI ITC KEARSE OPA SH 5 OD
lt, BOIRRHOM7T 7) AHMBDPRTSERLHKEDOCLE. CORD, ITC H#EBE
AWD CBRMORBHMEELEboKRbU CH. CR, B77) DEABDRGE YLT,
SE Gove ae Ib iee
3. ITC BARIEICR SSK LORS
l. BAFSSOMEA
ITC Dig h GIEW7cFLF OKA CHSACERBRZSAL, AAMABZADORVICR
Vic H OES. LeeBol, HEORABAICKH ST SRA SOF Zit HFA L OBI ER
DISD bRFASDEABRNCT VY eHEDS | EDO ARB bSBS EL. REL, [EMM t
V5 Ot [RED] CHSZCEABRLERA. ITC OHAMEICBMRAROFSULBITHSL
FIV CETL, HMO L I) ITC CIAO PMRILSHOERA. LKB, REEDS,
BRA, 7S, KES, SES, FROWTSORBTSLBITAZOARE4RBKLOLS
ZOWEF. Eh, fWFAMBMLy VY a VEOR-—WIM1 ABM HILASOMBAAAD OD, Fk
bKSKBADHD OED. BRRROSLCOBALTEbANIE, MEMICEDDOET. Bal
LET, HAS hae ¢ OFM EEG MB ICANSZNSBRLEZHNET.
2. We EO es
ZUR 38425) OFadicit (BIPMAO hic IFA AD b=aFAAOBRAD DE | Cc
HO LEDRESN COED. LOL, REBICHTABIMD CRIB A RET ANS CHSZCL,
FAD CUSCE GAD SOBMEAAMOTA), AADMiftfEceERAZSE,
Dia DILRIR IA VY EB RZKRAOMER CT. BEET, 18H SNKERAERSZS
Clit, MTEETAR (6B A - BRRVOMATABAAYLSED) & PERM: UCHSIE
mye sirewekt Uk. ITC OBMARCAS HRAFLRSSILRSROFSCH), BALE
eA y ceo) METAL AWE 7c ARIE ABE CL OD, REHAB BAS CEH I5
12.
Be
14.
Ie
16.
Ws
18.
19.
20.
Ze
Mpa
dpe
24.
WD.
26.
Zale
28.
Large spatial and temporal scales in mammalian ecology: perspectives from the Americas
P. Meselve, P. Marquet
Paleomammalogy in Mexico M. Montellano, J. Aitoyo-C.
Geographical ecology of mammals D. Morris, B. Kotler, J. Brown
Recent developments in predator-prey interactions D. Murray, S. Boutin
Ecology as a tool in taxonomic studies J. Shoshani, C. Groves
Ecological and evolutionary aspects of mammal-plant interactions
M. Steele, B. Danielson, P. Smallwood
Mammalogy in Mexico: History, development, and perspectives
D. Valenzuela, L. Vazquer, J. Schondube
Experimental testing of hypotheses in mammalian behavioral ecology H. Ylonen, J. Wolff
Biology and conservation of endangered and rare deer L. Sun, D. Moore
Current priorities in the conservation of mammals I. Chestin, C. Servheen, D. Jackson
Physiological ecology of mammals Rochelle Buffenstein
The flagship species approach to ecosystem conversation. What works, what doesn’t and why
Pat Foster-Turley
Habitat disturbance and tropical mammals: a global perspective A. Cuaron, C. Peres
Systematics and Biogeography of montane rodents in Southeastern Mexico and Northern
Central America M. Engstrom, Y. Hortelano
Molecular systematics of Peromyscine-Neotomine rodents C. W. Kilpatrick
The ecological, evolutionary and geomorphological significance of open burrows system
G. Ceballos
Veterianrians in conservation biology A. W. English
Workshops (11)
1;
oO COND AB
Dy
Migratory bats: research and conservation priorities and perspectives
G. McCracken, R. A. Medellin
IUCN/SSC Lagomorph specialist group meeting A. Smith, A. Velazquez, N. Formozov
US/Mexico cooperation in the conservation of rare species
W. Spencer, E. Mellink, J. Maldonado
History of mammalogy. K. Sterling
Meeting of Latin American Mammal Societies J. Arroyo, R. Ojeda
Prairie dog conservation J. EF Gully,
Meeting of the Mexican Society of Mammalogists R. A. Medellin
Evolution of the Procyonidae S. Zeveloff
Conservation issues concerning marine mammals in Latin America S. Manranilla et al.
Mammal diversity and conservation in Latin America G. Ceballos, R. A. Medellin
Ecology, evolution and conservation of Equidae P. D. Moehlman
ITC OPM EM BORE
19977E 7A 1 5 ACF REKEO) REE SAD OMB KAER CSR) CHRD D YO, ED
HMvat) PROP CAHMILD OEPCA. 4FIC 1 ERE Sh, RI CILKKReE PDIC1, 000A
EOZIMap oo ecmIN Cle s. EGiie CObMEMIS 1. 2A77, 2. 777 —, 3. ~rvy
22, A. sa PSEY PY, Bs WS =, OS VP Sas lo rave Yel) G23 Opera w
) DAEAIE-C2001ZEICEADNSAPIECT. BIBRRM, Fuse V-ety Va VR VV RLV AK
EWZMACHNOKE CHV DH eC ERBDHETAR, CEOCHKZAEMLET AT V2 (44
2GRE) KSOMEBT LET.
lo YP DDS
TAF VARKSIh, 199749 A7ADSILAECOS AM (3 HARARE AR SO ROCHEHR 4
Hisl) BAaaeEL KR. VV RVD AUER EFRCOONT, HCEATO << OPOX YY a
YUL FR Db FRG bE CHAN), THENIOABERBEMCSZEG CHAN, FROY
YRYDA (I-FYayT7) ORNNCKSR (SIMBVOAS bv) CHVFV-t#y YarvEPH
DE LIE HIE, YSZ Yap 7 SS VIRL YS CRIA st Drews Ciayay, icles ae 7)
aVPAVTy bRHVELK. CHOOOBBRICMZ, RAK-BREKSELAHTC 4 AH
0, ZO AHOKSRADPAEBD) CAPS bHvELE. FVFV—ty Vay, VV
VIR, JHIV 5 yy TORA PWEA-DIA F— (DSHS) KOM) CT.
Plenary sessions (4)
The Mexican commission of biodiversity: assessment of status of Mexican biological diversity
J. Soberon
The vicarious Gondwanan history of mammals, the other history R. Pascual
Body size and biodiversity J. H. Brown
The wild and the time in the past and the present J. Clutton-Brock
Symposiums (28)
1. Island biogeography, comparisons between insular and mainland populations
S. T. Alvarez-C., L. Heaney
Mammal collections S-T. Alvarez-C., A. Castro-C., M. Hafner
Canids ecology and conservation T. Fuller, M. Mills, D. McDonald
Biology of gliding mammals R. Goldingay, J. Scheibe
Global changes in mammal diversity at the end of the Pleistocene R. Graham, J. Arroyo-C.
Sai Claes)
Demography and population dynamics in Clethrionomys
L. Hansson, G. Bujalska, N. Yoccoz
7. Evolution and biology of Old and New World Hystricognath rodents R. Honeycutt, Burda
8. Biology of subterranean rodents: evolutionary challenges and opportunities
E. Lacey, G. Cameron, J. Patton
9. Biology and management of pest rodents H. Leirs, G. Singleton
10. Ecology of disease and parasites in small mammals: victims and models
H. Leirs, H. Henttonen
11. Behavioral and demographic responses to a patchy world: a mammalian perspective
W. Lidicker
Esl ESM YLAR=< (International Theriological Congress)
pater OVY TC
Fi ASM LAA 22 75 a
1. AFORE
KER O FEAT OV CLA B BWR DAA LETD, 20 HESH CODE 9 RRMA
“7 (International Theriological Congress ; LX F Crk ITC EMS MTS) OB ABAED BAIAYLS
PRICE SNH CWE. COMM TIE, BEICEAE A REM SES ORN AT bn CRE LCM,
SE 5 A 8 AICO MRAS TES, SbICA AM cee ies LE Li. CORR, ITC O
BAIL, SAL SOICFRO Be (EEL, AA OMAR ZORBICKS < BRITS EH
L, [RRC LCRAMOF A CHis GIR CRAIC RER) whys | & Oiiawlc
wLELK. Lal, BRRFSOREIL, KETO HS CL 2, AFSC - SAIC
KE ABRBAD OC LICERN ED. Lieto, [ARCEMLHDS | KOK ABOTR
READER AS LIAS SD ECEHO EVA. ME ITC AA (Q0014EB7 7 ) DHEA) OX
TD 2 MRE RD EPL AND [AB] oR < & MOREA AKIC ITC HHMI AS
DBD 0, GFOBRBKS Clk [ARTE iae HED SOL | ICRA CR BOR SA ORRY
WKEEERWEBZCWED. COLORES, ZHEBASOR ITC RBOT SYVEX
BAKE L, ITC HEM BOTH B ES RICHERTSCLAEROELK. LOL, BEBO
CHA OKA RIC FIT Se LCE SCL TEDHOED. CORD, SAIC COMPRA
LURARICARY BEV TARR PEL, S5ICGHEO ITC ONAP HACKS SHEAEO
ene, ERR ReO BAEIC Bd SEY - SR, FON 4) y bree eA THK CEICL
Ele. tavveRk dhe (FRE LCLANOA A CEMA S | = LIC 4 HL
LO CHEAP Sv». feds, BLM CHEE > CV AiARIS, EEA EAMMAMICED bNREOCH
(ABBORD [HAMEED | OMAHA TRIMER). Lito, BHC
DIS BRA CBE SH DBAS EA CUS ARE HOES. CORIO TIL BHP LOCO
WESS FE SW:
2. ITC chive MmORERICOWT
Ae be USB) > PHE5 (al: Bleeatees)
ITC OBAERTBIA, 1997 OT ATA AKSOPAC ITC BBBDOSATBANKE LCM
SOC, VRB WeBD CR CPA bm BRAROUEK CRO DbE Lae
BRLEF.
ITC (294A SFOR 4 DEN c RAR, HAMAR eWRE LCI (aa: SR
137
Author
Abe, H.
Abe, S.
Agungriyono, S.
Ando, A.
Ando, K.
Asada, M.
Asakawa, M.
Atoda, O.
Boonsong, P.
Chan-ard, T.
Doi, T.
Endo, A.
Endo, H.
Funakoshi, K.
Gao; Z: Z..
Han, S. H.
Hayashi, Y.
lanai oY
Hondo, D.
Hongmark, S.
Inuzuka, N.
Ishibashi, Y.
Jiang, Z.W.
Jin, K.
Kaji, K.
Kaneko, Y.
Kanzaki, N.
Kawamichi, T.
Kurohmaru, M.
Mano, T.
Maruyama, N.
Masuda, R.
Mori, T.
Motokawa, M.
Murakami, T.
Nabhitabhata, J.
ee LS,
a5
sell
> 45
65
5 15338 838 @5)
is)
223 i/
a37s23> 1
: 95; 23: 49
: 63
lise 25
8 ai)
Tle SOS NGS 8109
: 109
SeSilerso3 25379
Se 7-238 1
: 41
: 109
Nadee, N.
Nagata, J.
Nakamura, K.
Nakata, K.
Nakatsu, A.
Nishiumi, I.
Nonaka, N.
Ochiai, K.
Ohdachi, S.
Ohno, W.
Saitoh, T.
Sakaizumi, M.
Satoh, K.
Shimazaki, K.
Shiraishi, S.
Smeenk, C.
Sugasawa, K.
Suzuki, H.
Suzuki, T.
Takahashi, K.
Takatsuki, S.
Takeda, Y.
Tomisawa, M.
Tsuchiya, K.
Tsukada, H.
Uraguchi, K.
Urayama, K.
Wakana, S.
Wakayama, T.
Yabe, T.
Yamada, J.
Yamada, T.K.
Yamagiwa, D.
Yoshida, M. C.
Yoshinaga, Y.
Zubaid, A.
23:
23:
23:
Dike
22:
23:
ai lg
21:
21:
24p26
D2):
21:
DD:
23:
DD:
mails
23:
21:
23:
D2:
DD):
23:
2S:
21:
21:
23:
21:
Pile
21:
23:
23:
23:
21:
DD:
D2:
D2:
Mammal Study
1
95
119
59232) 19
Pay
1
1337/
15358235095
653722 ili e23395
53
55 2
15
39
119
45, 53
161
O85
1535 WS
109
393) 23305
I 2331635103
49
109
5), 15)
STs 2728 Al
31
59
155125
37
123, 129
1
119
Shy
339233 95
53
95
index
raccoon dog
radio-tracking
radiotelemetry
rat, roof
Rattus argentiventer
— exulans
— norvegicus
— rattus
rDNA
red fox
reproduction
reproductive cycle
resource partitioning
restoration
Rhinolophus cornutus
— ferrumequinnum
ribosomal DNA
Rishiri Island
Russia
scrotum
sexual dimorphism
sexual maturity
Shikoku
Shiraishi, S.
Shiretoko
shrew
Sichuan
sika deer
Sikkim
silicon reconstruction
Sorex caecutiens
— gracillimus
— unguiculatus
South Korea
2S:
Oa:
23:
DS:
23:
23:
23:
23:
alt:
21:
23:
Mpeg
23:
21:
23):
23:
Di:
21:
23):
22:
22:
Mp9
eile
D2:
Dil:
Qiks
Pale
21:
21:
23:
Pails
21:
Dik:
pails
109
Di
41
123
129
129
9, 129
123, 129
15
1B 72222 Til 28205)
19, 103
95
49
43
49
49
Sy 125
15
63
81
53
S23 319
71
1
13722 3e/ aol
652.22 1
89
Pil NSBR PBR LS IKOS)
161
119
65
65
65
125
spatial segregation
species diversity
Stipa
surface activity
sympatric
Szechwan
Talpidae
taxonomic revision
taxonomy
telemetry system
temperature
temporal muscle
testis
trace recorder
triangle size
twin
twinning rate
ultrasonic vocalization
ultrastructure
underground activity
Ursus arctos
vole, gray-sided
—, Japanese field
— , northern red-backed
— , red-backed
=, Stn
— , Smith’s red-backed
Vulpes vulpes
wildlife conservation
Yunnan
21:
2apee
23:
22):
235
21:
21:
vA
Aai18
apy
23:
23:
248
23:
23:
23:
23:
2
23:
22:
23:
Dupe
2s
papa
2g
Zr
Ia
21:
23:
AA Ie
136
S13023279
109
41
103
103
53
85
11
41
5
5929222 5832349555
39
1522245
161
45
137; 2207 eas
63
89
135
heterozygosity
histochemistry
Hokkaido
home range
Honshu
identification
Inner Mongolia
insectivorous bat
interference competition
Japan
Jindo island
joint angle
Kanto
kinematic gait analysis
Korea
Kyushu
laboratory mouse
laboratory rat
lens weight
limitation of reproduction
locomotion
longevity
Malayan pangolin
mammal
mandible
Manis javanica
masseter muscle
masticatory muscle
Mesocricetus auratus
microsatellite DNA
Microtinae
Microtus
Microtus montebelli
— pennsylvanicus
— sikimensis
Miniopterus fuliginosus
mink, American
mitochondrial DNA
Mogera
Mogera imaizumii
Mogera minor
— tokudae
— wogera
23:
23:
21:
D2:
23:
21:
Pails
21:
23:
23:
Dap
ai
D2
23:
Dile
ail
Dil
21:
21:
Dike:
23:
23:
DD:
D3:
21:
21:
23:
Bilt:
23:
23:
2S)
23:
23:
D2:
DD:
DD:
Dili:
23:
21:
21:
23:
21:
21:
21:
21:
pail
21:
ails
95
9
53 OS, lls
lil, 7le
31, 41, 95
D295 254 109
il
89
63
49
11
Se 77/5 S39
le 7s
31, 41, 103
125
43
59
43
15
71: 23: 49
SLR IR D354 S82
9, 85
1
161
49
37
IS}, 1S
Mls AS
Mls WAS
115
71
Mls 1S
molar
mole, Japanese
Mongolia
Mongolian gazelle
morphological variation
mouse, Japanese field
— , Japanese wood
— , striped field
Mt. Goyo
mtDNA
murids
Mus musculus
Musculi digastricus
— masseter
— mylohyoideus
— temporalis
Mustela
Myotis macrodactylus
— nattereri
Nara
Nara River
nasal sac
Nemuro Peninsula
Neodon sikimensis
nest burrows
nests
neuromuscular junction
niche shift
nocturnal activity
Nozaki Island
Nyctereutes procyonoides
Ochotona daurica
optic lens
orange, tankan
Oshima
pangolin
pawpad lamillae
PCR primer
Petaurista leucogenys
Phocoenoides dalli
pika, Daurian
Pitymys sikimensis
polymorphism
population density
porpoise, Dall’s
postnatal development
prey selection
Procapra gutturosa
provisions
pulmonary vein
ile
21:
23:
2S:
21:
23:
21:
21:
23:
21:
23:
23:
23:
DS:
23:
2S:
21:
23:
DS:
D3:
ile
23:
23:
Pails
DD:
DD:
23:
DR:
2p 48
Palle
23:
D2:
pap
23:
23:
23:
23:
Dapp
pape
DS):
2p 92
21:
Dit:
23:
23:
DD:
23:
23:
21:
Zit:
Mammal Study
1
Wis WIS
63
63
89
19
Sy)
125)
105
IS V5)
129
5
81; 23: 79
119
89
161
iSeel25
19
119
SBS 2-838 tsp)
49
63
11339/
37
index
Index
This index covers Mammal Study Vol. 21 (1996) to Vol. 23 (1998).
Subject
Abe, H.
acetylcholinesterase
acquisition
age at sexual maturity
age determination
age estimation
age variation
Amami Oshima
Aneurolepidium chinense
Apodemus
Apodemus agrarius
Apodemus argenteus
Apodemus speciosus
Arvicola
Arvicola sikimensis
Arvicolidae
Asahikawa
automatic collar release
system
bark-stripping
begging behavior
Boso Peninsula
bottle neck
breeding season
brown bear
cardiac musculature
cardiac myocyte
Cervus nippon
Cheju Island
Chiba
China
Citrus tankan
Clethrionomys
Clethrionomys glareolus
— montanus
= is
— rufocanus
— rutilus
— sikotanensis
coexistence
conception date
condylobasal length
Cynopterus
Daikoku Islet
Delphinus delphis
22:
23:
Ds
23:
22:
2096
24118
23:
23:
225
21:
2p 4p
Male
Dit:
Dit:
21:
225
23:
23:
mails
21:
23:
23:
23):
rails
21:
2A
21:
Dil:
Dil:
23:
21:
Dil:
ah |p
21:
21:
Dike
21:
D2:
21:
21:
22:
21:
23:
15
WS 28 ME)
595 225271
161
161
89
27
109
123
137
153
95
19
4]
3)
By)
Zils NSBR PRE Cd MOB
125
153; 23: 95
89; 23: 63
123
ISR 2418. Si, Pall
1
15
15
els 222.5527,
ISS 2428 39)
15
11
153
den
digastric muscle
distribution
dolphin, common
dynamic interaction
enamel pattern
Eothenomys
Eothenomys andersoni
— chinensis
— custos
— eva
— inez
— olitor
— proditor
— regulus
— shanseius
— smithii
— wardi
ermine
error estimation
eye lens
fecal analysis
ferret
fiber types
field test
flying squirrel
— , Japanese giant
food begging behavior
food habits
food shortage
foraging behavior
forest structure
forestry
gait analysis
geographic variation
Geoje island
golden hamster
Gompertz equation
Goto Archipelago
growth curve
habitat factor
habitat preference
habitat selection
haplotype
23:
DS:
Dil:
23:
21:
21:
2p42
Dike
21:
ilk:
ile
Pai IB
21:
21:
21:
Pai le
21:
21:
Dit
23:
2p
23:
21:
23:
23:
pee
22:
DD:
Zit:
DD:
2:
74942
22%:
21:
Ot
74) (2
23)
2p 2
21:
22
21:
21:
23:
71418
1; 22: 45
41
81; 23: 79
81; 23: 79
71
137; 23: 9, 49
89
137227195
Dil
Di
Instructions to contributors
Mammal Study publishes original Articles, Short Communications and Reviews, written
in English, on all aspects of mammalogy. In principle, membership of the Society is pre-
requisite for the submission of papers except for invited papers, but non-members may be
co-authors. Manuscripts are submitted to qualified referees for critical scientific reviewing.
Authors are notified, with referees’ comments, on acceptance, rejection or need for revision
within three months. The editor also customarily sends accepted manuscripts to qualified
reviewers for English editing.
Manuscripts should be submitted typewritten on one side of the paper (use A4
21.0 x 29.7 cm paper), and double-spaced. An approximately 3 cm margin should be left on
all sides. Do not hyphenate words at the right margin. Manuscripts should be arranged in
the following order: the title, name(s) of author(s) and affiliation, fax number and E-mail
address, abstract (fewer than 200 words) and key words (five words or fewer), main text,
acknowledgments, references, tables, figure legends, figures. Titles of papers must be ac-
curate and concise, and (for abstraction services) include any relevant taxonomic name.
Text pages should be numbered through from title to references. Manuscripts should be
line-numbered, every five lines, in the left margin. Short Communications do not exceed
four printed pages. Abstracts and key words are omitted from Short Communications.
Tables and figures should be simple and self-explanatory, and their preferred locations
should be indicated in the right margin of the text. The author’s name and figure numbers
should be written on the back of original figures and on the surface of copies.
Scientific names should be written in italic. All measurements should be in metric units.
The following abbreviations should be used. Length: km, m, cm, mm, etc.; area: km?, m?,
cic = volume: kim, m>°, kl, Il, mil, etc.; weight: ke, g, mg, etc.; time: hr, min, sec, etc.; others:
cal, kcal, °C, Hz, df, P (probability), SD, SE, CV, etc. Arabic numerals should be used for
numbers exceeding 10.
References in the text should follow the forms: “Uchida and Shiraishi (1985) stated that
...., (Abe and Kawamichi 1990), and (Miura et al. 1993). More than one reference within
the same parentheses should be listed chronologically, alphabetically if of the same year.
Full references cited must be listed alphabetically by the first author according to the fol-
lowing examples:
Abe, H., Shiraishi, S. and Arai, S. 1991. A new mole from Uotsuri-jima, the Ryukyu Is-
lands. Journal of the Mammalogical Society of Japan 15: 47-60.
Eisenberg, J. F. 1981. The Mammalian Radiations. University of Chicago Press, Chicago,
610 pp.
Geist, V. 1982. Adaptive behavioral strategies. In (J. W. Thomas and D. E. Toweill, eds.)
Elk of North America. Pp. 219-277. Stackpole, Harrisburg.
Obara, Y. 1991. Karyosystematics of the mustelid carnivores of Japan. Honyurui Kagaku
[Mammalian Science] 30: 197-220 (in Japanese with English abstract).
Authors are recommended to refer to recent issues of the journal for details of style and
layout.
Manuscripts should be submitted in triplicate, with a separate sheet giving the title,
author(s), name(s), and address(es) for editorial correspondence, a running head (fewer than
20 letters), the numbers of main text pages, tables and figures. Do not send original figures
until the paper has been accepted.
Galley proofs will be sent to the author. Reprints may be purchased in blocks of 50.
Mammal Study
Vol. 24, No. 1, June 1999
Contents
Original papers
Hashimoto, Y. and Yasutake, A.: Seasonal changes in body weight of female
Asiatic black bears under captivity :--:-:--:-+:-1: tee crecet terete eee ee ee ee
Lee, T. H. and Fukuda, H.: The distribution and habitat use of the Eurasian
red squirrel Sciurus vulgaris L. ee summer, in Nopporo Forest Park,
Hokkaido Sie ob eilevin sale eyrah w (a js'Uelle (oileh lemon entep arreieitey wise tesreilay ayreawea todwires sewatie epteltel aire iemaytor cite eaOweM eon eR eISn Cue Cn omen Sn RG ieaeaemene PR Eso ah
Takahashi, H., Kaji, K. and Koizumi, T.: Molar + wear rates in Sika deer
during three population phases: increasing versus decline and post- peti
phases \iSiegs ial aie use la G cighsiageie wlebie cress weld baie le Re Ole Deas be ene 7
Hosoda, T., Suzuki, H., Iwasa, M.A., Hayashida, M., Watanabe, Sa
Tatara, M. and Tsuchiya, K.: Genetic relationships within and between
the Japanese marten Martes melampus and the sable M. zibellina, based —
on variation of mitochondrial DNA and nuclear ribosomal DNA -::::: ee DS
Iwasa, M.A., Han, S.H. and Suzuki, H.: A karyological analysis of the
Korean red-backed vole, Eothenomys regulus (Rodentia, Muridae), using
differential staining MCAtThOdS crc rrr en ene tence eee eee enna 35
Suzuki, H., Iwasa, M.A., Ishii, N., Nagaoka, H. and Tsuchiya, K.:
The genetic status of two insular populations of the endemic spiny rat
Tokudaia osimensis (Rodentia, Muridae) of the Ryukyu Islands, Japan
The Mammalogical Society of Japan
Vee De oo ik come meee
ISSN 1343-4152
f the Journal of
ion oO
t
The Continua
iety of Japan
| Soc
Ica
:
the Mammalog
Tere Snelson Se
nu
fe)
Z
+
N
To
>
@D
xz
®
=
®
O
®
ra
The Mammalogical Society of Japan
Mammal Study Vol. 24, No. 2, December 1999
The continuation of the Journal of the Mammalogical Society of Japan
Editor-in-Chief: Takashi Saitoh
Associate Editor: Takuya Shimada
Editorial Board: Masao Amano, Mark A. Brazil, Nikolai E. Dokuchaev, Sang Hoon Han,
Allexei P. Kryukov, Tsutomu Mano, Masaharu Motokawa, Satoshi Ohdachi, Tsuneo
Sekijima, Hitoshi Suzuki, Masatsugu Suzuki, Seiki Takatsuki, Hidetoshi Tamate,
Toshio Tsubota, Akihiro Yamane
All correspondence regarding manuscripts and editorial matters should be addressed to:
Dr. Takashi Saitoh
Kansai Research Center
Forestry and Forest Products Research Institute
Momoyama, Kyoto 612-0855, Japan
Phone: +81(Japan)-75-611-1201; Fax: +81(Japan)-75-611-1207
E-mail: bedford@fsm.afirc.go.jp
Published by The Mammalogical Society of Japan
Officers and Council Members for 1999-2000
President: Noriyuki Ohtaishi
Secretary General: Masatsugu Suzuki
Executive Secretary: Keisuke Nakata
Treasurers: Toshihiro Hazumi, Nobuo Ishii
Council Members: Hisashi Abe, Teruo Doi, Hideki Endo, Kimitake Funakoshi, Koichi
Kaji, Yukibumi Kaneko, Takeo Kawamichi, Kishio Maeda, Shingo Miura, Okimasa
Murakami, Takashi Saitoh, Seiki Takatsuki
The Mammalogical Society of Japan was founded in 1987 for the purpose of promoting
and fostering mammalogy. The society publishes original papers in two journals: Mammal
Study (the continuation of the Journal of the Mammalogical Society of Japan) for papers
written in English, and Honyurui Kagaku [Mammalian Science] for those submitted in
Japanese. Each journal is published twice a year. Submissions are considered on the
understanding that they are being offered solely for publication by the Mammalogical Society
of Japan. Both journals are distributed free of charge to the members of the Society. The
following are the annual dues for the membership:
Domestic members
Individual members ¥9,000 (Student ¥7,000) Institutional subscriptions ¥25,000
Overseas members only for Mammal Study
Individual members ¥4,500 Institutional subscriptions ¥12,500
Overseas members for both journals
Individual members ¥9,000 Institutional subscriptions ¥25,000
All correspondence regarding application for membership, subscription, address change,
and other matters should be addressed to:
The Mammalogical Society of Japan
Business Center for Academic Societies of Japan,
Academic Society Center C21, 16-9 Honkomagome, 5-chome,
Bunkyo-Ku, Tokyo 113-8622, Japan
Fax: +81(Japan)-3-5814-5820
(©1999 The Mammalogical Society of Japan
All articles published in Mammal Study are protected by copyright. Any form of
reproduction requires prior written permission from the Mammalogical Society of Japan,
with exception of personal photocopying.
Front cover: The red-backed vole with their chromosomes illustrated by Makiko Kashiwagi.
Printed in Japan by Nakanishi Printing Co. Ltd., Kyoto.
Mammal Study 24: 51-65 (1999)
© the Mammalogical Society of Japan
Morphometric variation of house mice (Mus musculus)
on the Izu Islands
Yasushi Takada!, Eiichi Sakai?, Yasushi Uematsu? and Takashi Tateishi*
1,2,3Department of Anatomy, School of Dentistry, Aichi-Gakuin University, Chikusa-ku, Nagoya 464-
8650, Japan
4Omiya Research Laboratory, Nikken Chemicals Co. Ltd, Kitabukuro, Omiya 330-0835, Japan
Abstract. We conducted univariate and multivariate statistical analyses of the morphometry
of five island populations of the house mouse Mus musculus, from the Izu Islands (Oshima,
Nijima, Kozushima, Miyakejima, Hachijojima), and compared them with three populations
from the Japanese mainland of Honshu (from Kamogawa, Yokosuka, and Kawazu). Anal-
yses were based on bodies, mandibles and molars. According to the analyses based on the
mandible and molar measurements, the island samples differed from each other, and many of
them also differed from the Honshu samples, although there was no evidence of positive
directional variation, such as gigantism, in the insular samples. Cluster analyses of mor-
phological distance, based on mandible and molar measurements, indicated that the island
populations, with the exception of that on Oshima, were closely related to those on Honshu,
while the Oshima population was slightly more distantly related. These results indicate that
the divergence of the island populations is mainly attributable to the genetic variation of the
initial founders and to subsequent isolation. The differentiation of the island populations
may have taken place as recently as within the past 1,200 years.
Key words: Izu Islands, mandible, molar, morphometric variation, Mus musculus.
Islands are physically isolated, and changes amongst island populations can be expected to
be conserved and to progress rapidly. Information concerning morphological and genetic
changes in island populations is important, therefore, in contributing to an understanding of
speciation. Island populations of rodents have proven to differ morphologically and geneti-
cally from both mainland populations and from each other (see for example Hiraiwa et al.
1958; Miyao et al. 1968; Berry 1969; Berry and Rose 1975; Berry and Peters 1977; Berry et al.
1978; Sakai and Miyao 1979). That these genetic differences can accumulate rapidly, has
been shown by Berry and Jakobson’s (1975) classic example of a mouse population on
Skokholm Island, UK, which showed genetic changes over just 30 years.
The house mouse Mus musculus (or Mus molossinus according to Marshall and Sage
(1981)), occurs on many of the small Japanese islands (Imaizumi 1960; Abe et al. 1994). So
far, genetic studies using biochemical markers have concentrated on the geographical varia-
tion amongst house mice throughout Japan (Minezawa et al. 1979, 1980), but they have not
‘E-mail: ytaka@dpc.aichi-gakuin.ac.jp
52 Mammal Study 24 (1999)
found clear-cut divergences among insular populations, presumably due to the small number
of specimens examined from each locality and because of the limited number of markers.
Several studies have also revealed morphological variations amongst some insular house mice
populations (Suzuki 1980; Takada et al. 1994), however, populations within an archipelago
have not, so far, been studied.
The Izu Islands lie 90 km (Oshima) to 350 km (Aogashima) south of Tokyo Bay (Fig. 1).
They range in size from Oshima, which at 91 km? is the largest, to Toshima and Shikinejima,
which at just 4 km? are the smallest. These islands are mostly inhabited, but have just five
species of rodents and insectivores. These are the house mouse, two species of rats Rattus
norvegicus and R. rattus, the Japanese field mouse Apodemus speciosus, and the white-
toothed shrew Crocidura dsinezumi (Nishikata 1986; Takada et al. 1999). Both the field
mouse and the house mouse occur together on Oshima, Nijima, Kozushima (Kozu) and
Miyakejima (Miyake). In addition, field mice alone are found on Shikinejima, and house
mice are found alone on Hachijojima (Hachijo). White-toothed shrews occur on Toshima,
Nijima and Shikinejima.
In this paper, we describe the morphological differentiation of house mice in the Izu
archipelago, having analyzed morphological variation amongst five insular populations from
Oshima, Nijima, Kozu, Miyake and Hachijo. Furthermore, we compare these five island
YOKOSUKA
35
® ostima
c]
NIJIMA
A
KOZU e MIYAKE 3 4°
Ee )
—p Z
HACHIJO
¥
33 N
140° E
Fig. 1. A map showing sampling localities.
Takada et al., Mice on the Izu Islands 53
populations with three mainland populations from Kamogawa (Boso Peninsula), Yokosuka
(Miura Peninsula) and Kawazu (Izu Peninsula) areas of Honshu, the Japanese mainland.
Materials and methods
House mice were collected from December to March 1994 to 1997, using snap and live
traps set in grassland around cultivated fields. Each island and peninsula was visited once
for four to five days, with the exception of Kozu, which was visited three times in 1995
and 1996. The following data were recorded: sex, body weight (BW; for pregnant females,
excluding embryos and uterus), head and body length (HBL; from rostrum to anus), tail
length (TL; from anus to tail tip) and hindfoot length (HFL).
The age of the mice specimens collected was predicted using a linear regression equation
of eye lens weight against age (after Takada 1985). Only data from adults (two months old
and more) were analyzed for bodily dimensions.
Mouse heads were skinned and boiled for several minutes in water then soaked with a
tripsin solution in order to produce clean skeletons (following Takada et al.’s (1994) tech-
nique).
The right mandibles and right molars were measured to the nearest 1/100mm and
1/1000 mm, respectively, using a Nikon Measurescope. For mandible measurements, only
specimens aged two to eight months old were used in order to reduce age-related variation
(Lovell et al. 1984). The X-axis was fixed as the inferior edge of the mandible and the Y-axis
as the anterior edge. Ten dimensions were measured; five (M1-MS) consisted of heights and
the other five (M6-M10) of lengths (Fig. 2).
The buccolingual crown diameter was measured for upper (UM1 to UMS3) and lower
molars (LMI to LM3). The occlusal surface was kept horizontal and the widest part of the
crown was measured at right angles to the longitudinal axis of each molar; the axis being a
line connecting the central cusps for upper molars, and the central groove for lower ones.
For molar measurements, specimens with slightly worn cusps (dental wear categories 3 and 4
in Lidicker’s (1966) criteria) were used, and an average of two measurements for each molar
was used for the following analyses. Measurement errors were negligible; for the Oshima
sample (1=27), Gerrors WaS 2.1-:10~3 to 3.1-10~3 mm for each molar, where o2,,5,; was the sum
of the squared difference of the two measurements divided by 2n (after Murai 1975).
Because no significant sexual differences (P>0.05) were found (either for body (HBL,
Fig. 2. Diagram of right mandible showing the 10 measurements.
54 Mammal Study 24 (1999)
HEL, tail ratios=TL/HBL), or mandible or molar measurements; tested by f-statistics and
Mann-Whitney’s U- one TTEST and UTEST respectively (see Aoki 1995) for body, and
using Wilks’ A- one (WILKS, Aoki 1995) for mandible and molar measurements), data from
both sexes were pooled for the following analyses.
Morphometric differences between samples were analyzed using univariate and multi-
variate statistics. Significant differences between sample pairs were tested using the Scheffé’s
method of multiple comparisons after Kruskal-Wallis test for the tail ratio, and using Ryan’s
method of multiple comparisons for the other variables (KWTEST and MCOMP respec-
tively, Aoki 1995). To evaluate the divergence of the island samples, the relative deviation
from the Yokosuka sample, one of the mainland samples with a relatively large number of
specimens, was calculated using (mean,;—mean,)/SD,, where, mean, was a sample mean, and
mean, and SD, were the mean and SD of the Yokosuka sample. For multivariate statis-
tics, principal component analysis (PCA, Tanaka et al. 1984), using a correlation matrix of
pooled samples, was employed. Mahalanobis’ generalized distance (D?) was calculated as
an indication of morphological divergence between samples (MAHPCV, Tanaka et al. 1984).
Cluster analysis (CLUST, Tanaka et al. 1984) was also carried out using the group average
method based on D?.
Results
Body sizes
Significant differences between sample pairs were tested for HBL, HFL and tail ratios,
but no positive directional change was found among insular and mainland samples. For
sample means and SDs of adult mice see Table 1, and for a list of variables indicating
significant differences between samples see the Appendix.
Table 1. Measurements for body size. For each measurement, sample means, SD, and number of specimens are
given from the top.
Oshima Nijima Kozu Miyake Hachijo Kawazu) Kamogawa Yokosuka
BW (g) 11.18 10.96 IDS 11.68 12.30 12.47 15.82 10.42
2.67 155583 2.94 1.91 1.94 2.02 2.28 Dei
16 29 22 15 26 25 21 27
HBL (mm) 68.16 68.90 68.59 69.11 71.48 71.30 75.59 65.27
5.86 4.82 6.21 4.82 5.29 5.40 4.42 5.36
17 30 22 15 26 26 21 26
TL (mm) 55.89 57.66 56.00 59.51 62.02 60.71 59.42 55.14
4.01 4.62 4.63 3.06 2.80 4.32 3.08 2.42
15 30 7p) 15 26 25 Dp Di,
HFL (mm) 15235 15.63 15.28 5.28 15.67 15.74 15.74 15.46
0.46 0.38 0.38 0.43 0.32 0.56 0.40 0.27
17 30 22 15 26 26 22 27
TL/HBL (%) 82.15 83.85 81.81 86.29 87.03 85.09 78.43 85.00
4.24 6.19 4.52 4.25 4.49 5.02 3.74 5.34
15 30 DD, 15 26 D5 Diy 26
BW: body weight; HBL: head and body length; TL: tail length; HFL: hindfoot length.
Takada et al., Mice on the Izu Islands 55
Mandible and molar measurements
Significant differences were found in variables between all pairs of sample means (see
Table 2 for mandibles and Table 3 for molars).
Principal component analysis
The first component, expressing the overall size of the mandibles, arranges the samples
from the largest, Kamogawa, to the smallest, Yokosuka and Miyake (see Table 4, Fig. 3).
The second component, expressing the shape, particularly the height (M1, M2, M4; positive
vector) to the length (M6, M7, M8; negative vector), arranges the samples from the highest,
Oshima, to the lowest, Hachijo, Miyake and Kawazu. The third component, expressing
relative height of the posterior (M3, M4, M5; positive vector) to anterior part (M1, M2;
Table 2. Measurements for mandible (x 100, in mm). For each measurement, sample means, SD, and relative
deviation from Yokosuka sample are given from the top. n, number of specimens.
Oshima Nijima Kozu Miyake Hachijo Kawazu Kamogawa Yokosuka
n 14 28 18 16 16 24 18 ZS
Age mean 78 116 90 86 113 115 106 78
in days SD 16 45 30 DY 53 39 SY) 19
M1 164.3 165.4 155.4 156.6 155.4 154.9 165.7 152.6
5.6 5.4 6.1 53 6.0 5.6 S)s5) 5.0
2.32 2.54 0.56 0.79 0.56 0.45 2.60 0.00
M2 224.6 214.7 207.0 209.6 206.4 209.1 7998) 7) 205.9
7.8 83 9.4 8.8 9.5 9.4 8.8 7.6
2.46 Wohl 0.14 0.48 0.07 0.42 Dall 0.00
M3 434.4 452.3 457.3 428.9 446.8 442.9 455.2 433.9
So] 13:3 Yo 11.6 23.4 16.9 15.6 13.3
0.04 1.38 1.76 — 0.38 0.97 0.68 1.60 0.00
M4 476.3 476.6 481.0 441.3 475.9 468.3 489.0 465.1
16.8 16.5 20.0 12.9 26.9 17.3 Let 16.2
0.69 0.71 0.98 — 1.47 0.67 0.20 1.48 0.00
M5 541.2 546.5 556.2 520.8 544.9 550.9 S58), 530.1
S\o7/ 16.0 25.3 es 30.5 20.2 20.3 16.6
0.67 0.99 ilo =) 0.90 1.26 1.78 0.00
M6 22s 742.6 741.2 755.4 ISVS 762.9 767.6 729.8
19.8 24.5 De ISI 34.9 35.4 DOr 21.4
— 0.34 0.60 0.53 1.19 1.29 1.54 1.76 0.00
M7 781.8 795.5 793.9 797.4 798.9 829.6 818.2 773.8
24.2 Dies 33.9 Die 43.8 43.3 31.9 26.6
0.30 0.82 0.76 0.89 0.94 2.10 1.67 0.00
M8 894.9 907.0 897.1 907.2 941.3 929°5 939.4 893.7
25.6 28.8 33.8 20.4 41.0 32.9 23.6 24.4
0.05 0.55 0.14 0.55 1.95 1.47 1.87 0.00
M9 1012.1 1004.8 991.9 1011.8 1047.1 1025.2 1054.1 987.7
30.0 34.2 40.9 23.9 49.8 34.1 30.9 ell
0.76 0.53 0.13 0.75 1.85 ele) 2.07 0.00
M10 1047.5 1069.5 1068.2 1051.8 1086.9 1078.1 1103.3 1049.3
3)3).8) 36.1 47.4 23.3 44.1 43.9 31.6 33.5
— 0.05 0.60 0.57 0.07 1.12 0.86 1.61 0.00
56 Mammal Study 24 (1999)
Table 3. Measurements for molar (i > 5 + re
2
, Mee eae Pl Kes
at pe oe ii Tes GS 7 _- s a =
ES . } = ; 3 — bd
+ 1 é
i a ‘ he. 4 =
: ‘ ; = 7 ; a Wier a, 2
- ( , 4 ; 4 ie ae ers
i, ne a Ee : ; - — ae : 7 y E
: ‘ ze {
72) - 2 bape a
\ 2 F .
y , ? 2
if ‘ F xe 2
} : Ao itn
Z jue if af
be = : . 5 ie Aron
— * x rcs ~
, Sau i iv r z z > :
pa ; = ih Ee ; x i
; ; 7 < ' D, & ,
J a iy Nadie wa - f =
5 “ fa) f ; y
x 4 tun >
! 3
. Ee vt a : ‘
a \
= Seay
j - as 2 :
Sky, i Sr a, ey: ve ‘
fa { * site , :
" A
2, ry {
> ( — i 4 =
s 5 J = % y »
, fi : {
2 ( , a7 fe
ae = ; i :
x - ;
= Hi Se y 2
a . f
= - % ! Z } iL =
2» 3 cy ~ ra / re a :
i i
i . 7 a ke
La , * x f
{ 2 7 1 F a ~ i
igs y e } o \ \ é j j
r
€ ¥ i = i ~~
Mammal Study 24: 67-78 (1999)
© the Mammalogical Society of Japan
Morphometric status of shrews of the Sorex caecutiens/shinto
eroup in Japan
Nikolai E. Dokuchaev!, Satoshi Ohdachi* and Hisashi Abe?
'Institute of Biological Problems of the North, Magadan 685000, Russia
2Institute of Low Temperature Science, Hokkaido University, Sapporo 060-0819, Japan
3Katsuraoka 26-17, Otaru 047-0264, Japan
Abstract. The morphometric relationships among five operational taxonomic units of the
Sorex caecutiens/shinto group (Soricidae) (S. caecutiens of Hokkaido, S. shinto shinto of
Honshu including the S. chouei holotype, S. s. shikokensis of Shikoku, and S.s. sadonis
of Sado) in the Japanese Islands, were examined using uni- and multivariate analyses of 15
cranial, dental, and external characters. The morphological analyses showed that the shrew
from Hokkaido (S. caecutiens) and those from Honshu, Shikoku, and Sado (S. shinto) were
exclusively differentiated. In particular, the surface structure of the fourth upper premolar
completely separated the two taxa. In contrast, S. s. sadonis from Sado could not be com-
pletely distinguished from related taxa from Honshu and Shikoku. Thus these morpho-
metric analyses re-confirm that S. caecutiens of Hokkaido, and S. shinto from Honshu,
Shikoku, and Sado, should be treated as two separate species, as has previously been pro-
posed on the basis of a molecular phylogenetical study.
Key words: Sorex caecutiens, S. shinto, sadonis, shikokensis, taxonomy.
Thomas (1905, 1906) described Sorex shinto as a new shrew species from Honshu Island.
Later, he described a new subspecies, S. shinto saevus, from Sakhalin Island and included
the island of Hokkaido in its distributional range (Thomas 1907). Thomas (1907) did not
find any morphological specific differences, however, among the shrews from Honshu,
Hokkaido, and Sakhalin Islands.
In the years since Thomas’s (1907) study, the taxonomic treatment of S. shinto and other
taxa of the Sorex caecutiens/shinto group (in the sense of Ohdachi et al. 1997a) has varied.
Bobrinskii et al. (1944) treated some medium-sized shrews from Eurasia, including S. shinto
described by Thomas (1907), as a single species, S. macropygmaeus Miller, 1901. Ellerman
and Morrison-Scott (1951) accepted Bobrinskii et al’s (1944) systematic concept, but they
synonymized S$. macropygmaeus with S. caecutiens Laxmann, 1788. Stroganov (1957), who
investigated the shrews from Sakhalin, Hokkaido, and the southern Kurile Islands in great
details, concluded that the shrews in Hokkaido and Sakhalin, described as S. shinto saevus
by Thomas (1907), should be included in S. caecutiens, as Ellerman and Morrison-Scott
(1951) did. However, without inspecting Sorex samples from Honshu, Stroganov (1957)
To whom correspondence should be addressed. E-mail: ohd@pop.lowtem.hokudai.ac.jp
68 Mammal Study 24 (1999)
considered that the shrews of Honshu were a subspecies of S. caecutiens, S. c. shinto.
Since Stroganov’s (1957) investigation, there have been two main opinions concerning
the taxonomic status of shinto in the caecutiens/shinto group. On the one hand, some
authors have objected to the specific rank of shinto, and have followed Stroganov (1957) in
including it in S. caecutiens (e.g. Bobrinskii et al. 1965; Abe 1967, 1994; Gureev 1971, 1979;
Yudin 1971, 1989; Corbet 1978; Gromov and Baranova 1981; Krivosheev 1984; Dolgov 1985;
Okhotina 1993; Dobson 1994). Furthermore, with regard to the subspecific status of the
caecutiens/shinto shrews of the Japanese Islands and vicinity, Abe (1967, 1994) treated the
population of Honshu as S. caecutiens shinto, that of Shikoku as S. c. shikokensis, and that
of Hokkaido and Sakhalin as S. c. saevus. On the other hand, some authors have been of
the taxonomic opinion that S. shinto should be considered as an independent species that
occurs in Honshu, Shikoku, and Hokkaido (and Sakhalin, according to some authors) while
S. caecutiens across the Eurasian Continent (and in Sakhalin according to some authors),
essentially following Thomas’s (1907) position (e.g. Imaizumi 1949, 1960; Sokolov 1973;
Yoshiyuki and Imaizumi 1986; Pavlinov and Rossolimo 1987; Hutterer 1993; Pavlinov et al.
1995; Wolsan and Hutterer 1998). In addition, Imaizumi (1954) described S. chouei from
Honshu as a new species, although this was later synonymized with S. caecutiens (Abe 1967,
1994, 1996) or S. shinto (Imaizumi 1970; Hutterer 1993).
There has been the additional controversy in Japan concerning the taxonomic status of
the Sado shrew as part of the caecutiens/shinto group. This taxon was first described by
Yoshiyuki and Imaizumi (1986) from Sado Island. While some authors treat it as an in-
dependent species, S. sadonis Yoshiyuki et Imaizumi, 1986 (e.g. Abe 1994, 1996; Wolsan and
Hutterer 1998), others suggest that it should be considered a subspecies of S. shinto, S.s.
sadonis (Ohdachi et al. 1997a; Koyasu 1998).
Ohdachi et al. (1997a) recently used the DNA sequences of the mitochondrial cyto-
chrome b gene to reveal the phylogenetical relationships among northeastern Asiatic
soricine shrews. Their work indicated that all of the shrews from Honshu, Shikoku, and
Sado should be considered as belonging to a single species, S. shinto, whereas those from
Hokkaido and Sakhalin, belonged to the widespread Eurasian continental species, S.
caecutiens. This taxonomic scheme has subsequently been followed by Koyasu (1998). No
investigations have been made, however, of the morphological relationships among the local
populations (or subspecies) of S. caecutiens and S. shinto.
Our goal was to reveal the morphological status of the Sorex caecutiens/shinto group in
the Japanese Islands (Hokkaido, Honshu, Shikoku, and Sado). As a result of this research,
we are able to offer a morphological diagnosis making it possible to distinguish S. shinto
from S. caecutiens (in the sense of Ohdachi et al. 1997a and Koyasu 1998).
Materials and methods
We have followed the taxonomic approach of Ohdachi et al. (1997a) and Koyasu (1998)
for the caecutiens/shinto group, and call the shrews of Hokkaido S. caecutiens, those
of Honshu (including S. chouei Imaizumi, 1954) S. shinto shinto, those from Sado S. s.
sadonis, and those from Shikoku S. s. shikokensis. These five operational taxonomic units
(OTUs) were used for the present investigation. As to geographical terms, we refer the
total area of Honshu, Shikoku, and Sado Islands to the “Honshu complex”.
Dokuchaey et al., Morphometric status of the Sorex caecutiens/shinto group 69
Specimens of the Sorex caecutiens/shinto group at the National Science Museum
(Tokyo), the Natural History Museum, Faculty of Agriculture (K. Maekawa and H. Abe
collections), and the Institute of Low Temperature Science (S. Ohdachi collection),
Hokkaido University (Sapporo), were examined to provide the basic data for this study.
Undamaged skulls of 40 S. caecutiens from Hokkaido, 45 S. shinto from Honshu (including
the holotype of S. chouei Imaizumi, 1954, specimen code NSMT-M12513), one S.s.
shikokensis from Shikoku (the holotype of S. caecutiens shikokensis Abe, 1967, NHMHU-
13311), and six S. s. sadonis from Sado (including the holotype of S. sadonis Yoshiyuki et
Imaizumi, 1986, NSMT-M16180) were used for the cranial and dental analyses, and 240
specimens of S. caecutiens from Hokkaido and 25 S. shinto from Honshu were used for the
analysis of external characters. Specimen codes and locations are listed in the Appendix.
Only young-of-the-year (=sexually immature) specimens were used for the cranial and
external measurements, with the exception of the three holotype specimens, all of which
had over-wintered (=sexually matured). The reason for choosing primarily immature
shrews was that the skulls of the over-wintered shrews tend to be slightly smaller (Ognev
1933; Stroganov 1957; Abe 1967), their teeth may be worn, whereas their external characters,
such as body length and body weight, tend to be much greater. The three holotypes were
used only for the cranial analyses. Samples from both sexes were pooled for analysis,
since there is no significant difference in skull size between males and females of the
caecutiens/shinto group (Abe 1967).
Nine cranial and dental characters were measured. Definitions for these characters are
as follows. 1) Condylobasal length: the length from the anterior medial point of the pre-
maxillary bone to the posteriormost point on the occipital condyle. 2) Facial length: the
length from the anterior medial point of the premaxillary bone to the posteriormost point of
the foramen on the frontal bone. 3) Breadth of the braincase: the maximum width of the
braincase. 4) Glenoid width: the maximum width between the right and left mandibular
fossae. Definitions for (3) and (4) are illustrated in Dannelid (1994). 5) Width across the
second upper unicuspids: the width between the outer margins of the right and left second
upper unicuspids (U*) viewed from the crown side. 6) Width across the second upper
molars: the width between the outer margins of the right and left second upper molars
(M7?) viewed from the crown. 7) Length of the upper molariform tooth row: the length from
the anterior point of the fourth upper premolar (i.e. the superficial “third” premolar) to the
posterior point of the third molar, viewed from the crown. 8) Length of upper unicuspid
row: the length from the anterior point of the first unicuspid to the posterior point of the
fifth unicuspid, viewed laterally. 9) Relative basal width of the mesostyle of the fourth
upper premolar: length from the anterior point of the fourth upper premolar (Pm‘*) to
the posterior point of the mesostyle (“a—-b” distance in Fig. 1) relative to Pm‘ length (“a-c”
distance), expressed in percentage (“a-b”/“a-c” x 100). Here, we have followed Stroganov’s
(1957) and Dolgov’s (1985) terminology for tooth anatomy.
Skull and tooth characters were measured using an ocular micrometer under a binocular
microscope, with the exception of the condylobasal length, which was measured using
callipers. Most characters were measured to the nearest 0.01 mm, however condylobasal
length was measured to the nearest 0.1mm. The relative width of Pm* mesostyle was
measured, using digitally-saved images from a photo-capturing system: OLYMPUS micro-
scope (SZH10), OLYMPUS-Ikegami CCD camera (ICD-740), and a Macintosh computer
70 Mammal Study 24 (1999)
distal medial
= —
Fig. 1. Buccal view of the fourth right upper premolar of (A) Sorex shinto from Honshu (specimen code, SO-
96misc15) and (B) S. caecutiens from Hokkaido (SO-88n105). Pm‘, fourth upper premolar; M!, first upper molar;
US, fifth unicuspid.
(Performa 5430).
Six external characters, body weight, total body length, tail length, hind-foot length, tail
ratio, and hind-foot ratio, were used in the analyses. Measurements of the external charac-
ters were obtained from the original specimen labels, once doubtful data has been carefully
eliminated. Data from both sexes were combined, since there are no sexual differences in the
external characters of young shrews in the caecutiens/shinto group (Abe 1967). For our
purposes, the tail ratio was calculated as the percentage tail length to head and body length,
and the hind-foot ratio was the percentage to tail length.
Multivariate factor, cluster, and discriminant analyses were carried out, using the nine
cranial characters. For cluster analysis, the nearest neighbor method using Euclidean
distance was applied. Differences in means of cranial and external characters between S.
caecutiens in Hokkaido and S. shinto in Honshu were tested using Student’s ¢-test for most
characters and Mann-Whitney’s U-test for ratios (relative width of Pm* mesostyle, relative
tail length, and relative hind foot length).
Results
The cranial characters of the shrews from Hokkaido (S. caecutiens) were found to be
significantly larger than in those of the shrews from Honshu (S.s. shinto) (Table 1).
Remarkable differences between these two taxa were found in the relative basal width of
Dokuchaey et al., Morphometric status of the Sorex caecutiens/shinto group 71
Table 1. Means+1SE, ranges (in parentheses), and the results of t- and U-tests of cranial characters in Sorex
caecutiens from Hokkaido Island and S. s. shinto from Honshu Island. All the specimens were the young animals.
U-test was conducted for relative basal width of Pm* mesostyle, and f-tests for the other characters.
S. caecutiens S. s. shinto t or U-test
Cranial and dental characters in Hokkaido in Honshu
(n=40) (n= 44)
is Oe (U/ IP
Condylobasal length (mm) 18.0+0.05 17.4+0.06 Well <0.001
(17.0-18.5) (16.5—18.1)
Facial length (mm) 9.02+0.033 8.70+0.051 5.10 <0.001
(8.55—9.55) (8.12—9.35)
Breadth of braincase (mm) 9.17+0.031 8.73 + 0.034 9.30 <0.001
(8.80—9.60) (8.32—9.30)
Glenoid width (mm) 5.04+0.021 4.78 +0.022 8.38 <0.001
(4.70—5.30) (4.55—5.15)
Width across U? (mm) 1.81+0.009 17382-0012 5.56 <0.001
(1.70-1.95) (1.50-1.90)
Width across M? (mm) 4.23+0.016 4.11+0.020 4.73 <0.001
(4.05—4.50) (3.85—4.40)
Length of upper molariform 4.35+0.014 4.20+0.017 6.68 <0.001
tooth row (mm) (4.20—4.60) (3.95—4.42)
Length of upper unicuspid row 2A ==0:001 2.49+0.012 15.30 <0.001
(mm) (2.55—2.85) (2.34-2.65)
Relative basal width of Pm* 61.2+0.20 54.9+0.20 DAI2AO <0.001
mesostyle (%) (59.3-65.2) (52.1—57.2)
Pm‘ mesostyle and the length of the unicuspid row (Table 1). While almost all craniometric
characters overlapped between the two taxa, no overlap was found in observed values of the
relative width of the Pm* mesostyle (Table 1). The shrews from Hokkaido were heavier, and
had longer hind feet than the shrews from Honshu, but they did not differ in their total body
length (Table 2).
The shrews of Hokkaido could not be distinguished from the shrews of the Honshu
complex (S. shinto sspp.) on the basis of the first rotated factor of the factor analysis of the
craniometrical characters (Fig. 2), and the average first factor value of Hokkaido shrews was
intermediate between those of the shrews from Honshu, and the shrews from Sado and
Shikoku (S. s. sadonis and S. s. shikokensis) (Fig. 2). The second rotated factor, however,
clearly distinguished between the shrews of Hokkaido and of the Honshu complex (Fig 2).
The second rotated factor was greatly contributed to by the relative width of the Pm*
mesostyle, as well as the length of upper unicuspid row (Table 3).
Cluster analysis showed that the Hokkaido shrews are distant from the shrews of the
Honshu complex, which occur in a closely related single cluster (Fig. 3). Within the cluster
for the Honshu complex, the shrews from Sado and Shikoku formed a secondary cluster.
According to discriminant analysis, five out of the nine characters were significant
enough to be able to distinguish between the shrews of Hokkaido and of the Honshu com-
plex. The discriminant function between the two shrew groups was as follows:
72 Mammal Study 24 (1999)
Table 2. Means+1SE, ranges (in parentheses), and the results of ¢- and U-tests of external characters in Sorex
caecutiens from Hokkaido Island and S. s. shinto from Honshu Island. These specimens were all of young animals.
U-tests were conducted for the two characters of ratio, and f-tests for the other characters.
S. caecutiens S. s. shinto t or U-test
External characters in Hokkaido in Honshu
(n=240) (n=25)
tor U P
Weight (gram) 5.0+0.03 4.4+0.11 S255 <0.001
(4.0-6.7) (3.5—5.9)
Total body length (mm) 113.8+0.25 112.6+0.91 1.36 ns*
(98-126) (108-125)
Length of tail (mm) 48.2+0.22 5037 220555 B52 <0.01
(40.0—58.0) (46.0—S6.5)
Length of hind foot (mm) 12.4+0.03 12.0+0.08 4.84 <0.001
(11.1-13.5) (11.2-12.9)
Tail ratio to head & body length 73.80.44 82.44 1.84 1392.0 <0.001
(%) (60.0—103.6) (66.2—98.2)
Hind-foot ratio to tail length 2n8== 0 oie 23.7+0.30 1065.5 <0.001
(%) (21.5—30.5) (21.7—26.4)
P0105:
Rotated Factor 2
|
5
|
|
1
|
|
|
|
|
|
|
|
|
_
2.6 1.6 -0.6 0.4 1.4 2.4 3.4
Rotated Factor 1
= S. s. shintoin Honshu ¥» S. s. shinto (S. chouei type)
AS. s. sadonisin Sado © S. s. shikokensis in Shikoku
@ S. caecutiens in Hokkaido
Fig. 2. Plot of the first two factor scores for nine cranial and dental characters of shrews of the Sorex
caecutiens/shinto group on the Japanese Islands. Three symbols with asterisks (*) are the holotypes for S. chouel,
S. c. shikokensis, and S. sadonis, which are treated as S. s. shinto, S. s. shikokensis, and S. s. sadonis in the present
study, respectively.
Dokuchaey et al., Morphometric status of the Sorex caecutiens/shinto group W5
Table 3. Varimax rotated factor matrix for nine cranial and dental characters of the Sorex
caecutiens/shinto group in Japan. See the caption of Fig. 1 for abbreviation.
Rotated loadings
Character
I II
Width across M? 0.931 0.089
Width across U? 0.861 0.154
Length of upper molariform tooth row 0.833 0.356
Condylobasal length 0.686 0.573
Facial length 0.667 0.507
Glenoid width 0.665 0.473
Cranial breadth 0.587 0.678
Relative width of Pm* mesostyle 0.063 0.922
Length of upper unicuspid row 0.333 0.899
Percent of total variance explained 45.8% 34.3%
S.caecutiens
(Hokkaido)
S.s.shinto
(Honshu)
S.s.sadonis
(Sado)
S.s.shikokensis
(Shikoku)
0.00 5.00
[Nas eg ek re i a a |
Fig. 3. A dendrogram generated by cluster analysis of nine cranial and dental characters of shrews of the Sorex
caecutiens/shinto group on the Japanese Islands, based on single linkage method. The distance is multivariate
Euclidean distance of the nine characters.
Z=—47.6—1.1(FL)+8.9(LUU) + 4.9(02U?) — 2.4(M?M?) + 0.6(RMW),
where FL=facial length, LUU=length of upper unicuspid row, U?U*=width across the
second upper unicuspids, M?M?*=width across the second upper molars, RMW=relative
mesostyle width of Pm*. The group centroids are +3.36 for the shrews of Hokkaido, and
—2.58 for those of the Honshu complex. All the specimens were correctly classified into the
two groups (probability of misclassification=0.0%).
Discussion
The morphometric analyses clearly showed that the shrews of Hokkaido (S. caecutiens)
is morphologically different from the shrews of Honshu complex (S. shinto sspp.) (Figs. 2
and 3). The most important difference is in the shape of the upper premolar (Fig. 1 and
Table 3). Dokuchaev (1978) found that S. caecutiens retains a well developed mesostyle of
74 Mammal Study 24 (1999)
Pm‘, which is a notable difference between it and several other shrew species. This feature is
consistent in S. caecutiens throughout its trans-continental Eurasian range. In the present
study, we found the same morphotype of the Pm* mesostyle in all of the Hokkaido shrews
we examined (Fig. 1-B), while the mesostyle of Pm* of the shrews from the Honshu complex
was less developed (Fig. 1-A). For instance, the relative width of Pm* in Honshu shrews
never reaches values found in Hokkaido shrews (Table 1).
George (1988) treated S. shinto from Honshu as a separate species from S. caecutiens,
based on allozyme analysis. Ohdachi et al. (1997a) showed that the shrews of Honshu and
Shikoku were clearly distinct from those of Hokkaido, Sakhalin, and the Eurasian Conti-
nent, based on mitochondrial DNA sequences (see also Fumagalli et al. 1999). According to
their phylogenetical relationships (George 1988; Ohdachi et al. 1997a; Fumagalli et al. 1999)
and their morphological differences (Figs. 2 and 3), S. caecutiens and S. shinto should be
treated as two separate species.
In contrast, among the four OTUs from the Honshu complex (S. s. shinto including S.
chouei holotype, S. s. shikokensis, and S. s. sadonis), no clear morphological demarcations
were found, although only a small number of specimens were examined for the last three
units (Fig. 2). Sorex chouei was described on the basis of one specimen of an old individual
with very worn teeth (Imaizumi 1954), and its holotype lay in an extreme point within the
variation of S. shinto (Fig. 2), which might be attributed to by the very worn condition of its
teeth. Sorex s. shikokensis is a larger relative of S. s. shinto in Honshu (Abe 1967), however
the genetic distance between them is very small (Ohdachi et al. 1997a). The specimen of
S. s. shikokensis dropped within the range of S. s. sadonis (Fig. 2) and was morphologically
similar to the latter (Fig. 3). In addition, we examined more than ten S. s. shikokensis that
had over-wintered and confirmed that they were morphologically similar to S. s. sadonis (this
data was not used in the present analyses in order to minimize the potential influence of age).
The molecular phylogenetical study suggested that the Sado Shrew, S. s. sadonis, should
be considered as a subspecies or local population of S. shinto (Ohdachi et al. 1997a).
Cranial and dental morphology confirmed that the Sado shrew was similar to the other taxa
in the S. shinto complex (Fig. 3), and that there was morphological overlap between them
(Fig. 2), although the Sado Shrews do have larger skulls than those of Honshu (as does S. s.
shikokensis), longer claws on the forelegs, and darker pelage (Yoshiyuki and Imaizumi 1986).
According to Ohshima (1990, 1991, 1992), Sado Island was separated from proto-
Honshu in the middle Pleistocene, long before the formation of the Tsugaru Strait, that
separates Honshu and Hokkaido, which is estimated to have been formed 100-150 10%-years
ago. In contrast, Ohdachi et al. (1997b) have doubted the earlier formation of the Sado
Strait than the Tsugaru Strait, because of the molecular phylogeny of the caecutiens/shinto
group. Likewise, a more recent date for the isolation of Sado Island has been suggested by
Tokuda (1941, 1969) on the basis of an examination of the distribution and morphological
variation among rodents. The Sado shrew might, therefore, have separated from the
Honshu population of S. shinto recently (after 150 10°-years ago at the most). Further-
more, other small mammals, such as Apodemus argenteus (Temminck, 1844), A. speciosus
(Temminck, 1844), and Mogera tokudae Kuroda, 1940 (the Sado mole) are found on
both Sado and Honshu Islands (Abe 1994, 1995, 1997). Fossil A. argenteus have been
found from earlier periods in the Pleistocene than the genus Sorex from Honshu Island,
and the earliest fossils of A. speciosus and Mogera sp. were from the same period as Sorex
Dokuchaevy et al., Morphometric status of the Sorex caecutiens/shinto group 75
sp. (Kawamura et al. 1989). In the case of M. tokudae, morphological and molecular
phylogenetical characteristics of the populations of Sado and Honshu reveal that they are
closely related to one other (Abe 1995; Okamoto 1998), as is the case in the shrews of the
caecutiens/shinto group. At least, the extant Apodemus spp. and M. tokudae of Sado,
whose origins seem to be older than or contemporaneous with Sorex, are considered con-
specific with their Honshu counterpart populations. Therefore, the subspecific rank of S.
shinto sadonis is considered to be the more appropriate taxonomic status for the Sado shrew,
than S. sadonis, as suggested by Ohdachi et al. (1997a) and Koyasu (1998). In order to
determine morphological status of S.s. sadonis within S. shinto more clearly, however,
morphological comparisons, such as those of fur colour and claw length, should be con-
ducted using larger sample sizes.
To summarize, morphological analysis has clearly demonstrated that S. caecutiens and
S. shinto should be treated as separate species, as has previously been proposed by Ohdachi
et al. (1997a) on the basis of their molecular phylogenetical study. Furthermore, morpho-
logical research also suggests that the shrew of Sado Island should be included within S.
shinto.
Acknowledgements: We are grateful to Hideki Endo at the National Science Museum,
Tokyo, and Hideo Ichikawa at the Natural History Museum of the Faculty of Agriculture,
Hokkaido University, for supporting investigations of samples. We also thank to Alexey N.
Dokuchaev for his assisting in writing the manuscript, Masanori J. Toda for reviewing the
early manuscript, and Mark Brazil for his help in preparing the final manuscript for publi-
cation. Part of this study was conducted during the stay of N. E. Dokuchaev at the Institute
of Low Temperature Science, Hokkaido University as a visiting professor.
References
Abe, H. 1967. Classification and biology of Japanese Insectivora (Mammalia). I. Studies on variation and
classification. Journal of the Faculty of Agriculture, Hokkaido University 55: 191-265.
Abe, H. (edition). 1994. A Pictorial Guide to the Mammals in Japan. Tokai University Press, Tokyo, 195 pp. (in
Japanese).
Abe, H. 1995. Revision of the Asian moles of genus Mogera. Journal of the Mammalogical Society of Japan 20:
51-68.
Abe, H. 1996. A review of specific names of Japanese insectivores. Honyurui Kagaku (Mammalian Science) 36:
97-108 (in Japanese).
Abe, H. 1997. Insectivora. In (Mammalogical Society of Japan, ed.) The Red Data. Japanese Mammals. Pp. 9-30.
Bun-Ichi Syuppan, Tokyo (in Japanese).
Bobrinskii, N. A., Kuznetsov, B. A. and Kuzjakin, A. P. 1944. Key to the Mammals of the USSR. Sovetskaja
Nauka, Moscow, 440 pp. (in Russian).
Bobrinskii, N. A., Kuznetsov, B. A. and Kuzjakin, A. P. 1965. Key to the Mammals of the USSR. 2nd Edition.
Prosveshchenie, Moscow, 383 pp. (in Russian).
Corbet, G. B. 1978. The Mammals of the Palaearctic Region: Taxonomic Review. British Museum and Cornell
University Press, London, 314 pp.
Dannelid, E. 1994. Comparison of pigment and other dental characters of Eastern Palearctic Sorex (Mammalia:
Soricidae). In (J. F. Merritt, G. L. Kirkland, Jr. and R. K. Rose, eds.) Advances in the Biology of Shrews
(Carnegie Museum of Natural History Special Publication 18). Pp. 217-231. Carnegie Museum of Natural
History, Pittsburgh.
Dobson, M. 1994. Patterns of distribution in Japanese land mammals. Mammal Review 24: 91-111.
16 Mammal Study 24 (1999)
Dokuchaev, N.E. 1978. On diagnostics of morphologically similar species of shrews (Sorex, Insectivora) from
North-East Siberia. Zoologicheski Zhurnal 57: 1746-1748. (Gin Russian).
Dolgov, V. A. 1985. Shrews of the Old World. Moscow State University Press, Moscow, 221 pp. (in Russian).
Ellerman, J. R. and Morrison-Scott, T.C.S. 1951. Checklist of Palaearctic and Indian Mammals 1758 to 1946.
British Museum of Natural History, London, 810 pp.
Fumagalli, L., Taberlet, P., Stewart, D. T., Gielly, L., Hausser, J. and Vogel, P. 1999. Molecular phylogeny and
evolution of Sorex shrews (Soricidae: Insectivora) inferred from mitochondrial DNA sequence data. Molecular
Phylogenetics and Evolution 11: 222-235.
George, S. B. 1988. Systematics, historical biogeography, and evolution of the genus Sorex. Journal of Mam-
malogy 69: 443-461.
Gromoy, I. M. and Baranova, G. I. (edition). 1981. Mammals of the USSR (Pliocene-Recent). Nauka, Leningrad,
456 pp. (in Russian).
Gureev, A. A. 1971. Shrews (Soricidae) of the World. Nauka, Leningrad, 256 pp. (in Russian).
Gureev, A. A. 1979. The Fauna of the USSR. Mammalia. Vol. 4 (2). Nauka, Leningrad, 502 pp. (in Russian).
Hutterer, R. 1993. Order Insectivora. In (D. E. Wilson and D. M. Reeder, eds.) Mammal Species of the World. A
Taxonomic and Geographic Reference. 2nd Edition. Pp. 69-130. Smithsonian Institution Press, Washington.
Imaizumi, Y. 1949. An Illustrated Book of the Mammals of Japan. Systematics and Ecology. Yoyo Shobo, Tokyo,
348 pp. (in Japanese).
Imaizumi, Y. 1954. New species and subspecies of Sorex from Japan (Mammalia; Insectivora). Bulletin of the
National Science Museum, Tokyo 1: 94-104.
Imaizumi, Y. 1960. Coloured Illustrations of the Mammals of Japan. Hoikusha Publishing Co., Osaka, 196 pp. (in
Japanese).
Imaizumi, Y. 1970. The Handbook of Japanese Land Mammals, Volume 1. Shin-Shicho-Sha, Tokyo, 350 pp. (in
Japanese with English abstract).
Kawamura, Y., Kamei, T. and Taruno, H. 1989. Middle and late Pleistocene mammalian faunas in Japan.
Daiyonki Kenkyu (The Quaternary Research) 28: 317—326 (in Japanese with English abstract).
Koyasu, K. 1998. Natural history of Japanese Soricinae. In (H. Abe and Y. Yokohata, eds.) The Natural History
of Insectivora (Mammalia) in Japan. Pp. 201-267, Hiba Kagakukyouiku Shinkou Kai, Syoubara-shi (in
Japanese).
Krivosheev, V. G. (edition). 1984. Terrestrial Mammals in the Far East of the USSR. Nauka, Moscow, 358 pp. (in
Russian).
Ognev, S. I. 1933. Data on systematic, morphology, and geography in the common shrews. Zoologicheski Zhurnal
12: 8-16 (in Russian).
Ohdachi, S., Masuda, R., Abe, H., Adachi, J., Dokuchaev, N. E., Haukisalmi, V. and Yoshida, M.C. 1997a.
Phylogeny of Eurasian soricine shrews (Insectivora, Mammalia) inferred from the mitochondrial cytochrome b
gene sequences. Zoological Science 14: 527-532.
Ohdachi, S., Masuda, R., Abe, H. and Dokuchaev, N. E. 1997b. Biogeographical history of northeastern Asiatic
soricine shrews (Insectivora, Mammalia). Researches on Population Ecology 39: 157-162.
Ohshima, K. 1990. The history of straits around the Japanese Islands in the late-Quaternary. Daiyonki Kenkyu
(The Quaternary Research) 29: 193-208 (in Japanese with English abstract).
Ohshima, K. 1991. The late-Quaternary sea-level change of the Japanese Islands. Chigaku Zasshi (Journal of
Geography) 100: 967-975 (in Japanese with English abstract).
Ohshima, K. 1992. Sealevel and coastal morphology through the late Quaternary glacial maximum. Chishitsu News
459: 40-48 (in Japanese).
Okamoto, M. 1998. How many species of moles in Japan? Phylogenetical relationships of Japanese moles, inferred
from mitochondrial DNA sequences. In (H. Abe and Y. Yokohata, eds.) The Natural History of Insectivora
(Mammalia) in Japan. Pp. 59-61, Hiba Kagakukyouiku Shinkou Kai, Syoubara-shi (in Japanese).
Okhotina, M. V. 1993. Subspecies taxonomy revision of Far East shrews (Insectivora, Sorex) with the description
of new subspecies. Questions of Systematics, Faunistics and Palaeontology of Small Mammals. Proceeding of
the Zoological Institute, St. Petersburg 243: 58-70 (in Russian with English abstract).
Pavlinov, I. Ja. and Rossolimo, O. L. 1987. The Systematics of the Mammals of USSR. Archives of Zoological
Museum, Moscow State University, Volume 25. Moscow State University, Moscow, 285 pp. (in Russian).
Pavlinov, I. Ja., Borisenko, A. V., Kruskop, S. V. and Yakhontov, E. L. 1995. The Mammals of Eurasia. II.
Dokuchaey et al., Morphometric status of the Sorex caecutiens/shinto group 77
Non-Rodentia. Archives of Zoological Museum Moscow State University, Volume 28. Moscow State University,
Moscow, 336 pp. (in Russian).
Sokolov, V. E. 1973. The Systematics of the Mammals. Vysshaja Shkola, Moscow, 432 pp. (in Russian).
Stroganov, S. U. 1957. Mammals of Siberia. Insectivora. Academy of Sciences of the USSR, Moscow, 267 pp. (in
Russian).
Thomas, O. 1905. Abstract of Proceedings of Zoological Society of London 1905 (23): 18-19. (Cited in Thomas
1906).
Thomas, O. 1906. The Duke of Bedford’s Zoological exploration in Eastern Asia. I. List of mammals obtained by
Mr. M. P. Anderson in Japan. Proceedings of the Zoological Society of London 1905 (2): 331-363.
Thomas, O. 1907. The Duke of Bedford’s Zoological exploration in Eastern Asia. IV. List of mammals from the
Islands of Saghalien and Hokkaido. Proceedings of the Zoological Society of London 1907 (1): 404-414.
Tokuda, M. 1941. Biogeography in Japan. Geological History of the Japanese Islands and Biogeographical History
of Japanese Fauna and Flora, Inferred from Evolutionary Studies of Eastern Asiatic Rodents. Kokon Syoin,
Tokyo, 201 pp. (in Japanese).
Tokuda, M. 1969. Biogeography. Tsukiji Syokan, Tokyo, 199 pp. (in Japanese).
Wolsan, M. and Hutterer, R. 1998.
A list of living species of shrews. In (J. M. Wojcik and M. Wolsan, eds.)
Evolution of Shrews. Pp. 423-448, Mammal Research Institute, Polish Academy of Sciences, Bialowieza.
Yoshiyuki, M. and Imaizumi, Y. 1986. A new species of Sorex (Insectivora, Soricidae) from Sado Island, Japan.
Bulletin of the National Science Museum, Tokyo, Series A 12: 185-193.
Yudin, B.S. 1971. Insectivorous Mammals of Siberia (Key), Nauka, Novosibirsk, 172 pp. (in Russian).
Yudin, B.S. 1989. Insectivorous Mammals of Siberia. Nauka, Novosibirsk, 360 pp. (in Russian).
Appendix.
Codes of specimens used for analyses. Deposit places
are National Science Museum (NSMT), Natural History
Museum, Hokkaido University (NHMHU, HA, KM),
and Institute of Low Temperature Science, Hokkaido
University (SO).
Cranial Measures
S. caecutiens in Hokkaido
HA-1037, HA-1044, HA-1064, HA-1084, HA-1108,
HA-1151, HA-1178, HA-1181, HA-1187, HA-1199,
SO-88n105, SO-88n141, SO-88n169, SO-88n197, SO-
88n203, SO-88n207, SO-88n248, SO-88n263, SO-
88n264, SO-88n265, SO-88n285, SO-88n329, SO-
88n336, SO-88n370, SO-88n377, SO-88n378, SO-
89nn38, SO-96misc-5, SO-96misc-25, SO-96misc-26,
SO-96misc-27, SO-96misc-28, SO-96misc-29, SO-
96misc-30, SO-96misc-31, SO-96misc-32, SO-96misc-33,
SO-96misc-34, SO-97/8/16-10, SO-97/9/1-1
S. s. shinto in Honshu
HA-1215, HA-6137, NSMT-M12479, NSMT-M12513
(holotype of S. chouei Imaizumi, 1954), NSMT-
M13366, NSMT-M13397, NSMT-M13398, NSMT-
M15593, NSMT-M15594, NSMT-M15595, NSMT-
Received 2 June 1999. Accepted 23 August 1999.
M15598, NSMT-M15599, NSMT-M15611, NSMT-
M15613, NSMT-M16082, SO-95misc-2, SO-96misc-9,
SO-96misc-10, SO-96misc-11, SO-96misc-13, SO-
96misc-14, SO-96misc-15, SO-96misc-16, SO-96misc-17,
SO-96misc-18, SO-96misc-19, SO-96misc-20, SO-
96misc-21, SO-96misc-22, SO-96misc-57, SO-97/8/2-1,
SO-97/8/5-1, SO-97/8/6-2, SO-97/8/6-3, SO-97/8/6-4,
SO-97/8/6-5, SO-97misc-17, SO-97misc-18, SO-97misc-
19, SO-97misc-37, SO-97misc-39, SO-97misc-40, SO-
97misc-42, SO-97misc-134, SO-98misc-1
S. s. sadonis in Sado
NSMT-M16180 (holotype of S. sadonis Yoshiyuki et
Imaizumi, 1986), NSMT-M26593, NSMT-M26600,
NSMT-M26601, NSMT-M26602, NSMT-M27286
S. s. shikokensis in Shikoku
NHMHU-13311 (holotype of S. caecutiens shikokensis
Abe, 1967)
External Measures
S. caecutiens in Hokkaido
KM-kil12, KM-ko103, KM-kol04, KM-kol21, KM-
ko122, KM-ko50, KM-ko51, KM-ko52, KM-ko70, KM-
78
ko72, KM-ko74, KM-ko83, KM-ko92, KM-ko093, KM-
ko94, KM-sh9, KM-toml, KM-tom3, KM-tom4, KM-
tomS, KM-tom7, KM-tom8, KM-tom9, KM-tom19,
KM-tom20, KM-tom21, KM-tom22, KM-tom27, KM-
tom28, KM-tom29, KM-tom30, KM-tom31, KM-tom32,
KM-tom8-53, KM-tom8-54, KM-tom8-57, KM-tom8-58,
KM-tom8-67, KM-tom8-68, KM-tom8-69, KM-tom8-70,
KM-tom8-71, KM-tom8-72, KM-tom8-73, KM-tom8’-74,
KM-tom8-75, KM-tom8-76, KM-tom8-77, KM-tom8’-78,
KM-tom8-79, KM-tom8-82, KM-tom8-92, KM-tom8-93,
KM-tom8-94, KM-tom8-95, KM-tom8-128, KM-tom8-
130, KM-tom8-131, KM-tom8-132, KM-tom8-132/2,
KM-tom8-133, KM-tom8-136, KM-tom8-139, KM-
tom8-140, KM-tom8-143, KM-tom8-144, KM-tom8-145,
KM-tom8-150, KM-tom8-151, KM-tom8-152, KM-
tom8-153, KM-tom8-154, KM-tom8-156, KM-tom8-157,
KM-tom8-163, KM-tom8-164, KM-tom8-165, KM-
tom8-167, KM-tom8-168, KM-tom8-169, KM-tom8-171,
KM-tom8-172, KM-tom8-176, KM-tom8-177, KM-
tom8-178, KM-tom8-180, KM-tom8-181, KM-tom8-183,
KM-tom9-31, KM-tom9-32, KM-tom9-34, KM-tom9-35,
KM-tom9-36, KM-tom9-37, KM-tom9-38, KM-tom9-47,
KM-tom9-48, KM-tom9-49, KM-tom9-51, KM-tom9-52,
KM-tom9-58, KM-tom9-60, KM-tom9-71, KM-tom9-72,
KM-tom9-73, KM-tom9-74, KM-tom9-75, KM-tom9-76,
KM-tom9-77, KM-tom9-81, KM-tom9-82, KM-tom9-84,
KM-tom9-86, KM-tom9-87, KM-tom9-93, KM-tom9-96,
KM-tom9-97, KM-tom9-98, KM-tom9-130, KM-tom9-
134, KM-tom9-137, KM-tom9-139, KM-tom9-140, KM-
tom9-142, KM-tom9-144, KM-tom9-148, KM-tom9-149,
KM-tom9-150, KM-tom9-151, KM-tom9-152, KM-
tom9-153, KM-tom9-154, KM-tom9-157, KM-tom9-158,
KM-tom9-159, KM-ton66a, SO-1-4, SO-30-1, SO-30-2,
SO-31-1, SO-31-2, SO-88c025, SO-88c026, SO-88c060,
SO-88c067, SO-88c068, SO-88f053, SO-88f065, SO-
Mammal Study 24 (1999)
88f070, SO-88f096, SO-88f105, SO-88f110, SO-88f123,
SO-88f126, SO-88f128, SO-88f132, SO-88f133, SO-
88n105, SO-88n168, SO-88n169, SO-88n197, SO-
88n203, SO-88n207, SO-88n248, SO-88n263, SO-
88n264, SO-88n265, SO-88n274, SO-88n285, SO-
88n336, SO-88t002, SO-88t006, SO-88t009, SO-88t012,
SO-88t016, SO-89nn021, SO-89nn022, SO-89nn038,
SO-89nn045, SO-94/9/13-8, SO-94/9/13-9, SO-
94/9/13-10, | SO-94/9/13-11, SO-94/9/14-7, SO-
94/9/14-8, SO-94/9/14-9, SO-94/9/14-10, SO-94sc3,
SO-95/7/12-3, SO-95/7/13-4, SO-95/7/13-10, SO-
97/8/16-4, SO-97/8/16-5, SO-97/8/16-6, SO-97/8/16-7,
SO-97/8/16-8, SO-97/8/16-9, SO-97/8/16-10, SO-
97/8/16-11, SO-97/8/16-12, SO-97/8/16-13, SO-
97/8/16-14, | SO-97/8/16-15, SO-97/8/16-16, SO-
97/8/16-17, | SO-97/8/16-18, | SO-97/8/17-5, SO-
97/8/17-6, SO-97/8/17-7, SO-97/8/17-8, SO-97/8/17-9,
SO-97/8/17-10, SO-97/8/17-11, SO-97/8/17-12, SO-
97/8/17-13, SO-97/8/17-14, SO-97/8/17-15, SO-
97/8/30-2, SO-97/8/31-1, SO-97/8/31-2, SO-97/8/31-9,
SO-97/9/1-1, | SO-97/9/19-8, | SO-97/9/19-9, SO-
97/9/19-10, SO-97/9/19-11, | SO-98/6/19-6, SO-
98/6/19-7, SO-98/6/20-10, SO-98/6/20-11, SO-
98/6/20-12, SO-98/7/29-4, SO-98/7/29-5, SO-98/7/29-
6, SO-98/7/30-6, SO-98/7/30-7, SO-98/7/30-8, SO-
98/7/31-4, SO-98/7/31-5, SO-98/7/31-7
S. s. shinto in Honshu
SO-96misc-9, SO-96misc-10, SO-96misc-11, SO-96misc-
13, SO-96misc-14, SO-96misc-15, SO-96misc-16, SO-
96misc-17, SO-96misc-18, SO-96misc-19, SO-96misc-20,
SO-96misc-21, SO-96misc-22, SO-97misc-37, SO-
97misc-39, SO-97misc-40, SO-97misc-133, SO-97misc-
134, SO-97/8/2-1, SO-97/8/5-1, SO-97/8/6-1, SO-
97/8/6-2, SO-97/8/6-3, SO-97/8/6-4, SO-97/8/6-5
Mammal Study 24: 79-89 (1999)
© the Mammalogical Society of Japan
Constraints on feeding type in ruminants: a case for morphology
over phylogeny
Jiang Zhaowen! and Seiki Takatsuki?
1The Laboratory of Wildlife Biology, Graduate School of Agriculture and Life Sciences, The University
of Tokyo, Yayoi 1-1-1, Bunkyo-ku, Tokyo 113-8657, Japan
2The University Museum, The University of Tokyo, Hongo 7-3-1, Bunkyo-ku, Tokyo 113-8654, Japan
Abstract. Ruminants were categorized into three feeding types: grazers, mixed feeders and
browsers based on their food habits. We studied how phylogeny constrains the feeding
types, the morphology of digestive organs, and their relationships in Cervidae and Bovidae.
It is shown that species with different feeding types occur in the same phylogenetic group of
the family, subfamily, and tribe. This suggests that phylogeny does not always reflect feed-
ing type. Comparisons of three morphological indices of digestive organs (parotid gland
size, rumino-reticulum capacity, and rumino-reticulum contents weight) among feeding types
found that trends along the grazer-browser continuum were similar in both families. The
index values of the same feeding types were similar in the two families. These results suggest
that the morphology of digestive organs is closely related to feeding types, and that phylo-
genetic characteristics are less important. The species in the same feeding type also share
other morphological characteristics of digestive organs, irrespective of phylogeny.
Key words: digestive organs, feeding type, morphology, phylogenetic constraint, ruminants.
The evolution of ruminants reflects changes in food quality and availability associated with
changes in climate and vegetation during the Tertiary period (Romer 1966; Janis 1976).
Adaptations were apparent in food habits, feeding behavior, morphology, and physiology of
the digestive systems (Janis 1976; Hofmann 1989).
Studies on the feeding ecology of ungulates have revealed negative relationships between
body mass and food quality (Bell 1971; Jarman 1974). These authors emphasized the im-
portance of body weight for the evolution of ungulate feeding ecology. On the other hand,
based on the comparative morphophysiology of digestive systems of 65 ruminant species
(Hofmann 1968, 1989; Hofmann and Stewart 1972), Hofmann described the correspondence
of feeding types and the morphology of digestive organs. Considering the evolution of
ruminants, he concluded that changes in feeding ecology and diets were the primary adaptive
factors in ruminant evolution while body weight was secondary (Hofmann 1989).
Hofmann (1989) has categorized ruminants into three feeding types. Of approximately
150 ruminants including six domestic species, about 25% fall into “grazers” which eat fibrous
'Present address: The University Museum, The University of Tokyo, Hongo, 7-3-1, Bunkyo-ku, Tokyo 113-8654,
Japan. E-mail: jiang@um.u-tokyo.ac.jp.
80 Mammal Study 24 (1999)
foods rich in cell wall, or structural carbohydrates. For example, cattle, sheep, water
buffalo, Bubalus spp., and banteng, Bos javanicus, belong to this group.
More than 40% of ruminant species belong to “browsers”. They thrive on high quality
diets and are adapted to process forage that is rich in plant cell contents. For example, roe
deer, Capreolus capreolus, moose, Alces alces, and dik-dik, Madoqua kirki, are representa-
tive browsers.
The other 35% of ruminant species are “mixed feeders” which have intermediate
characteristics between grazers and browsers. They show short term or seasonal changes
in anatomy in response to food quality. The domestic goat, Capra hircus, and red deer,
Cervus elaphus, belong to this group.
Most ruminologists and animal ecologists gave little attention to phylogenetic relation-
ships in comparative studies of ruminant feeding ecology. However, the importance of
considering phylogeny in comparative biology has been stressed thoroughly by Harvey and
Pagel (1991). One of the most important arguments is that similar characteristics shown by
different species do not necessarily imply adaptation to a particular environment, because it is
possible that they have resulted merely from the phylogenetic history. However, if similar
correlation between feeding types and morphological characteristics of digestive organs are
observed in several independently evolving lineages, this implies that the traits have evolved
in a correlated fashion, and explanations associated with the phylogenetic history are less
likely to apply (Harvey and Pagel 1991).
The objective of this study is to clarify the importance of phylogenetic constraints on the
feeding types and the morphology of digestive organs of ruminants. We classify species of
Bovidae and Cervidae according to their feeding types. We then compare parameters of the
morphology of digestive organs among the feeding types in each family, and the same feed-
ing types between the two families.
Materials and methods
Groups examined and their feeding types
Species-level information for the three ruminant feeding types (grazers, mixed feeders,
and browsers) was collected from available literature (references in Tables 1 and 2). We
limited our search to two families, Bovidae (115 spp) and Cervidae (53 spp), because they
account for 91.3% of the true ruminants (184 spp), and quantitative information is more
available for these two families.
Taxonomic relationships of the species were used instead of phylogenetic relationships
because the phylogenetic tree for all ruminant species is not available. The standard
taxonomies of Spinage (1986) for Bovidae and Walker (1975) for Cervidae were adopted.
For the classification of feeding types according to food habits, the results of Kay et al.
(1980), Kay (1987), and Hofmann (1973, 1982, 1984) were used. Species not included in
these studies were categorized according to food habit studies, i.e., the oryx, Oryx basia
(Maloiy et al. 1982), bighorn sheep, Ovis canadensis (Belovsky 1986), Pere-David’s deer,
Elaphurus davidianus (Axmacher and Hofmann 1988), and Roosevelt elk, Cervus elaphus
roosevelti (Church and Hines 1978). Based on feeding types, the taxonomic classifications
of the ruminant species were rearranged.
Jiang and Takatsuki, Feeding type in ruminants 81
Indices of digestive organs
Quantitative data on digestive organs of ruminants with different feeding types were
collected from available literature (Tables 1 and 2). Three quantitative indices were derived:
1) ratio of parotid weight (g) to body weight (kg) (6 species of Cervidae and 14 species of
Bovidae); 2) ratio of rumino-reticulum capacity (1) to body weight (kg®”°) (6 species of
Cervidae and 30 species of Bovidae); and 3) ratio of weight of rumino-reticulum contents
to body weight (kg®-’>5) (11 species of Cervidae and 36 species of Bovidae). Indices with
inadequate sample size or otherwise unsuitable for quantitative comparison were used to
describe qualitative differences between grazers and browsers (Table 3).
Data related to feeding type was available for 50 species and subspecies of Bovidae and
15 species and subspecies of Cervidae, including domestic species. For these subspecies
and species, we could obtain data related to the three indices for 43 species and subspecies
of Bovidae and 13 species and subspecies of Cervidae. Index values are expressed as
mean = SD.
Results
Feeding types
Tables 1 and 2 show that both Bovidae and Cervidae include species belonging to
different feeding types. Different feeding types were found not only in the two families,
but also in lower taxonomic levels. In Bovidae, for example, the buffalo, Syncerus caffer,
European bison, Bison bonasus, and greater kudu, Tragelaphus strepsiceros, in the sub-
family Bovinae belonged to the grazers, mixed feeders, and browsers, respectively. Different
feeding types were also found in subfamilies Antilopinae and Caprinae, and also at tribe
levels, such as in Bovini, Antilopini, Neotragini, and Caprini. In Cervidae also, the sub-
family Cervinae and the tribe Cervini included grazers and mixed feeders, and the sub-
family Odocoilinae included both mixed feeders and browsers. There were, however, fewer
species classified as grazers in Cervidae than in Bovidae.
Morphology of digestive organs
a. Parotid gland
In Bovidae, the relative weights of parotid glands were lower in grazers than those of
mixed feeders and browsers, but no obvious difference was found between mixed feeders and
browsers (Fig. 1, Table 1). In Cervidae, data were not available for grazers. The mean
value for browsers was higher than that for mixed feeders, but variation was great (Fig. 1,
Table 2).
Index values for each feeding type were similar in Bovidae and Cervidae. Index values
showed a similar increasing tendency from grazers to browsers in both Bovidae and Cervidae
(Fig. 1).
b. Rumino-reticulum capacity
In Bovidae, the relative capacities of rumino-reticula were greater in grazers than in
mixed feeders and browsers (Fig. 1, Table 1). The mean value for mixed feeders was greater
than that for browsers, but variation was great. Although only one datum was available for
Cervidae browsers and grazers, respectively, relative capacity was larger in the grazer (Fig. 1,
82
Mammal Study 24 (1999)
Table 1. Parameters of digestive organs of species belonging to different feeding types in Bovidae.
Species
English name
Grazers
Subfamily Bovinae
Tribe Bovini
Buffalo
American bison
European ox
Zebu
Cow
Subfamily Reduncimae
Mountain reedbuck
Bohor reedbuck
Laikipia waterbuck
Waterbuck
Nile lechwe
Uganda kob
Subfamily Hippotraginae
Roan antelope
Sable antelope
Oryx
Oryx (Wild)
Oryx (Domesticated)
Subfamily Alcelaphinae
Blue wildebeest
Hartebeest
Topi
Subfamily Antilopinae
Tribe Antilopini
Black buck
Tribe Neotragini
Oribi
Subfamily Caprinae
Tribe Caprini
Ibex
European sheep
Mouflon
Mean+SD
Mixed Feeders
Subfamily Bovinae
Tribe Bovini
European bison
Tribe Tragelaphini
Eland (Wild)
Eland antelope (Pofu)
Subfamily Aepycerotinar
Impala
Body weight Parotid R-R capacity R-R contents Reference
Scientific name kg kg®.75 g/kg % I/kg®-5 % kg/kg°75 No.
Syncerus caffer WS 55 88.4 85.3 3, 4, 6
Bison bison 800.0 150.4 69.3 6, 12
Bos taurus 600.0 22 0.6 69.8 6, 13
Bos indicus 400.0 89.4 63.3 6
Bos taurus 400.0 89.4 136.7 61.5 12,
Redunca fulvorufula 235 10.7 68.4 3
Redunca redunca 45.0 17.4 55.8 20.1 35 6
Kobus ellipsiprymnus 220.0 Sol 76.9 52:5 3,05, 9
Kobus defassa 229.0 58.9 51.9 8
Kobus megaceros 80.0 26.7 6
Kobus kob 79.0 26.5 36.8 3
Hippotragus equinus 250.0 62.9 6
Hippotragus niger 200.0 e774 6
Oryx basia 174.3 48.0 48.9 8
Oryx gazella 181.5 49.5 71.8 49.1 3, 4, 6
Oryx gazella 200.0 Slo” 42.9 6
Connochaetes taurinus 182.0 49.6 80.7 57.3 3, 4, 5, 6
Alcelaphus buselaphus 156.0 44.1 70.3 38.5 3555.0
Damaliscus lunatus 119.0 36.0 86.0 44.2 37,0
Antilope cervicapra 40.9 16.2 0.7 jI3)
Ourebia ourebi 16.0 8.0 49.4 3
Capra ibex 36.0 12.8 11
Ovis aries 50.0 18.8 0.5 64.8 Sil ae 556; 13
Ovis ammon musimon 355 13.9 0.7 68.2 34.2 6 115-13
0.6+0.1 73.4+23.8 51.6+16.1
Bison bonasus 800.0 150.4 44.1 6
Taurotragus oryx 700.0 136.1 52.9 57.6 3, 6
Taurotragus oryx 519.0 108.7 57.0 51.0 Beall
Aepyceros melampus 62.6 DOS 5355 29.7 304.56
Jiang and Takatsuki, Feeding type in ruminants 83
Table 1. (continued)
Species Body weight Parotid R-R capacity R-R contents Reference
English name Scientific name kg kg?.75 g/kg % I/kg®75 % kg/kg®-75 No.
Subfamily Antilopinae
Tribe Antilopini
Grant’s gazelle Gazella granti 64.0 22.6 2.0 56.6 23.9 3h, Sp. (Os 118)
Thomson’s gazelle Gazella thomsoni Mbps 10.3 1.0 56.1 26.0 3), Oy Os 13)
Springbok Antidorcas marsupialis 42.0 16.5 1.4 28.4 23.2 4, 6, 15
Tribe Neotragini
Steinbok Raphicerus campestris 10.5 5.8 Dep 42.9 13.5 315 Dy (Oy JIS)
Subfamily Caprinae
Tribe Ovibovini
Musk ox Ovibos moschatus 350.0 80.9 6
Tribe Rupicaprini
Chamois Rupicapra rupicapra 33.5 13.9 1.8 53.1 11
Tribe Caprini
Goat Capra hircus 40.0 15.9 44.6 a, (0)
Dall’s sheep Ovis dalli 80.0 26.7 6
Bighorn sheep Ovis canadensis 72.0 24.7 18.8 12, 14
Sheep Ovis aries 30.0 12.8 44.9 6
Mean+ SD leet (05 ae Onl 928s S403 teil 359
Browsers
Subfamily Bovinae
Tribe Tragelaphini
Greater kudu Tragelaphus strepsiceros 250.0 62.9 36.9 4,6
Lesser kudu Tragelaphus imberbis 90.5 73$).3) 45.0 3
Bushbuck Tragelaphus scriptus 60.0 21.6 37.4 18.1 35 55 ©
Bongo Taurotragus eurycerus 200.0 377 6
Subfamily Cephalophinae
Red duiker Cephalophus harveyi 16.0 8.0 Dep) 62.5 29.6 3, 6
Grey duiker Sylvicapra grimmia 14.3 Va 43.5 19.2 35 Dy
Subfamily Antilopinae
Tribe Antilopini
Gerenuk Litocranius walleri 40.0 15.9 2.0 39.3 del) 35 (Op thy JIS
Tribe Neotragini
Klipspringer Oreotragus oreotragus 12.0 6.4 26.1 12.1 6
Dik-dik Madoqua spp. S72 3.4 1.6 10.2 35 diy Wy JIB)
Gunther’s dik-dik Madoqua quentheri 4.1 DS) 26.0 3
Kirk’s dik-dik Madoqua Kirki So 3.4 1.5 27.4 10.8 Il, Gy WO, 18)
Suni Nesotragus moschatus 4.5 Jol 1.6 5) 12.3 3h) Oy Oh JO, 18
Mean+ SD Lotsaes sac) Spee’)
R-R: Rumino-reticulum. Reference No. 1. Short et al. (1965), 2. Prins and Geelen (1971), 3. Hofmann (1973), 4.
Giesecke and Van Gylswyk (1975), 5. Hoppe et al. (1977), 6. Kay et al. (1980), 7. Demment (1982), 8. Maloiy et al.
(1982), 9. Clemens and Maloiy (1983), 10. Hoppe et al. (1983), 11. Hofmann (1984), 12. Belovsky (1986), 13. Kay
(1987), 14. Gordon and Illius (1988), 15. Hofmann et al. (1995).
Table 2).
Index values for each feeding type were similar in Bovidae and Cervidae.
84
Mammal Study 24 (1999)
Table 2. Parameters of digestive organs of species belonging to different feeding types in Cervidae, Tragulidae,
Camelidae and Giraffidae.
Species Body weight Parotid R-R capacity R-R contents Reference
English name Scientific name kg kg®75 g/kg % W/kg®-> 9% kg/kg®-75 No.
Cervidae
Grazers
Cervinae
Pere-David’s deer Elaphurus davidianus 190.5 Silas 14
Cervini
Sika deer Cervus nippon 61.2 21.9 56.7 48.6 10, 16
Mixed feeders
Cervinae
Cervini
Wapiti Cervus canadensis 318.0 75.3 28.1 9, 12
Wapiti (Elk) Cervus elaphus roosevelti PAPE) 67.1 8
Red deer Cervus elaphus 150.0 42.9 0.6 71.8 40.1 4, 7, 9, 13, 18
Fallow deer Dama dama 70.0 24.2 B5e2, 29.0 4,7,9
Odocoilinae
Odocoileini
Mule deer Odocoileus hemionus 120.0 36.3 28.5 22.6 2s), 9
White-tailed deer Odocoileus virginianus 66.6 23e3 32.0 25.3 I Ole:
Caribou Rangifer tarandus acticus 120.0 36.3 32.6 6, 9
Reindeer, Norwegian Rangifer tarandus tarandus 90.0 29:2 0.6 41.5 9=3,. 17
Reindeer, Svalbard Rangifer t. platyrhynchus 71.0 24.5 1.6 38.9 Osea
Mean+SD 0.90.6 41-9220 32:3 ==7—e2
Browsers
Odocoilinae
Alcini
Moose Alces alces 400.0 89.4 43.4 9
Capreolini
Roe deer Capreolus capreolus 20.7 9.7 hep) 1I5),5 159 4,7, 9, 13
Hydropotinae
Chinese water deer Hydropotes inermis 12.0 6.4 1.4 OF 13, 15
Muntiacinae
Reeves’ muntjac Muntiacus reevesi 10.4 5.8 1.4 9, 13
Mean+SD 11,7/22(0)55) 155 29.7+19.4
Other families:
Mixed feeder
Camelidae
Arabian camel Camelus dromedarius 0.5 13
Antilocapridae
Pronghorn Antilocapra americana 50.0 18.8 33.8 6, 12
Browsers
Tragulidae
Larger mousedeer Tragulus napu 4.0 2.8 9
Lesser mousedeer Tragulus javanicus eS 1.4 9
Giraffidae
Giraffe Giraffa camelopardalis 750.0 143.3 132 70.3 ll
R-R: Rumino-reticulum. References No. 1. Short (1964), 2. Short et al. (1965), 3. Hakonson and Whicker (1971),
4. Prins and Geelen (1971), 5. Hofmann (1973), 6. Hobson et al. (1975), 7. Nagy and Regelin (1975), 8. Church and
Hines (1978), 9. Kay et al. (1980), 10. Hofmann (1982), 11. Maloiy et al. (1982), 12. Belovsky (1986), 13. Kay (1987),
14. Axmacher and Hofmann (1988), 15. Hofmann et al. (1988), 16. Takatsuki (1986), 17. Staaland and White
(1991), 18. Fraser (1996).
Jiang and Takatsuki, Feeding type in ruminants 85
Bovidae Cervidae
22 22
“eb
a
me eS 18
Sh (3)
ee aA (5) 1.4
oS
ro) (5) (3)
Sy Gy 1.0
ep (4)
™~!
= 06 $ 0.6
a
ra
0.2 02
GR MF BR GR MF BR
90 90
70 (8) 70 (1) 4)
(9) i
i 50
(13)
30 (1)
Capacity/body weight 9:75
3
@
10 10
GR MF BR GR MF BR
: 65 65
=
3 55 55 (1) (2)
B45 45 is (8)
S
35 (9) 35
“eb (16) :
2 25 25
SB 15 (11) 15
c
IS}
O 5 5
GR MF BR GR ME BR
Fig. 1. Three indices of digestive organs of Bovidae and Cervidae. Top: weight contributions of parotid glands to
body weight (g/kg), middle: ratios of capacity of rumino-reticulum (1) to metabolic body weight (kg®7>), and down:
ratio of content weight (kg) of rumino-reticulum to metabolic body weight (kg®-’5). GR: grazers, MF: mixed feeders
and BR: browsers. Numbers in parentheses indicate sample size and vertical lines indicate SD. For data sources,
see Tables 1 and 2.
c. Weight of rumino-reticulum contents
In Bovidae, the relative weight of rumino-reticulum contents was highest in grazers,
followed by mixed feeders and lowest in browsers (Fig. 1, Table 1). A similar tendency
was noted among the three feeding types in Cervidae, but only two data were available for
browsers and one for grazers, respectively (Fig. 1, Table 2). Obvious difference was not
found between mixed feeders and browsers (Fig. 1). Index values for each feeding type were
similar in Bovidae and Cervidae.
86
Mammal Study 24 (1999)
Table 3. Characters of the digestive organs of grazers and browsers.
Grazers Browsers Reference No.
Total salivary gland W (g)/Body W (kg) 1.8 3.6 5
Rumen structure Subdivided Simple 1
Rumen pillar Powerful Weak 1
Pappilla density in rumen wall Low, uneven High, even 2,4
Rumen dorsal wall SEF Low High 2,4
Average rumen SEF Low High 2, 4
Reticulum Small, deeply cellulated Large, lightly cellulated 2
Omasum Large, high SEF Small, low SEF [2
Orifice between reticulum and omasum Small Large V5 pd
Abomasum Large Small eye
Intestine L/Body L (time) 25-30 12-15 5
Small intestine L/Total intestine L (%) 80-82 65-73 5
Large intestine L/Total intestine L (%) 18-20 27-35 5
Capacity ratio of DFC/R-R 1/15-13 1/6-10 5
SEF: Surface enlargement factor of inner surface, L: Length, W: Weight, R-R: Rumino-reticulum. DFC: Distal
fermentation chamber. Reference No. 1. Hofmann and Stewart (1972), 2. Hofmann (1973), 3. Kay et al. (1980), 4.
Hofmann et al. (1988), 5. Hofmann (1989).
Other morphological characteristics of digestive organs
Other characteristics of digestive organs were compared for grazers and browsers (Table
3). The weight contribution of total salivary glands was higher in browsers than in grazers.
The rumens of grazers were more subdivided, more capacious, and had more powerful
muscle pillars for contraction than those of browsers (Hofmann 1968; Hofmann and Stewart
1972). Within the stomach, various shapes and sizes of papillae were more unevenly dis-
tributed in grazers than in browsers. Furthermore, papillae were less dense in grazers than in
browsers (Hofmann 1968, 1973). In the dorsal regions of the stomachs of grazers, extensive
unpapillated zones existed, while in browsers the papillae were evenly distributed. Conse-
quently, the degree of rumen surface enlargement was smaller in grazers than in browsers
(Hofmann 1973; Hofmann et al. 1988). The reticula of grazers were relatively smaller and
more deeply cellulated than in browsers, and exhibited distinct subdivisions in the secondary
and the tertiary crests (Hofmann 1973; Church and Hines 1978). The omasa were larger
with more pronounced mucosal surface enlargement in grazers than in browsers, because of
many laminae of several orders in size in grazers. The abomasa were larger and more
spacious in grazers than in browsers. Orifices between reticula and omasa were smaller in
grazers than in browsers (Hofmann 1973, 1989). Total intestinal length of grazers were
relatively longer, but the large intestines were relatively shorter than those of browsers
(Hofmann 1989). The distal fermentation chambers of grazers were relatively less spacious
than those of browsers. The digestive systems of grazers can pass foods more slowly
through the gut and digest them more thoroughly than those of browsers (Kay et al. 1980;
Van Soest 1982; Hofmann 1989).
Discussion
In this analysis, species relationships were derived from the traditional taxonomic
Jiang and Takatsuki, Feeding type in ruminants 87
classification of ruminants based mainly on morphology (Walker 1975; Spinage 1986). In
spite of considerable advances in studies on the phylogenetic relationships of ruminants
(Miyamoto et al. 1990; Gatesy et al. 1992; Wall et al. 1992; Chikuni et al. 1995; Cronin et al.
1996), a phylogenetic tree for all ruminants has not been established. However, phylogenetic
studies have confirmed close relationships within genera as defined by traditional taxonomic
categories. We assume that the use of traditional taxonomic relationships does not affect our
results.
The indices analyzed are closely related to food habits and digestive physiology. The
salivary gland and rumino-reticulum are the most important organs for ruminants to digest
fibrous foods (Hofmann 1973). The amount of the saliva secreted by the parotid gland is
closely related to the size of the glands, and the quick turnover and fermentation of ingesta
in the stomach of browsers need more saliva to buffer the rumen’s volatile fatty acid and pass
the digesta (Kay 1987; Hofmann 1989). Therefore, browsers possess larger parotid glands
than do grazers. In contrast to the salivary glands of the browsers, grazers possess a larger
rumino-reticulum, which ferments and digests fibrous food efficiently by its long retention
time (Hofmann 1973, 1989).
The result that different species in the same phylogenetic group (Bovidae or Cervidae)
appear in different feeding types suggests that the feeding types are not constrained strongly
by phylogenetic relations. The average values for each index showed a similar tendency
from grazers to browsers in both Bovidae and Cervidae (Fig. 1). In addition, other
morphological characteristics of the digestive organs of ruminants are similar in species of
the same feeding type irrespective of the phylogenies (Table 3). This further suggests that
the morphologies of digestive organs associated with different feeding types are likely
consistent in different phylogenetic groups, and are not strongly constrained by phylogeny.
These results suggest that the correlation among characteristics reflects independently
evolving lineages in ruminants. It is, however, noteworthy that Cervidae contains fewer
grazers, suggesting that species numbers are affected by phylogeny.
Two conclusions arise from this study: 1) phylogenetic relations did not strongly con-
strain feeding types and morphology of digestive organs of ruminants, and 2) there exists an
underlying principle that feeding types of ruminants are closely related to the morphology of
their digestive organs even in different phylogenetic groups.
Acknowledgements: We are especially grateful to Professor H. Higuchi, Associate Professor
T. Miyashita and Assistant Professor G. Fujita, of The University of Tokyo, for their
encouragement, valuable suggestions and constructive comments. We would also like to
express our thanks to Professor S. W. Buskirk, Department of Zoology and Physiology,
University of Wyoming, and Dr. P. McIntyre for their constructive comments and kind help
in reviewing English.
References
Axmacher, H. and Hofmann, R. R. 1988. Morphological characteristics of the masseter muscle of 22 ruminant
species. Journal of Zoology, London 215: 463-473.
Bell, R.H. V. 1971. A grazing ecosystem in the Serengeti. Scientific American 225: 86-93.
Belovsky, G. E. 1986. Optimal foraging and community structure: implications for a guild of generalist grassland
88 Mammal Study 24 (1999)
herbivores. Oecologia 70: 35-52.
Chikuni, K., Mori, Y., Tabata, T., Saito, M., Monma, M. and Kosugiyama, M. 1995. Molecular phylogeny based
on the k-Casein and cytochrome b sequences in the mammalian suborder Ruminantia. Journal of Molecular
Evolution 41: 859-866.
Church, D. C. and Hines, W. H. 1978. Ruminoreticular characteristics of elk. Journal of Wildlife Management 42:
654-659.
Clemens, E. T. and Maloiy, G.M.O. 1983. Digestive physiology of East African wild ruminants. Comparative
Biochemistry and Physiology 76A: 319-333.
Cronin, M.A., Stuart, R., Pierson, B. J. and Patton, J.C. 1996. K-casein gene phylogeny of higher ruminants
(Pecora, Artiodactyla). Molecular Phylogenetics and Evolution 6: 295-311.
Demment, M. W. 1982. The scaling of ruminoreticulum size with body weight in East African ungulates. African
Journal of Ecology 20: 43-47.
Fraser, K. W. 1996. Comparative rumen morphology of sympatric sika deer (Cervus nippon) and red deer (C.
elaphus scoticus) in the Ahimanawa and Kaweka Ranges central North Island, New Zealand. Oecologia 105:
160-166.
Gatesy, J.D., Yelon, R., DeSalle, E.S. and Vrba, E.S. 1992. Phylogeny of the Bovidae (Artiodactyla, Mamma-
lia), based on mitochondrial ribosomal DNA sequences. Molecular Biology of Evolution 9: 433-446.
Giesecke, D. and Van Gylswyk, N. O. 1975. A study of feeding types and certain rumen functions in six species of
South African wild ruminants. Journal of Agricultural Science, Cambridge 85: 75-83.
Gordon, I. J. and Illius, A. W. 1988. Incisor arcade structure and diet selection in ruminants. Functional Ecology
2 NS,
Hakonson, T. E. and Whicker, F. W. 1971. The contribution of various tissues and organs to total body mass in
the mule deer. Journal of Mammalogy 52: 628-630.
Harvey, P. H. and Pagel, M. D. 1991. The Comparative Method in Evolutionary Biology. Oxford University Press,
New York, 239 pp.
Hobson, P. N., Mann, S.O., Summers, R. and Staines, B. W. 1975. Rumen function in red deer, hill sheep and
reindeer in the Scottish Highlands. Proceeding of the Royal Society of Edinburgh (B) 75: 181-198.
Hofmann, R. R. 1968. Comparisons of the rumen and omasum structure in East African game ruminants in rela-
tion to their feeding habits. In (M. A. Crawford, ed.) Comparative Nutrition of Wild Animals. Pp. 179-194.
Symposium of Zoological Society of London 21: London.
Hofmann, R.R. 1973. The Ruminant Stomach (stomach structure and feeding habits of East African game
ruminants): Vol. 2, East African Monographs in Biology. East African Literature Bureau. Nairobi, 354 pp.
Hofmann, R. R. 1982. Morphological classification of Sika deer within the comparative system of ruminant feeding
types. Deer 5: 352-353.
Hofmann, R.R. 1984. Feeding habits of mouflon (Ovis ammon musimon) and chamois (Rupicapra rupicapra) in
relation to the morphophysiological adaptation of their digestive tract. In (M. Hoefs, ed.) Proceedings of
Northern Wild Sheep and Goat Council 4: 341-355.
Hofmann, R.R. 1988. Morphophysiological evolutionary adaptations of the ruminant digestive system. In (A.
Dobson, ed.) Comparative Aspects of Physiology of Digestion in Ruminants. Pp. 393-407. Cornell University
Press.
Hofmann, R.R. 1989. Evolutionary steps of ecophysiological adaptation and diversification of ruminants: a
comparative view of their digestive system. Oecologia 78: 443-457.
Hofmann, R.R., Knight, M. H. and Frssaf, J. D. S. 1995. On structural characteristics and morphophysiological
adaptation of the springbok (Antidorcas marsupialis) digestive system. Transactions of the Royal Society of
South Africa 50: 125-142.
Hofmann, R. R., Saber, A. S., Pielowski, Z. and Fruzinski, B. 1988. Comparative morphological investigations of
forest and field ecotypes of roe deer in Poland. Acta Theriologica 33: 103-114.
Hofmann, R.R. and Stewart, D. R. M. 1972. Grazer or browser: a classification based on the stomach-structure
and feeding habits of East African ruminants. Mammalia 36: 226-240.
Hoppe, P. P., Qvortrup, S. A. and Woodford, M.H. 1977. Rumen fermentation and food selection in East
African sheep, goats, Thomason’s gazelle, grant’s gazelle and impala. Journal of Agricultural Science, Cam-
bridge 89: 129-135.
Hoppe, P.P., Van Hoven, W., Von Engelhardt, W., Prins, R. A., Lankhorst, A. and Gwynne, M.D. 1983.
Jiang and Takatsuki, Feeding type in ruminants 89
Pregastric and caecal fermentation in dikdik (Madoqua kirki) and suni (Nesotragus moschatus). Comparative
Biochemistry and Physiology 75A: 517-524.
Janis, C. 1976. The evolutionary strategy of the Equidae and the origins of rumen and cecal digestion. Evolution
30: 215-267.
Jarman, P. J. 1974. The social organization of antelope in relation to their ecology. Behaviour 48: 215-267.
Kay, R. N. B. 1987. Weights of salivary glands in some ruminant animals. Journal of Zoology, London 211: 431-
436.
Kay, R.N.B., Engelhardt, W. V. and White, R.G. 1980. The digestive physiology of wild ruminants. In (Y.
Ruckebusch and P. Thivend, eds.) Digestive Physiology and Metabolism in Ruminants. Pp. 743-761. AVI Publ.
Com inc:
Maloiy, G. M. O., Clemens, E. T. and Kamau, J. M. Z. 1982. Aspects of digestion and in vitro rumen fermentation
rate in six species of East African wild ruminants. Journal of Zoology, London 197: 345-353.
Miyamoto, M. M., Kraus, F. and Ryder, O. A. 1990. Phylogeny and evolution of antlered deer determined from
mitochondrial DNA sequences. Proceeding of Natural Academy of Sciences, USA 87: 6127-6131.
Nagy, J. G. and Regelin, W. L. 1975. Comparison of digestive organ size of three deer species. Journal of Wildlife
Management 39: 621-624.
Prins, R. A. and Geelen, M. J. H. 1971. Rumen characteristics of red deer, fallow deer and roe deer. Journal of
Wildlife Management 35: 673-680.
Romer, A. S. 1966. Vertebrate Paleontology. University of Chicago Press. Chicago and London, 446 pp.
Short, H. L. 1964. Postnatal stomach development of white-tailed deer. Journal of Wildlife Management 28: 445—
458.
Short, H. L., Medin, D. E. and Anderson, A. E. 1965. Ruminoreticular characteristics of mule deer. Journal of
Mammalogy 46: 196-199.
Spinage, C. A. 1986. The Natural History of Antelopes. Croom Helm Publishers Ltd, Provident House, Burrel
Row, Beckenham, Kent, 203 pp.
Staaland, H. and White, R.G. 1991. Influence of foraging ecology on alimentary tract size and function of
Svalbard reindeer. Canadian Journal of Zoology 69: 1326-1334.
Takatsuki, S. 1986. Food habits of Sika deer on Mt. Goyo, northern Honshu. Ecological Research 1: 119-128.
Van Soest, P. J. 1982. Nutritional Ecology of the Ruminant. O & B Books, Corvallis, 374 pp.
Walker, E. P. 1975. Mammals of the World. 3rd edn. (J. L. Paradiso, ed.) The Johns Hopkins University Press,
Baltimore and London, 1500 pp.
Wall, D. A., Davis, S. K. and Read, B. M. 1992. Phylogenetic relationships in the subfamily Bovinae (Mammalia:
Artiodactyla) based on ribosomal DNA. Journal of Mammalogy 73: 262-275.
Received 16 April 1999. Accepted 12 October 1999.
~
. ne ;
rs ?
re le a ye Avciies Cathi oma
th = Pe aa) a
Mammal Study 24: 91-102 (1999)
© the Mammalogical Society of Japan
Diet of the Japanese serow (Capricornis crispus) on the Shimokita
Peninsula, northern Japan, in reference to variations
with a 16-year interval
Keiji Ochiai!
Natural History Museum and Institute, Chiba, 955-2 Aoba-cho, Chuo-ku, Chiba 260-8682, Japan
Abstract. The diet of the Japanese serow (Capricornis crispus) was analyzed quantitatively
in a high density (14.8+3.0 individuals/km2) population throughout the year by direct
observation of feeding behavior on the Shimokita Peninsula, northern Japan, during two
survey periods, 1978-1980 and 1994-1996. Serows fed on 114 plants species and one species
of fungus. Analyses of 16,686 bites indicated that serows fed mainly on leaves and twigs
of deciduous broad-leaved trees, which formed 54.8-58.3% of the diet in autumn and
94.5-95.0% in winter, followed by forbs (16.5-39.1% from spring to autumn). The results
suggest that the Japanese serow is a browser throughout the year, and is mainly a folivore.
There was no significant difference in the dietary composition at the food category level, nor
was there any change in the diversity index of the diet between the two study periods. The
four top-ranking food species were identical in the both periods. Browsing by Japanese
serows may have only limited impacts on vegetation because of low population densities
related to territoriality.
Key words: browser, browsing effects, Capricornis crispus, diet, Japanese serow.
The Japanese serow (Capricornis crispus) is a solitary ungulate inhabiting forested moun-
tainous areas of Japan. A knowledge of food habits is essential for understanding wildlife
habitat needs. The present study on the diet of Japanese serows had two aims.
The first was to analyze the serow diet quantitatively throughout the year. Many reports
(Chiba 1968; Chiba and Yamaguchi 1975; Miyao 1976; Akasaka 1977; Akasaka and
Maruyama 1977; Yamaguchi and Takahashi 1979) have indicated that Japanese serows feed
mainly on various woody species according to the region inhabited. However, these studies
have been qualitative and/or analyzed with small sample size, except for a single analysis of
the winter diet (Takatsuki and Suzuki 1984). Therefore, more detailed quantitative studies
on all seasons are needed for a clear understanding of Japanese serow feeding habits.
The second aim of the study was to analyze the effects of browsing by Japanese
serows on vegetation by comparing the diets recorded in two survey periods 16 years apart.
Ungulates not only depend on plant communities but also can affect plant community com-
position and structure. Numerous studies on the effects of browsing have been conducted,
1F-mail: ochiai@chiba-muse.or.jp
92 Mammal Study 24 (1999)
as reviewed by Gill (1992) and Augustine and McNaughton (1998). However, almost all of
these studies focused on gregarious and/or non-territorial ungulates. The effects of solitary
and territorial ungulates such as the Japanese serow on vegetation may be different from
those of gregarious species. In this study, the effects of serows on the vegetation are
discussed in comparison with corresponding information on sika deer (Cervus nippon), a
gregarious ungulate inhabiting Japan.
Study area
The study area (90 ha) was situated in Wakinosawa village (41°8'N; 140°46’E) on the
Shimokita Peninsula, Aomori Prefecture, northern Japan. The area, facing Mutsu Bay on
its south and west sides, ranges in altitude between 0 and 240 m, and slopes are steep (25°).
The climate belongs to the cool temperate zone; mean annual temperature is 9.3°C and mean
monthly temperatures ranges from —1.8°C in February to 21.5°C in August. Mean annual
precipitation is 1,337 mm at the nearest meteorological station, 4km east of the study area.
The area is covered by 30-100cm of snow in winter, and snow cover persists for three
months between late December and March.
In 1978, 75% of the area was mature deciduous broad-leaved forests dominated by
Quercus mongolica ssp. crispula, Fagus crenata and Tilia japonica with Rhododendron
obtusum var. kaempferi and Viburnum dilatatum as common understory species. Natural
coniferous forests of Thujopsis dolabrata var. hondae covered 7% of the area. Plantations
with coniferous trees (Cryptomeria japonica and Pinus densiflora) both less than 20 years
old and over 21 years old accounted for 10% and 3% of the area, respectively. The vegeta-
tion composition in the study area remained unchanged between the two study periods. The
proportion of younger and older plantations, however, had changed to 1% and 12% of the
study area.
Serows, the only species of ungulates inhabiting the study area, maintained a stable
population density with a mean of 14.8 individuals/km? (SD=3.0) from 1976 to 1996 (Ochiai
1993, unpublished data). The mean population density of Japanese serows in 10 prefectures
is 2.62.7 individuals/km* (mean+SD, n=174) (Maruyama and Furubayashi 1980); the
density of serows in the study area was at the highest level.
Methods
To servey vegetation composition in the study area, trunk diameters at ground level
of all woody plants (<2 m in height) were measured in forty 5mx<4m plots. For the survey
two sites in the study area were selected, and the twenty plots in each site were distributed
uniformly on a 100m square grid. This survey was carried out in 1997.
Diet composition was estimated by direct bite count observation (Wallmo and Neff
1970). Field observations were made during two periods, from March 1978 to October 1980
(Period A, 191 days) and from October 1994 to November 1996 (Period B, 59 days). The
surveys were conducted in May-June (spring), July-September (summer), October-November
(autumn) and January-March (winter) in Period A and only in autumn and winter in Period
B. Serows were directly observed for 947 h in Period A and 223 h in Period B, for a total of
1,170 h in 250 days.
Ochiai, Diet of the Japanese serow 93
I walked through the study area looking for serows, and observed the feeding behavior
of any serows detected with the aid of 7 x 35 binoculars and a telescope (x 25). Because the
serows in the study area were not very alarmed by the presence of humans, it was possible
to follow about 10-20 m behind without serious disturbances. The number of bites, food
species and plant parts eaten were recorded. In winter, fresh signs of feeding on twigs along
fresh serow tracks in snow were also recorded as bites. Foods were categorized into woody
plants (deciduous broad-leaved trees, including vines, and evergreen coniferous trees), forbs,
graminoids, ferns and fungi. The composition of serow diets was expressed as percentages
of the total number of bites, regardless of bite size.
Food diversity was measured according to the Shannon-Weaver index (77),
H =—>(P)In(P))
where P; is the proportion of food item i in the total diet.
Diets in autumn and winter between Periods A and B were compared by the G-test.
Results
Dominance of understory trees
Forty-four understory tree species were recorded in the plots, and deciduous broad-
leaved trees of 41 species accounted for as much as 96.6% of the total basal area at ground
level (Appendix 1). Two species of deciduous broad-leaved trees, R. obtusum var.
kaempferi (18.5%) and V. dilatatum (18.3%), were dominant, followed by QO. mongolica ssp.
crispula (8.0%), Tripetaleia paniculata (6.5%) and T. japonica (5.4%).
Diet at the food category level
A total of 16,686 bites was observed. The most important food category was woody
plants, which comprised 56.2-60.2% of the diet in autumn to 97.7-98.1% in winter (Table 1).
Forbs accounted for 16.5-39.1% from spring to autumn, and two graminoids (Carex species)
were eaten in autumn (3.9-4.7%) and winter (1.6-2.1%).
Among trees, deciduous broad-leaved trees were the primary food. Serows browsed
leaves from spring to autumn and 5-10 cm long twigs with buds in winter. The proportion
of the twigs rose to 93.2-94.5% in the winter diet. Leaves of evergreen coniferous trees were
eaten in autumn (1.4-1.9%) and winter (2.7-3.6%). Serows occasionally fed on flowers and
fruit together with leaves. Flowers of R. obtusum var. kaempferi and fruits of Berberis
amurensis were eaten selectively. Fallen acorns of Q. mongolica ssp. crispula were also
consumed in autumn and winter. Serows dug for acorns when the snow cover was not more
than 10cm deep. No bark or dead leaves of woody plants were eaten.
Diet at individual species level
Serows fed on 114 plant species (60 deciduous broad-leaved trees, 5 evergreen coniferous
trees, 46 forbs, two graminoids and one fern) belonging to 56 families, and one species of
fungus (Table 2). The numbers of food species were higher (64-81 species) from spring to
summer, and lower (29-32 species) in winter. The diversity index (H’) of the diet was highest
(3.29) in summer, and lowest (2.33-2.35) in winter (Table 2).
04 Mammal Study 24 (1999)
Table 1. Food categories and the percentage frequencies of bites of the Japanese serow (Capricornis crispus)
observed on the Shimokita Peninsula, northern Japan, in each season during Period A (1978-1980) and Period B
(1994-1996).
Month May-June July—Sept. Oct.—Nov. Jan.—Mar.
Period A A A B A B
Food category n=2,281 n=3,567 n=2,668 n=1,720 n=3,879 n=2,571
Woody plants
Deciduous broad-leaved trees
leaves 82.9 77.8 56.1 49.1 0.0 0.0
flowers 0.6 0.0 0.0 0.0 0.0 0.0
fruits 0.0 0.6 0.2 0.3 0.0 0.0
acorns 0.0 0.0 0.4 5.4 0.0 1.8
twigs and buds 0.0 0.0 1.6 0.0 94.5 93.2
Total deciduous broad-leaved trees 83.5 78.4 58.3 54.8 94.5 95.0
Evergreen coniferous trees (leaves) 0.0 0.0 1.9 1.4 3.6 Deal
Total woody plants 83.5 78.4 60.2 56.2 98.1 97.7
Forbs
leaves and stems 16.5 plod 35.8 39.1 0.3 0.2
flowers 0.0 0.4 0.1 0.0 0.0 0.0
Total forbs 16.5 21.5 35.9 39.1 0.3 0.2
Graminoids 0.0 0.0 3.9 4.7 1.6 2.1
Ferns 0.0 0.0 =F 0.0 0.0 0.0
Fungi 0.0 0.1 0.0 0.0 0.0 0.0
+: trail (<0.05).
Table 2. Number of food species for each food category, diversity index of diet, and percentage frequencies of
bites accounted for by major food species (3, 5 and 10 top-ranking food species) of the Japanese serow (Capricornis
crispus) on the Shimokita Peninsula, northern Japan, in each season during Period A (1978-1980) and Period B
(1994-1996).
May-June July—Sept. Oct.—Nov. Jan.—Mar. Total
Food category Period A A A B A B —
Woody plants
Deciduous broad-leaved trees 39 42 28 23 23 24 60
Evergreen coniferous trees 0 0 2 1 5 2 5
Forbs 25 38 23 23 2 1 46
Graminoids 0 0 2 2 7) 2 2
Ferms 0 0 1 0 0 0 1
Fungi 0 1 0 0 0 0 1
Total 64 81 56 49 32 29 115
Shannon-Wiener diversity index 2.87 3.29 3.03 3.09 2233 235 —
% of the 3 top-ranking food species 50.7 35.7 39.4 39.4 59.0 57.8 —
% of the 5 top-ranking food species 59.1 46.4 53.9 S24 Boll Teo —
% of the 10 top-ranking food species 74.4 64.0 73.0 71.0 88.6 88.6 —
Ochiai, Diet of the Japanese serow 95
In spite of the large number of food species, a major part of the diets comprised a
limited number of species: e.g., the top five and 10 species in the diet accounted for 46.4—
75.5% and 64.0-88.6%, respectively (Table 2). According to a similar analysis, 80% of the
total diet was comprised of 13-18 species in spring-autumn and only seven species in winter.
The main food species changed seasonally (Appendix 2).
Comparison between Period A (1978-1980) and Period B (1994-1996)
No significant difference in the percentage frequencies of bites of the four food cate-
gories (deciduous broad-leaved trees, evergreen coniferous trees, forbs and graminoids)
was detected in either autumn or winter between the two study Periods A and B (Table 1;
autumn, G=7.65, df=3, P>0.05; winter, G=6.78, df=3, P>0.05). There was no
obvious change in the H’ values for the diet between Periods A and B; the values were
3.03 and 3.09 in autumn and 2.33 and 2.35 in winter, respectively. The following species
remained unchanged as the top four species in the both periods: Callicarpa japonica,
Table 3. Results of G-test for the numbers of counted bites of the Japanese serow (Capricornis crispus) on the
Shimokita Peninsula, northern Japan, in autumn between Period A (1978-1980) and Period B (1994-1996). The
top 15 species in each period are shown.
Period A Period B
Species Rank No.of % Rank No.of % G
order bites order bites
Callicarpa japonica 1 464 17.4 1 324 18.8 0.739 NS
Alangium platanifolium var. trilobum D, 345 12.9 4 136 TD a NANOS 2 Dae
Angelica ursina 3 242 9.1 2 201 7 Bn800) wil
Artemisia montana 4 237 8.9 3 152 8.8 0.001 NS
Buckleya lanceolata 5 150 5.6 — 0 OM WBS Ibe
Akebia trifoliata 6 135 5.1 9 49 2.8 6.689 D**
Smilax china 1 124 4.6 11 35 2.0 11041 DE ss
Carex blepharicarpa & C. foliosissima 8 105 3.9 6 82 4.8 0.877. NS
Asperula odorata 9 75 2.8 44 4 A PSSIG IDs
Rhus ambigua 10 70 2.6 33 7 OA SSS Dt oe
Spuriopimpinella calycina 11 66 75) 21 16 0.9 Ua Dye
Rubus crataegifolius 12 61 D8) 16 75) Joe) 1.962 NS
Acer japonicum 13 54 7x0) 14 28 1.6 0.455 NS
Eupatorium chinense var. oppositifolium 14 48 1.8 24 14 0.8 3.927 Ds
Berberis amurensis 15 43 1.6 _— 0 V0. Als ID
Quercus mongolica ssp. crispula 19 35 1.3 5 114 G5, ALO) il
Cacalia auriculata var. kamtschatica 27 13 0.5 13 29 1 TTL Satelite rs
Schizophragma hydrangeoides 4] 3 0.1 10 45 DS BT Ws
Solidago virgaurea var. asiatica 41 3 0.1 12 32 1298 F213 865 rules
Lindera umbellata ssp. membranacea 46 2 0.1 15 26 1S) sp SAD ee aes
Zanthoxylum piperitum — 0 0.0 7 79 aS Ss
Trifolium repens — 0 0.0 8 52 3 AQIS ee
Others — 393 14.7 — 270 S)57/ — —
Total — 2,668 100.0 — 1,720 100.0 — —
Asterisks indicate the degree of significance of the results (*** P<0.001, ** P<0.01, * P<0.05, NS=not sig-
nificant), and ‘D’ and ‘I’ represent a significant decline and increase in occurrence of the individual species in the
diet from Period A to B, respectively.
96 Mammal Study 24 (1999)
Table 4. Results of G-test for the numbers of counted bites of the Japanese serow (Capricornis crispus) on the
Shimokita Peninsula, northern Japan, in winter between Period A (1978-1980) and Period B (1994-1996). The top
15 species in each period are shown.
Period A Period B
Species Rank No. of % Rank No.of % G
order bites order bites
Hamamelis japonica var. obtusata 1 Ls WSo7 D 572. 22.2" “loin
Lindera umbellata ssp. membranacea 2 858 DON 1 583 De 0.138 NS
Tilia japonica 3 317 8.2 4 DSi 10.0 3.138 I*
Acer japonicum 4 292 US 3 332 12.9. uf 252103mu of ***
Viburnum furcatum 5 279 To2d I 75 2:9 «29536. ***
Stachyurus praecox 6 211 5.4 15 11 0.4 75.640 D***
Thujopsis dolabrata var. hondae 7 120 3.1 8 val 2.8 0.299 NS
Carpinus cordata 8 97 DES lst 55) Poe 0.444 NS
Viburnum wrightii 9 86 Dp 5) 197 hell 53554050 1 4t*
Quercus mongolica ssp. crispula 10 64 1.6 6 111 4-3 45 20 296mr s**
Fraxinus lanuginosa f. serrata 11 64 1.6 10 57 Phe) 1.329 NS
Carex blepharicarpa & C. foliosissima 12 61 1.6 12 ay) 2.0 0.897 NS
Corylus sieboldiana 13 55 1.4 16 9 0.4" 1107345 DF *
Viburnum dilatatum 14 52 1.3 9 67 2.6 6:65 7) ke *
Buckleya lanceolata 15 50 1.3 — 0 0.0" 25555355 D***
Fagus crenata 19 18 0.5 14 38 15 9.020 I**
Rhus ambigua 24 9 0.2 13 42 1.6 19.595 |[***
Others — 134 3.5 — 42 1.6 — —
Total — 3,879 100.0 — 2,571 100.0 — —
Asterisks indicate the degree of significance of the results (*** P<0.001, ** P<0.01, * P<0.05, NS=not sig-
nificant), and ‘D’ and ‘I’ represent a significant decline and increase in occurrence of the individual species in the
diet from Period A to B, respectively.
Alangium platanifolium var. trilobum, Angelica ursina, and Artemisia montana in autumn;
Hamamelis japonica var. obtusata, Lindera umbellata ssp. membranacea, Tilia japonica, and
Acer japonicum in winter. However, in the second study period, among 22 species in
autumn (the top 15 species in each period) nine accounted for a significantly lower propor-
tion of the diet, eight accounted for a significantly higher proportion (P<0.05), and five
showed no significant difference (Table 3). There were some conspicuous declines between
study periods (e.g., Buckleya lanceolata, Asperula odorata). Among 17 species in winter,
the proportion in the diet of five significantly decreased, seven increased (P<0.05), and five
showed no significant difference (Table 4). Conspicuous declines between study periods were
also apparent in the winter use of some species (e.g., Stachyurus praecox, Viburnum
furcatum).
Discussion
General features of the serow diet
On the Shimokita Peninsula, Japanese serows fed mainly on woody plants, mostly
deciduous broad-leaved trees. Forbs were of secondary importance from spring to autumn.
These results support the findings of Takatsuki and Suzuki (1984), who analyzed the winter
Ochiai, Diet of the Japanese serow 97
foods of serows in central Japan, and described them as browsers. The current study found
that Japanese serows on the Shimokita Peninsula are browsers throughout the year, and are
conspicuous folivores.
Food habits of Japanese serows vary regionally. Several pioneer reports indicated that
conifers and evergreen broad-leaved shrubs are important in the winter diet (Chiba and
Yamaguchi 1975; Miyao 1976; Akasaka 1977; Yamaguchi and Takahashi 1979). For
instance, the proportion of coniferous trees occupied more in winter in central Japan
(32.8%, Takatsuki and Suzuki 1984) than in the present study (2.7-3.6%). Their study areas
contained many young plantations of a coniferous tree (Chamaecyparis obtusa). Yakatsuki
et al. (1988) reported that a coniferous shrub (Cephalotaxus harringtonia var. nana) and an
evergreen broad-leaved shrub (Aucuba japonica var. borealis) were the main winter foods
in Yamagata, northern Japan. These shrubs are uncommon in the present study area. In
addition, no feeding on dwarf bamboos (Sasa spp.) was observed in the present study,
although it accounted for 27.2% of the winter diet in central Japan (Takatsuki and Suzuki
1984). Takatsuki and Suzuki (1984) interpreted the importance of dwarf bamboos in the
diet of serows as a reflection of their relative abundance and year-round availability. Dwarf
bamboos seem to be less important in low altitude areas (<600 m) such as the present study
and Yamagata (Takatsuki et al. 1988) than at higher altitudes (600-1700 m, Chiba and
Yamaguchi 1975; Yamaguchi and Takahashi 1979; Takatsuki and Suzuki 1984). If this
altitude-related difference is valid, dwarf bamboos may be a less preferred food eaten mainly
under poor food conditions.
The Japanese serow is a forest-dwelling, solitary species with a small resource-defending
territory (Akasaka and Maruyama 1977; Ochiai 1983a, b, 1993; Kishimoto and Kawamichi
1996). Their body size is moderate (30-45 kg), and they have little sexual dimorphism
(Miura 1986). These features are typical of browsers (Bell 1971; Jarman 1974). The present
results together with the findings of Takatsuki and Suzuki (1984) support the Jarman-Bell
principle.
The mainland serow (C. sumatraensis) and the goral (Nemorhaedus goral) belong to the
same Tribe Rupicaprini as the Japanese serow. These are also primitive species inhabiting
forests. Faecal analysis of these two sympatric species in North India indicated that the
mainland serow was a browser, whereas the goral was a grazer (Green 1987). The goral can
dwell in cliff habitats with open rocky slopes (Schaller 1977; Heptner et al. 1989; Lovari and
Apollonio 1993). The maximum group size of gorals is 9-11 (Cavallini 1992; Lovari and
Apollonio 1993), which is larger than the corresponding figure, 4 of the Japanese serow
(Ochiai 1993; Kishimoto and Kawamichi 1996). The Japanese serow seems to be a fairly
solitary browser in comparison with the goral.
Effects of browsing
In the 16 years between study Period A and B, no obvious difference in the crude com-
position of the diet was found. However, the proportion of some species, such as Buckleya
lanceolata and Stachyurus praecox, decreased markedly in the diet. These results suggest
that although the browsing of serows may have no drastic impacts on overall vegetation
structure and composition, some species may be affected by browsing pressure. Since the
density of serows in the study area is among the highest in Japan, negative impacts of
browsing on vegetation structure and composition in other areas are even less likely.
98 Mammal Study 24 (1999)
In contrast, the sika deer (Cervus nippon centralis), another medium-sized ruminant
(60-87 kg for males and 40-50 kg for females, Koganezawa et al. 1986; Ochiai and Asada
1995) living in Honshu, Japan, has been reported to have severe impacts on vegetation,
including not only the elimination of the main food species in the habitat (Kabaya 1988)
but also the alteration of forest composition (Takatsuki and Gorai 1994). This difference
may reflect differences in social organization, such as the territorial isolation of the Japanese
serow as opposed to the non-territorial gregariousness of sika deer. Consequently, the
population density of serows seldom exceeds 20/km* (Maruyama and Furubayashi 1980),
whereas it reaches 100/km2 with sika deer (C. n. nippon; Doi and Endo 1995). At such low
densities, it is less likely that over-browsing by serows would lead to changes in overall
vegetation structure and composition (Takatsuki 1996). Furthermore, the aggregation of
serows and the concentration of their browsing on preferable species may be less than sika
deer due to their territoriality, even when their population densities are similar. Differences
in the volume of forage intake related to body size may also influence the relative degree of
the browsing effects.
Acknowledgements: I wish to thank H. Mizuhara for his valuable advice. I am also
grateful to S. Lovari and Y. Ono for their helpful comments on an earlier draft of the
manuscript. I thank T. Nakashizuka for his help on the identification of the plant species,
K. Susaki for providing assistance during the field work, members of the Society of Serow
Research on the Shimokita Peninsula for their co-operation in the survey of the vegetation,
the people of Wakinosawa village, A. Matsuoka, S. Matsuoka, T. Nakazima, M. Shibata,
K. Takahashi and others for their kindness and helpfulness, and J. P. Moll for improving
the English manuscript. This study was supported in part by a Grant-in-Aid for Scientific
Research from the Ministry of Education, Science and Culture, Japan (Nos. 06660200 and
10680559).
References
Akasaka, T. 1977. Food habits and feeding behavior of Japanese serow in Nibetsu, Akita Prefecture. Annual
Reports of WWF-Japan 1: 67—80 (in Japanese with English summary).
Akasaka, T. and Maruyama, N. 1977. Social organization and habitat use of Japanese serow in Kasabori. Journal
of Mammalogical Society of Japan 7: 87-102.
Augustine, D. J. and McNaughton, S. J. 1998. Ungulate effects on the functional species composition of plant
communities: herbivore selectivity and plant tolerance. Journal of Wildlife Management 62: 1165-1183.
Bell, R. 1971. A grazing ecosystem in the Serengeti. Scientific American 225: 86—93.
Cavallini, P. 1992. Survey of the goral Nemorhaedus goral in Himachal Pradesh, India. Journal of Bombay
Natural History Society 89: 302-307.
Chiba, H. 1968. Some notes on the food habit of the Japanese serow, Capricornis crispus crispus (TEMMINCK).
Journal of Mammalogical Society of Japan 4: 20—25 (in Japanese with English summary).
Chiba, H. and Yamaguchi, Y. 1975. The food habit of Japanese serow Capricornis crispus crispus (TEMMINCK),
in the basin of River Takase, the Japan North Alps. Bulletin of the Kanagawa Prefectural Museum (Natural
Science) 8: 21-36 (in Japanese with English summary).
Doi, T. and Endo, A. 1995. A report on the effects of the Nozaki Dam, Ojika area. Department of Ecology,
Faculty of Science, Kyushu University, Fukuoka, 25 pp. (in Japanese).
Gill, R. M. A. 1992. A review of damage by mammals in North temperate forests: impact on trees and forests.
Forestry 65: 363-388.
Ochiai, Diet of the Japanese serow 99
Green, M. J. B. 1987. Ecological separation in Himalayan ungulates. Journal Zoology. Ser. B. London 1: 693-719.
Heptner, V. G., Nasimovich, A. A. and Bannikov, A. G. 1989. Mammals of the Soviet Union, volume 1 ungulates.
E. J. Brill, Leiden, 1147 pp.
Jarman, P. J. 1974. The social organization of antelope in relation to their ecology. Behaviour 48: 215-267.
Kabaya, H. 1988. Changes of undergrowth of a broadleaved evergreen forest in relation to grazing effects by sika
deer. Bulletin of the Tokyo University Forests 78: 67-82 (in Japanese with English summary).
Kishimoto, R. and Kawamichi, T. 1996. Territoriality and monogamous pairs in a solitary ungulate, the Japanese
serow, Capricornis crispus. Animal Behaviour 52: 673-682.
Koganezawa, M., Inui, T. and Kitahara, M. 1986. Body weight and external carcass measurements of sika deer
(Cervus nippon Temminck) in Nikko-Ashio Mountains, Tochigi Prefecture, Japan. Memoirs of Tochigi
Prefectural Museum 4: 29-53 (in Japanese with English summary).
Lovari, S. and Apollonio, M. 1993. Notes of the ecology of gorals in two areas of Southern Asia. Revue d’Ecologie
48: 365-374.
Maruyama, N. and Furubayashi, K. 1980. On the distribution, density, and population size of Japanese serow. The
Environmental Agency, Tokyo, 48 pp. (in Japanese).
Miura, S. 1986. Body and horn growth patterns in the Japanese serow, Capricornis crispus. Journal of Mamma-
logical Society of Japan 11: 1-13.
Miyao, T. 1976. Stomach contents of Japanese serow indigenous to southern parts of the Japan North Alps.
Journal of Mammalogical Society of Japan 6: 199-209 (in Japanese with English summary).
Ochiai, K. 1983a. Pair-bond and mother-offspring relationships of Japanese serow in Kusoudomari, Wakinosawa
Village. Journal of Mammalogical Society of Japan 9: 192-203 (in Japanese with English summary).
Ochiai, K. 1983b. Territorial behavior of the Japanese serow in Kusoudomari, Wakinosawa Village. Journal of
Mammalogical Society of Japan 9: 253—259 (in Japanese with English summary).
Ochiai, K. 1993. Dynamics of population density and social interrelation in the Japanese serow, Capricornis
crispus. 72 pp. Ph.D. Thesis. Kyushu University, Fukuoka.
Ochiai, K. and Asada, M. 1995. Growth in the body size of sika deer (Cervus nippon) on the Boso Peninsula,
central Japan. Journal of the Natural History Museum and Institute, Chiba 3: 223-232 (in Japanese with
English summary).
Schaller, G. B. 1977. Mountain monarchs. University of Chicago Press, Chicago, 425 pp.
Takatsuki, S. 1996. Relationship between food resources and territoriality of the Japanese serow. In The Japanese
serows in the Western Zao. Pp. 101-106. Yamagata Prefectural Board of Education, Yamagata (in Japanese).
Takatsuki, S. and Gorai, T. 1994. Effects of Sika deer on the regeneration of a Fagus crenata forest on Kinkazan
Island, northern Japan. Ecological Research 9: 115—120.
Takatsuki, S., Osugi, N. and Ito, T. 1988. A note on the food habits of the Japanese serow at the western foothill
of Mt. Zao, northern Japan. Journal of Mammalogical Society of Japan 13: 139-142.
Takatsuki, S. and Suzuki, K. 1984. Status and food habits of Japanese serow. Proceedings Biennial Symposium of
Northern Wild Sheep & Goat Council 4: 231-240.
Wallmo, O. C. and Neff, D. J. 1970. Direct observations of tamed deer to measure their consumption of natural
forage. In Range and wildlife habitat evaluation — a research symposium. U.S. Department Agriculture/Forest
Service Miscellaneous Publication 1147: 105-110.
Yamaguchi, Y. and Takahashi, H. 1979. Food habits of Japanese serow as assessed by rumen contents. In Report
on wildlife damages. Pp. 29-51. Environmental Agency of Japan, Tokyo (in Japanese).
Received 15 March 1999. Accepted 18 October 1999.
100 Mammal Study 24 (1999)
Appendix 1. Basal area of understory woody species in the study area.
Species Leaf type* Basal area** Percentage
(mm?/m?)
Rhododendron obtusum var. kaempferi D 63.3 18.5
Viburnum dilatatum D 62.4 18.3
Quercus mongolica ssp. crispula D PET xP 8.0
Tripetaleia paniculata D Dos) 6.5
Tilia japonica D 18.5 5.4
Lindera umbellata ssp. membranacea D 16.3 4.8
Fraxinus lanuginosa f. serrata D 15.1 4.4
Magnolia praecocissima D 14.5 4.2
Hamamelis japonica var. obtusata D 9.6 2.8
Viburnum wrightii D 933 Dea
Acer japonicum D 9.0 2.6
Callicarpa japonica D 8.0 23
Carpinus cordata D 7.8 2.3
Thujopsis dolabrata var. hondae C 6.1 1.8
Zanthoxylum piperitum D 505) 1.6
Vaccinium oldhamii D 5.4 1.6
Syringa reticulata D 4.4 15S)
Evodiopanax innovans D 4.2 1.2
Quercus dentata D Sail Jel
Acer mono f. marmoratum D Sol el
Alangium platanifolium var. trilobum D 325 1.0
Rhododendron brachycarpum E 3.0 0.9
Fagus crenata D 3.0 0.9
Cryptomeria japonica C 2.3 0.7
Corylus sieboldiana D 233 0.7
Pourthiaea villosa var. laevis D 1.9 0.5
Carpinus laxiflora D 1.8 0.5
Rhus ambigua D hed 0.5
Euonymus alatus f. ciliato-dentatus D 1.0 0.3
Sorbus alnifolia D 0.9 0.3
Viburnum furcatum D 0.9 0.3
Benthamidia japonica D 0.7 0.2
Berberis amurensis D 0.7 O7
Rubus crataegifolius D 0.6 0.2
Aralia elata D 0.2 0.1
Sambucus racemosa ssp. sieboldiana D 0.2 0.1
Vaccinium japonicum D 0.2 0.1
Clerodendrum trichotomum D 0.2 0.1
Picrasma quassioides D 0.2 0.0
Euonymus alatus D 0.1 0.0
Morus australis D 0.1 0.0
Buckleya lanceolata D 0.1 0.0
Stachyurus praecox D =F 0.0
Akebia trifoliata D = 0.0
Total — 341.6 100.0
*: D, deciduous broad-leaved tree (including two vine species); E, evergreen broad-leaved tree; C, evergreen
coniferous tree.
**: basal area at ground level.
+: trail (<0.05 mm?/m72).
101
Ochiai, Diet of the Japanese serow
v0 vl £0 vii 9°0 80 d oeooe[Njog pubipjogais snjx1oy
L'€ 3°0 4 seooe[AydodAle,) SIUNWWUOD DULJAWUWOd
3°0 QT rl €'0 8°0 A sejIsodurog wnyofiisoddo ‘rea asuauiys wnisojvdny
7'0 ys 0°0 €°0 6'0 d eae InAYIeIS xoJapid sninkyonjy
L'0 9°7 L'0 €°0 Q°7 O'T ad IBIOVSLIFIXES Saploasuvipdy vulsp1ydoz1yrIg
L'0 9°0 ‘0 CK vl LI ad seo0BqnOIeWIS SaploissonDd DUSDADIg
80 9°0 0°0 One a A SeIOFT[OQU() SINnpa DIjasuy
9'[ €°7 OI Taal ad avo0eplioqgiog SISUBANUID S1LOGIOT
Q°7 as Cl Gal IT 9 oeooessoidny appuoy “eA vJvAqvjop sisdo[ny |
ICG 6 0°0 0°0 IG a d oeooRNIOg DIDP1OD SNUIAIDD
Onl 70 v0 NG IC G |! d ovooRIpleovuy onsiquin snyYy
v0 9'Y Gal ad seo0esey DIDJUuap SNI1ENO
€'0 61 0°0 el d seSOUIUINSS T DIDGO] DIADAING
[ale GO a0) 0°0 60 vil d ovooer[ojlide) MJYZ1IM WINUANGIA
67 Gu 0°0 0°0 vl d ovoorr[ojlide) uinjooinf WnuANg1A
8°C I's 60 9°0 VT d oeooeleqezipse’] DIDIOfIA] DIGAYW
07% 9'[ 87 6°€ Sali 19) oeoovlodA, DUISSISOIOL ‘Dd 2% vdivrlspYydajq XadDD
60 SiC IG 9°7 9°T d seas Tquip) DUIIAIDI BjjauiduidoLinds
a 8S call 0°? d seo0eSOY pyofsiujo snqsog
07? 4 9°0 LAS 0'C S A oeooell] DUIYD XDIIWS
Lit 16 © O) 0°0 YC S*T A se LOFTT[OQu() DUISIN DIjasuy
eV 9°| 9°9 el LY €°0 Q°7 V‘'L‘TI d avooesey pindsisd “dss vI1JOsUuOW SNI1ENCE
70 £0 8°8 68 lv G | W) te Id ‘S “T A sesodwoy) DUDJUOU DISIWA}AV
6 CI See oT 0°? 1? 8 vv eae | d SBINB IOV wunquodvf 1090 y
6'L 6TI OL oY 1 rae seoovISULTV WNGOjid] “eA winyofiunjojd wnisunjpy
70 70 6'0 ULI CT esa ad IBIDCIONV UNJDAOULIDUL *¥ OUOW ABI
cml 9°¢ vCI vy | Sv th eal d seooR[ejUeS pinjoaouD] vAajyong
0'0T C8 10 Te 0°8 ES i a d oeooellL pauodol vii
[L(G a6 | 10 €°0 IL, 69 lew d oeoovIne T padpubiquiaul “dss pjojyjaquin D1apulT
CGE L’87 10 v0 9°9 Laid ad seooRpI[OWIeUIe YY pvsnjqgo “red pI1UOodvs sjawmDwoy
v) 6 Call 10 9°ST 69 nea d ovoorl[ojlided UNjoIo/Ip UNUANGLA
10 9°0 8°81 vLI €91 10 L’8 L“T d SBIdBUOGIOA pnuodol pdivojjoD
Ol
Ee eae eee ee ee aa suse sure aioe
"SIT JUOSoId OY} UI UMOYS o1e
‘UOSB9S YO¥O UI Sofdods QZ do} oY} ore YOIYM ‘(Satdods Cy) JOIP MOJOS 91TJUS OY} JO Sotdads 9UO-A}XIS *(9661—-766I1) A POTOd pue (0861-8161) V POl9d UOseas Yove UI
‘ueder UIOYIIOU ‘e[NsUTUSg BITYOUIIYS dy} UO (SNAS119 SIUJOIIIADD) MOIS BsoURAEL 9} JO S911 PoAIOsqo Jo sofoudnbosyJ o3e}Ud0I0d oY} pue solseds pooy °7 xipueddy
WS
L'66
€°0
Mammal Study 24 (1999)
c0
v0
cl
00
CC
6L8°€
V 66
0)
c°0
v0
0)
II
‘uI00®e FY ‘JINIF ‘I SIOMOP ‘TA ‘Woys “S Spng YIM 3IM) ‘YL ‘Jeo] “7 :,,, Uae eg
"9911 SNOIOJIUOS UIdIBIIAO ‘D *qio ‘4 :(Safoods SUIA xIS BUIPNIOUI) 991] PaAva[-peOlq snonpldep ‘q :,,WIOJ JIT]
Sd}Iq PdAIOSqO JO ‘ON
[e1OL
O7L‘T 899° LOS‘€ I8Z‘Z 989 OT
1°S6 vS6 8°€6 9°S6 0°96
0°0 af d avoor[niog
10 Le poll ral ale l)(6)
G)| 0°0 10 7 ad ovoorl[ely
£0 10 a ) SBOOVIPOXP I,
Vv 10 Sea | d avoovuosA[Od
Gal 0°0 0°0 10 S‘T d de908OI}I()
9°0 m0) 10 70 Lea al IedDRIOW
IO 70 Te ad ae90e3e J
10 0'T €°0 I d ovooeUW)
Oe €°0 S17 dA oeSOUIUINSST
c0 0°0 VT v0 al d oeooejnounuey
€°0 0) v0 OT v0 Wd ‘S “7 d aeaoeplioqiog
10 Cl v0 a | 4d ovoovjnuedures)
9°0 ima 0°0 v0 T d sevooelfojlided
61 10 8°0 10 v0 ld ‘S “7 d seyIsoduioD
8 0°0 a0) al d ovooel[ely
c0 8°C 10 0) S°T A avoovIqny
v0 S|! 70 0) T ad BOORIIA
7 10 a0) I d svooe Ny
Lit 50 9°0 v0 50 ld ‘S “1 d selisoduio0p
0) v0 [| 10 C0 S ‘TIT A ae}Isoduiod
£0 °C 9°0 Iq “7 d avooRl[eIV
60 v'T 8°0 GO 9°0 I ‘S “7 d oesodwio)
£0 cil Vl 70 9°0 1 al SBOORIPIUIOV
cl EG €°0 9°0 IT d oea0Rsoy
a0) 9°0 nO | d aea0eI1O
a0) 01 61 £0 L‘0 S“T dA aeyIsodurosy
¢'0 VT 70 L‘0 T ral oeSOUIUINSST
@ POled V polled q POled V polled V polled V polled x,U9}e9 =, UOJ sureu ATU
IUIN, UUININyY UuUNINY IowWNg sulIdg § [e10] wed osIT :
OVUM,
102
(ponutjuod)
‘7 xipuoddy
DIIMIGIS “eA DINSALY SNULY
NYSOUOYIS] WINAJSNS1T
DIDJa DIDAY
pauodol pisauojdasD
NBIAQUNY] DIADIISIAg
SLUJSAA[AS DidaWYy20g
SIJDAJSND SNAOP
DIDUadD SN&DI
DIMIUIID] SnU A
suadad WnOfis]
SUDIS SIJDUAID
wnuvaloy winipauidy”
DAOYIJOWad DAOYdOUepy
NMOJIOUL DLBIIUOT
DI1JDISD “eA DAANDSAIA OSDP1]OS
supaouul xpuvdo1poaq
DIDAOPO DinJedsy
Didydosajay ‘eA DsOjnpuDnjs sisdojadup
wnjidadid wnjcAxoyJuvZ
DINDYISJUDY “IEA DIDINILAND D1jDIDD
snaiuodofl sajisvjad
snjaid xpundojvoy
‘ds wnisuld
DINBAD DIPIU1JIV
SNIJOfIZAD]DII SNGNY
DIDAAAS *} DSOUISNUY] SNUIXDAT
DUDAYSIAY VISIWALAY
40j0I1q vzapadsa'T
sorseds
Mammal Study 24: 103-113 (1999)
© the Mammalogical Society of Japan
Synaptonemal complex analyses in the XY chromosomes of six
taxa of Clethrionomys and Eothenomys from Japan
Masahiro A. Iwasa!, Yoshitaka Obara’, Eiji Kitahara> and Yoshiyuki Kimura‘
1,2Department of Biofunctional Science, Faculty of Agriculture and Life Science, Hirosaki University,
Bunkyo-cho, Hirosaki 036-8561, Japan
3Forestry and Forest Products Research Institute, Ibaraki 305-8687, Japan
4Faculty of Education, Fukushima University, Fukushima 960-1296, Japan
Abstract. The XY chromosomes of bone marrow metaphases and the XY-synapses of
pachytene spermatocytes of six taxa of Clethrionomys and Eothenomys from Japan were
examined using C-banding and surface-spreading techniques. Light, and electron, microscopy
revealed that in the red-backed vole, the XY size ratios of the metaphase sex chromosomes
and the SC-axes of pachytene XY-synapses show a similar pattern of variation. The X
chromosomes of these vole taxa were classified, on the basis of their size and morphology, as
one of two types, that is they were either acrocentric or sub-telocentric. Similarly, two types
of Y chromosome, small and medium, were recorded. According to these criteria, C.
rufocanus, C. rutilus and Eothenomys andersoni carry an acrocentric X chromosome and
a small Y chromosome, whereas the two local forms of EF. smithii, the so-called “smithii-
type” and “kageus-type”, carry a subtelocentric X chromosome and a medium Y chromo-
some. In contrast to these XY combinations, E. imaizumii showed a composite combina-
tion, with a subtelocentric X chromosome and a small Y chromosome. In view of earlier
findings on the genetic background of E. imaizumii (Suzuki 1994; Suzuki et al. 1999), such
a composite combination of the sex chromosomes suggests that E. imaizumii may have
inherited an X chromosome from a female E. smithii and a Y chromosome from a male
E. andersoni during the course of speciation through hybridisation.
Key words: red-backed voles, synaptonemal complex, X chromosome, Y chromosome.
In general, red-backed voles (Clethrionomys and Eothenomys) are karyologically conserva-
tive irrespective of their domestic and continental distribution and show very close karyotypic
similarity (Rausch and Rausch 1975; Tsuchiya 1981; Obara and Yoshida 1985; Obara 1986;
Modi 1987; Ando et al. 1988; Kashiwabara and Onoyama 1988; Modi and Gamperl 1989;
Yoshida et al. 1989; Ando et al. 1991). Both diploid number and autosomal fundamental
number were essentially 56 in all of the species examined. Interspecific chromosome varia-
tion of these voles is found only in the sex chromosomes (Tsuchiya 1981; Yoshida et al. 1989;
'Present address: Laboratory of Ecology and Genetics, Graduate School of Environmental Earth Science, Hokkaido
University, Sapporo 060-0810, Japan
To whom correspondence should be addressed: E-mail: yobara@cc.hirosaki-u.ac.jp
104 Mammal Study 24 (1999)
Ando et al. 1991; Kitahara and Harada 1996; Iwasa 1998), except for one case of a 1-9
translocation in a lineage containing C. glareolus, C. rutilus, C. gapperi and C. californicus
(Gamperl 1982; Modi and Gamperl 1989; Obara et al. 1995). Such interspecific variation of
the sex chromosomes is unclear among these voles and the synaptonemal complex (SC)
analysis at the electron microscopic level, as well as a detailed chromosome banding analysis
at the light microscopic level, may be necessary to clearly define interspecific variations of the
sex chromosomes of this group.
Suzuki (1994) and Suzuki et al. (1999) found, based on the RFLP (restriction fragment
length polymorphism) analysis of the rDNA spacer region, that E. imaizumii carries two
types of rDNA in about equal amounts in its genome, one the E. andersoni type and the
other the E. smithii type. This mixture indicates that perhaps this species is of hybrid
origin involving both E. andersoni and E. smithii. In addition, Kitahara and his colleague
examined in detail the taxonomic allocation of three local populations of Anderson’s red-
backed voles andersoni, niigatae and imaizumii on the basis of morphological and develop-
mental analyses and crossbreeding experiments, and concluded that these three taxa belong to
one species E. andersoni, and that “imaizumii’ is phylogenetically closer to E. smithii than it
is to C. rufocanus (Kitahara 1995a, 1995b; Kitahara and Kimura 1995). In view of these
findings, it would appear that “imaizumii’ is closely related, genetically as well as morpho-
logically, to both E. andersoni and E. smithii.
In order to test this view from a cytogenetic standpoint, we describe an analysis of X
and Y chromosomes in mitotic metaphase and the SC configurations of XY-synapses in
meiotic prophase from six taxa of Clethrionomys and Eothenomys from Japan, paying
special attention to the XY combination of E. imaizumii.
Materials and methods
Animals
In total, 36 male specimens of two Clethrionomys species, C. rufocanus (Crf) and C.
rutilus (Crt), and three Eothenomys species, E. andersoni (Ean), E. smithii and E. imaizumii
(Eim) were used in this study. Smith’s red-backed vole, E. smithii, consists of two geo-
graphical forms, the “smithii-type” (Esm) distributed west of the Chubu district, and the
“kageus-type’ and Ekg), distributed east of the Chubu districts (see Table 1 for a summary
of the collecting details).
Species were identified on the basis of the salient angle pattern of the third upper molars,
following Kaneko (1994). Although Kaneko (1994) and Kitahara and Kimura (1995)
regarded Eim and Ean to be conspecific, the “andersoni’ population from the Kii Peninsula
has been dealt with here as a distinct species, E. imaizumii, following Jameson (1961),
Imaizumi (1988), and the Japanese Environmental Agency (1993).
Somatic chromosome analysis
Somatic chromosomes were obtained from the bone marrow cells of femurs, using the
short-term culture method (Obara 1982). After 30 min colchicine treatment (0.03 ug/ml
at the final concentration) in TC199 medium supplemented with 15% calf serum, the cells
were incubated in 0.075 M KCI solution at 37°C for 18 min. The cells were spread on
glass slides and air-dried under moist conditions after being fixed with Carnoy’s fixative
Iwasa et al., XY chromosomes of Clethrionomys and Eothenomys 105
Table 1. Species of Japanese red-backed voles examined in this study.
Species Collecting locality Specimen’s No.
Clethrionomys rufocanus Oiwake, Hokkaido 94Crf-1; 95Crf-3
Onnetoh, Ashoro, Hokkaido 94Crf-1; 95Crf-1, 2
Clethrionomys rutilus Shunkunitai, Nemuro, Hokkaido 94Crt-1, 2, 6, 9, 14, 15
Bunsen, Rikubetsu, Hokkaido 94Crt-21
Onnetoh, Ashoro, Hokkaido 94Crt-23, 24
Abiragawa, Tomakomai, Hokkaido 95Crt-2, 5
Chitose, Hokkaido 95Crt-4
Eothenomys andersoni Zatoh-ishi, Hirosaki, Aomori Pref. 94Fan-4, 6, 8; 95Ean-1
Tennohzawa, Hirosaki, Aomori Pref. 95Ean-2, 4
Mt. Iwaki, Iwaki, Aomori Pref. 95Ean-3
Eothenomys smithii Kamikumeda, Matsuoka, Fukui Pref. 94Esm-1, 3, 6; 95Esm-5
Matogawa, Matsuoka, Fukui Pref. 94Esm-2
Eiheiji, Eiheiji, Fukui Pref. 95Esm-1
Kotakakura, Ohtama, Fukushima Pref. 94Ekg-4, 5; 95Ekg-1
Eothenomys imaizumii Owase, Mie Pref. 95Eim-1, 2, 3
(methanol : acetic acid=3:1). Air-dried chromosomes were differentially stained for C-
banding, following Sumner’s (1972) BSG method. From 15-40 cells from each species of
voles were examined, and the relative lengths of their X and Y chromosomes and the XY
ratio were analysed.
Synaptonemal complex analysis
Synaptonemal complex (SC) preparations of the spermatocytes were made from
testicular materials taken from adult males following the slightly modified methods of Moses
(1977) and Greenbaum et al. (1986). The SC and unsynapsed axes of XY-synapses were
stained following Howell and Black’s (1980) one-step method. The silver-stained prepara-
tions were observed with transmission electron microscopes (Nippon Denshi JEM-1210 80 kV
and Hitachi H-600 75 kV), and photographed in order to measure the actual length of SC
plus the unsynapsed axis (SC-axis). Measurement of the length of the XY-synapses were
made using the IP Lab Spectrum program (Signal Analytic Corporation) after scanning
the SC-axis with an image scanner (EPSON GT-8500). From 12 to 36 SC-axes were studied,
and their absolute lengths, mean lengths and standard errors for the full pachytene stages
(including early-, mid- and late-pachytene substages; subdivided according to Greenbaum
et al. (1986)), were analysed statistically.
Results
The autosomes of the red-backed voles examined, with the exception of Crt which is
characterised by 1-9 translocations (Modi and Gamperl 1989; Obara et al. 1995), showed no
interspecific variation in their G-banding pattern, confirming the earlier reports of Obara and
Yoshida (1985) Ando et al. (1988), Yoshida et al. (1989), Ando et al. (1991), and Kitahara
and Harada (1996).
The X chromosomes of these voles were classified as either acrocentric (Crf, Crt and
Ean) or subtelocentric (Esm, Ekg and Eim), while the Y chromosomes were defined as
106 Mammal Study 24 (1999)
Conv.
.
XY XY XY XY XY
Crf Crt Ean Esm_ Ekg’ Eim
Fig. 1. Conventionally-stained (upper) and C-banded (lower) XY chromosomes from the bone marrow metaphases
of the red-backed voles examined. Crf=C. rufocanus; Crt=C. rutilus; Ean=E. andersoni; Esm=E. smithii
(smithii-type); Ekg=E. smithii (kageus-type); Eim=E. imaizumii.
“small” (Crf, Crt, Ean and Eim) or “medium” (Esm and Ekg) (see Fig. 1). The subtelo-
centric type X chromosomes were relatively longer than the acrocentric types, and the short
arm seemed to be euchromatic on the basis of its negative C-band staining properties (Fig. 1).
A deeply stained centromeric C-band was observed in both types. The “small” Y chromo-
some, varied in morphology (acro-, submeta- and metacentric) among the various vole
species, but had a centromeric C-band in all taxa examined. The remaining interstitial and
terminal areas of the “small” Y chromosome were C-stained less darkly than the centromeric
C-band. In Crt, the Y chromosome was deeply C-stained along its entire length. The
“medium” Y chromosome was subtelocentric, and deeply C-stained from the centromeric to
the proximal area (Esm and Ekg) of its long arm. Crf, Crt and Ean carried an acrocentric X
chromosome and a small Y chromosome, whereas Esm and Ekg both carried a subtelocentric
X chromosome and a medium Y chromosome. Unlike these XY combinations, the sex
chromosomes of Eim were composed of a subtelocentric X chromosome and a small Y
chromosome. The X chromosome of Eim seemed to be slightly longer in its short arm when
compared with that of Esm and Ekg, and was the longest X chromosome among the six vole
taxa examined. The Y chromosome of Eim was closer in length to that of Ean than that
of Crf and Crt. The mean XY ratios in the bone marrow metaphases of Crf, Crt, Ean,
Esm, Ekg and Eim were 0.25, 0.22, 0.27, 0.43, 0.46 and 0.26, respectively. It is unclear
whether such variations in the length and ratio of the XY chromosomes are significant since
chromosome condensation is variable.
Actual measurements of surface-spread XY-synapses in full pachytene may provide more
reliable information about chromosomal length. In general, autosomal pachytene SCs are
formed along the entire length of the corresponding autosomal homologues. Thus, the
length of a given autosomal pachytene SC reflects that of the corresponding autosome in
pachytene. However, in a surface-spread XY-synapsis, SC is usually only partially formed,
between a small region of the X chromosome and a small region of the Y chromosome, as
Iwasa et al., XY chromosomes of Clethrionomys and Eothenomys 107
Fig. 2. C-banded metaphase I plate in a spermatocyte of E. andersoni. Arrow indicates association between
centromeric end of the X chromosome and one end of the Y chromosome. Bar=5 wm.
suggested from a typical example of a C-banded XY bivalent in the MI stage of Ean (Fig. 2).
The remaining unsynapsed areas form rather knobby axes (X- and Y-axes), as in most
mammalian species reported so far (Moses 1977; Solari and Rahn 1985; Schmid et al. 1987;
Sudman and Greenbaum 1990; Villagomez 1993; Ashley and Fredga 1994; Iwasa and Obara
1995). A full set of SC configurations of a surface-spread pachytene spermatocyte from Ean
is shown in Fig. 3a, and typical examples of XY-synapsis in pachytene from the six taxa
examined are shown in Fig. 3b-3g. In Esm and Ekg, the Y chromosome synapses with
the X chromosome along less than one fifth of its entire length, and forms the SC in the
synapsing area, whereas in the remaining four species the SC forms along almost half of the
entire length. The long X-axis often turns round, crosses over itself (Fig. 3c, d, f and g),
and sometimes forms an end-to-end association with a terminal end of the Y-axis (Fig. 3e).
The statistical results of axes measurements are shown in Fig. 4. As in the metaphase
chromosomes, the length of the SC-axis of the X chromosome (SC-axis (X)) in the XY-
synapsis was distributed in two distinct groups, small and large: 16.07 +0.56 um~17.11+0.78
um (Crf, Crt and Ean) and 18.50+0.55 wm~20.10+0.64 wm (Esm, Ekg and Eim). The
SC-axis length of the Y chromosome (SC-axis (Y)) also occurred in small and medium
groups: 3.62+0.15 wm~5.13+0.17 wm (Crf, Crt, Ean and Eim) and 7.93 +0.46~9.20+0.86
um (Esm and Ekg). Thus, Crf, Crt and Ean carry small XY chromosomes, whereas Esm
and Ekg carry medium or large XY chromosomes. In contrast, the XY-synapsis of Eim was
composed of a large X chromosomes and a small Y chromosome. The mean XY ratios of
the SC-axis in the pachytene spermatocytes of Crf, Crt, Ean, Esm, Ekg and Eim were 0.31,
0.21, 0.26, 0.43, 0.48 and 0.26, respectively, roughly matching the mean XY ratios in the
bone marrow metaphases.
108 Mammal Study 24 (1999)
Ne
Fig. 3. Electron micrographs of a surface-spread pachytene spermatocyte of E. andersoni (a) and magnified XY
configurations (b—g) in the pachytene spermatocytes of the red-backed voles examined. The arrow indicates the
XY-synapsis and arrowheads indicate SC regions. X and Y show X- and Y-axes. b=C. rufocanus; c=C. rutilus;
d=E. andersoni; e=E. smithii (smithii-type); f=E. smithii (kageus-type); g=E. imaizumii. Bar=2 um.
Discussion
The mitotic chromosomes of the red-backed voles examined were quite conservative in
their autosomes, with the exception of 1-9 translocations in Crt, whereas the sex chromo-
somes generally showed interspecific variations in both the size and the morphology of the
X and Y chromosomes, as in other species in this group (Rausch and Rausch 1975; Nadler et
al. 1976; Modi 1987; Kashiwabara and Onoyama 1988; Modi and Gamperl 1989; Yoshida
et al. 1989). In such an autosomally conservative group, the sex chromosome morphology,
therefore, is the only marker that distinguishes between the species chromosomally. These
findings indicate that the two vole genera, Clethrionomys and Eothenomys, are phylogeneti-
cally close to each other. Furthermore, the G-banding patterns of the long arms of the
X chromosomes of these voles showed good accordance with each other (Obara 1986;
Tsuchiya et al. 1986; Ando et al. 1988; Modi and Gamperl 1989; Yoshida et al. 1989; Obara
Iwasa et al., XY chromosomes of Clethrionomys and Eothenomys 109
Esm
Eim
a a a
2 4 6 8 10 12 14 16 18 20
Length of SC-axis (um)
Fig. 4. Actual lengths of SC-axes (X and Y) in the surface-spread pachytene spermatocytes of the red-backed voles
examined. Thick and thin lines indicate mean length and standard error, respectively.
et al. 1995; Kitahara and Harada 1996), therefore, it is considered that the difference of the
X chromosomal morphology among these voles might have arisen as a result of the presence
or absence of the short arm. Thus, the morphological differences between the subtelo-
and acrocentric X chromosomes seem to have been formed through minor chromosomal
rearrangements, such as the addition or deletion of the short arm segment. In this context,
Kitahara and Kimura (1995) crossbred Anderson’s red-backed voles (Eim) from the Ki
Peninsula with Anderson’s red-backed voles (Ean and E. niigatae; formerly Clethrionomys
andersoni and C. niigatae) from Fukushima and Nagano Prefecture, obtaining fertile hybrids
in either combination, and concluded, supporting Aimi’s (1980) opinion that Eim, Ean and
E. niigatae are all conspecific. Although their crossbreeding experiments were reliable and
significant, our chromosome and SC analyses revealed that Eim is apparently different from
Ean in the size and morphology of the X chromosome, suggesting no genetic interchange
between Eim and Ean. In fact, Eim which inhabits the restricted area of the Kii Peninsula
has been geographically isolated from Ean, which ranges from the Chubu to the Tohoku
districts. It remains unknown whether Eim and Ean are able to produce fertile hybrids in
the wild.
In the Chinese hamster Cricetulus griseus, there is a 1:1 relationship between the
relative lengths of autosomal SCs and mitotic autosomes. The unpaired X- and Y-axes of
pachytene spermatocytes shorten and lengthen, however, not necessarily matching in relative
lengths the sex chromosomes of bone marrow metaphases, though the SC portion of XY-
Synapsis is constant in length through most of the pachytene (Moses et al. 1977). This
phenomenon is believed to be caused by the presence of a high amount of C-heterochromatin
contained in the X and Y chromosomes. In all the vole species examined here, the X
chromosome had a small amount of C-heterochromatin, which is detected as a centromeric
110 Mammal Study 24 (1999)
C-band, and the Y chromosome had a deeply stained centromeric-to-proximal C-band and
a Slightly lighter whole arm C-heterochromatin. If this view is correct, the variation in
length of the X- and Y-axes of pachytene spermatocytes should be small in vole species,
and therefore the XY-ratio of the SC-axis in pachytene should also be close to that of the
sex chromosomes during metaphase. This relationship seems to be roughly compatible in
all vole taxa examined. Thus, there may be a close relation, at least in the vole species
examined, between the XY-ratios in pachytene spermatocytes and those in bone marrow
metaphases. Moreover, the XY-synaptic regions of Crf, Crt, Ean and Eim were longer
than those of Ekg and Esm (Figs. 3b-g). The differences in the synaptic conditions among
these vole taxa may be have arisen naturally at the pairing region of the Y chromosome.
Thus, it is considered that the differences in synaptic lengths between X and Y axes among
the various combinations of the XY chromosomes (such as acrocentric X-small Y, sub-
telocentric X-small Y, and subtelocentric X-medium Y), lead to that synaptic property
dependent on the nature of the segment in the synaptic region of the Y chromosomes.
Our chromosome and SC analyses clearly demonstrate that three vole species Crf, Crt
and Ean have an acrocentric X -small Y combination (a small XY chromosome type) and
two geographic forms Esm and Ekg have a subtelocentric X - medium Y combination (a
large-medium type of XY) (Figs. 1 and 4). Of significance is the finding that the sex
chromosomes of Eim were composed of a subtelocentric type X and a small type Y (a
composite type of XY) (Figs. 1 and 4). In the light of these findings, Eim shares the X
chromosome with the Esm - Ekg group, yet shares the Y chromosome with the Crf - Crt -
Ean group. Therefore, it is tempting to consider that the X chromosome of Eim may have
originated from the Esm - Ekg group and the Y chromosome from the Crf - Crt - Ean group.
No significant difference in length of the SC-axis (X) was found among Esm, Ekg and Eim,
whereas the SC-axis (Y) of Eim was statistically different in length from that of Ean, but not
from that of Crf (P<0.05). So, the data from the XY-synapsis may suggest inheritance of
the X chromosome from either Esm or Ekg, and the Y chromosome from Crf. However,
the latter species has been isolated in Hokkaido, thus having been widely separated from the
Kii population, and similarly Ekg is distributed east of the Chubu districts. Taking such
geographic distribution into consideration, it is most likely that the X and Y chromosomes
of Eim has been inherited, through speciation by hybrid formation, from Esm and Ean,
respectively, even though inequality of the SC-axis (Y) between Eim and Ean still leaves
much to be explained.
Recently, Suzuki (1994) and Suzuki et al. (1999) studied the rDNA of several vole species
including Eim by RFLP analysis, and found two types of rDNA, or Ean type and Esm - Ekg
type in its genome in equal proportions. Based on their molecular findings they proposed
that the ancestral form of Eim (probable Ean-type) had been distributed on the Kii Peninsula
and that genetic interchange has occurred recently between Esm- Ekg and the ancestral
form. Our evolutionary scenario of Japanese red-backed voles, in particular for Eim, sug-
gests that Eim might be derived from hybridization between the ancestors of Ean and Esm on
the basis of molecular phylogenetic findings (Suzuki 1994; Suzuki et al. 1999), and present
data on the sex chromosome constitution of Eim is well compatible with these molecular
viewpoints. Furthermore, the Y chromosomes of Crf, Crt, Ean and Eim are cytogenetically
quite similar, on the basis of morphological and differential staining criteria (Tsuchiya 1981;
Obara 1986; Tsuchiya et al. 1986; Ando et al. 1988; Yoshida et al. 1989; Obara et al. 1995;
Iwasa et al., XY chromosomes of Clethrionomys and Eothenomys 111
Kitahara and Harada 1996) because the Y chromosomes of Ekg and Esm were more
differentiated from the cytogenetic aspect in the voles (Yoshida et al. 1989; Hielscher et al.
1992; Iwasa and Tsuchiya unpublished data) including related species. From cytogenetic and
other phylogenetic aspects, small Y chromosomes might occur through minor chromosomal
rearrangements such as inversion, however, medium Y chromosomes carrying partially
heterochromatic segments might be derived from more confused rearrangement than small
ones. Further research focussing on the sex chromosome-linked genes such as Sry may
provide a way of disclosing this issue.
Acknowledgements: The authors wish to express their gratitude to the late Emeritus
Professor Dr. K. Saitoh of Hirosaki University, and Dr. H. Suzuki of Hokkaido University,
for their advice and expert criticism. We are also grateful to Dr. Oscar G. Ward, Associate
Professor Emeritus of the University of Arizona, for reading and refining the original
manuscript and for his expert criticism. We thank Dr. M. Brazil for improving the English
manuscript. Special thanks are also due to Dr. K. Nakata of Hokkaido Forestry Research
Institute, Dr. N. Takada of Fukui Medical College, Messrs. K. Saigusa, R. Hatano, S.
Kawada, T. Yoshida, R. Yamamoto and F. Ishiguro, and Miss H. Shichiri for their kind
co-operation in collecting the vole specimens.
References
Aimi, M. 1980. A revised classification of the Japanese red-backed voles. Memoirs of the Faculty of Science, Kyoto
University, Series of Biology 8: 35-84.
Ando, A., Shiraishi, S., Harada, M. and Uchida, T. A. 1988. A karyological study of two intraspecific taxa in
Japanese Eothenomys (Mammalia: Rodentia). Journal of the Mammalogical Society of Japan 13: 93-104.
Ando, A., Harada, M., Shiraishi, S. and Uchida, T. A. 1991. Variation of the X chromosome in the Smith’s red-
backed vole Eothenomys smithii. Journal of the Mammalogical Society of Japan 15: 83-90.
Ashley, T. and Fredga, K. 1994. The curious normality of the synaptic association between the sex chromosomes of
two arvicoline rodents: Microtus oeconomus and Clethrionomys glareolus. Hereditas 120: 105-111.
Gamperl, R. 1982. Chromosomal evolution in the genus Clethrionomys. Genetica 57: 193-197.
Greenbaum, I. F., Hale, D. W. and Fuxa, K. P. 1986. The mechanism of autosomal synapsis and the substaging of
zygonema and pachynema from deer mouse spermatocytes. Chromosoma 93: 203-212.
Hielscher, K., Stubbe, A., Zernahle, K. and Samjaa, R. 1992. Karyotypes and systematics of Asian high-mountain
voles, genus Alticola (Rodentia, Arvicolinae). Cytogenetics and Cell Genetics 59: 307-310.
Howell, W. M. and Black, D. A. 1980. Controlled silver-staining of nucleolus organizer regions with a protective
colloidal developer: a 1-step method. Experientia 36: 1014-1015.
Imaizumi, Y. 1988. A World List of Mammals with Japanese Names. 980 pp., Heibonsha, Tokyo (in Japanese).
Iwasa, M. A. 1998. Chromosomal and molecular variations in red-backed voles. Honyurui Kagaku [Mammalian
Science] 38: 145-158 (in Japanese with English abstract).
Iwasa, M. and Obara, Y. 1995. Presence of XY-synapsis in the Japanese grass vole, Microtus montebelli (Rodentia;
Microtinae). Chromosome Information Service 59: 21-23.
Jameson, E. W. Jr. 1961. Relationships of the red-backed voles of Japan. Pacific Science 15: 594-604.
Japanese Environmental Agency. 1993. A list of Japanese wild animals: Vertebrates. Japan Wildlife Research
Center, Tokyo, Japan (in Japanese).
Kaneko, Y. 1994. Muridae. In A Pictorial Guide to the Mammals of Japan (H. Abe ed.). Pp. 90-109 and 168-183.
Tokai Univ. Press, Tokyo (in Japanese).
Kashiwabara, S. and Onoyama, K. 1988. Karyotypes and G-banding patterns of the red-backed voles,
Clethrionomys montanus and C. rufocanus bedfordiae (Rodentia, Microtinae). Journal of the Mammalogical
Society of Japan 13: 33-41.
112 Mammal Study 24 (1999)
Kitahara, E. 1995a. Taxonomic status of Anderson’s red-backed vole on the Kii Peninsula, Japan, based on skull
and dental characters. Journal of the Mammalogical Society of Japan 20: 9-28.
Kitahara, E. 1995b. Growth and development of captive Anderson’s red-backed voles from the Kii Peninsula.
Journal of the Mammalogical Society of Japan 20: 29-42.
Kitahara, E. and Harada, M. 1996. Karyological identity of Anderson’s red-backed voles from the Kii peninsula
and central Honshu in Japan. Bulletin of the Forestry and Forest Products Research Institute No. 370: 21-30.
Kitahara, E. and Kimura, Y. 1995. Taxonomic reexamination among three local populations of Anderson’s red-
backed voles from crossbreeding experiments. Journal of the Mammalogical Society of Japan 20: 43-49.
Modi, W.S. 1987. Phylogenetic analyses of chromosomal banding patterns among the Nearctic Arvicolidae
(Mammalia: Rodentia). Systematic Zoology 36: 109-136.
Modi, W.S. and Gamperl, R. 1989. Chromosomal banding comparisons among American and European red-
backed mice, genus Clethrionomys. Zeitschrift fir Saugetierkunde 54: 141-152.
Moses, M. J. 1977. Synaptonemal complex karyotyping in spermatocytes of the Chinese hamster (Cricetulus
griseus). 1. Morphology of the autosomal complement in spread preparartions. Chromosoma 60: 99-125.
Moses, M. J., Slatton, G. H., Gambling, T. M. and Starmer, C. F. 1977. Synaptonemal complex karyotyping in
spermatocytes of the Chinese hamster (Cricetulus griseus). III. Quantitative evaluation. Chromosoma 60: 345—
315).
Nadler, C. F., Rausch, V.R., Lyapunova, E. A., Hoffmann, R.S. and Vorontsov, N.N. 1976. Chromosome
banding patterns of the Holarctic rodents, Clethrionomys rutilus and Microtus oeconomus. Zeitschrift ftir
Sdugetierkunde 41: 137-146.
Obara, Y. 1982. Comparative analysis of karyotypes in the Japanese mustelids, Mustela nivalis namiyei and M.
erminea nippon. Journal of the Mammalogical Society of Japan 9: 59-69.
Obara, Y. 1986. G-band homology between the Japanese red-backed vole, Clethrionomys a. andersoni and the gray
red-backed vole, C. rufocanus. Chromosome Information Service 40: 7-9.
Obara, Y. and Yoshida, I. 1985. A case of X-autosome translocation in the Japanese red-backed vole,
Clethrionomys andersoni andersoni. Chromosome Information Service 39: 3-5.
Obara, Y., Kusakabe, H., Miyakoshi, K. and Kawada, S. 1995. Revised karyotypes of the Japanese northern red-
backed vole, Clethrionomys rutilus mikado. Journal of the Mammalogical Society of Japan 20: 125-133.
Rausch, R. L. and Rausch, V. R. 1975. Relationships of the red-backed vole, Clethrionomys rutilus (PALLAS), in
North America: Karyotypes of the subspecies dawsoni and albiventer. Systematic Zoology 24: 163-170.
Schmid, M., Johannison, R., Haaf, T. and Neitzel, H. 1987. The chromosomes of Micromys minutus (Rodentia,
Murinae). II. Pairing pattern of X and Y chromosomes in meiotic prophase. Cytogenetics and Cell Genetics 45:
121-131.
Solari, A. J. and Rahn, M.I. 1985. Asymmetry and resolution of the synaptonemal complex in the XY pair of
Chinchilla laniger. Genetica 67: 63-71.
Sudman, P. D. and Greenbaum, I. F. 1990. Unequal crossing over and heterochromatin exchange in the X-Y
bivalents of the deer mouse, Peromyscus beatae. Chromosoma 99: 183-189.
Sumner, A. T. 1972. A simple technique for demonstrating centromeric heterochromatin. Experimental Cell
Research 75: 304-306.
Suzuki, H. 1994. Genetic diversity of ribosomal DNA: phylogenetic analysis of small mammals. Honyurui Kagaku
[Mammalian Science] 34: 67—79 (in Japanese with English abstract).
Suzuki, H., Iwasa, M., Harada, M., Wakana, S., Sakaizumi, M., Han, S.H., Kitahara, E., Kimura, Y.,
Kartavtseva, I. and Tsuchiya, K. 1999. Molecular phylogeny of red-backed voles in Far East Asia based on
variation in ribosomal and mitochondrial DNA. Journal of Mammalogy 80: 512-521.
Tsuchiya, K. 1981. On the chromosome variations in Japanese cricetid and murid rodents. Honyurui Kagaku
[Mammalian Science] 42: 51-58 (in Japanese).
Tsuchiya, K., Kimura, Y. and Minato, S. 1986. Comparison of cytogenetics in Japanese red-backed voles. In
Conservation and Rehabitation of Oze. Pp. 97-42. Fukushima Prefectural Project Report on the Conservation
of Special Plant Species and Their Habitats, Fukushima Prefecture (in Japanese).
Villagomez, D.A.F. 1993. Zygotene-pachytene substaging and synaptonemal complex karyotyping of boar
spermatocytes. Hereditas 118: 87-99.
Iwasa et al., XY chromosomes of Clethrionomys and Eothenomys 113
Yoshida, I., Obara, Y. and Matsuoka, N. 1989. Phylogenetic relationships among seven taxa of the Japanese
microtine voles revealed by karyological and biochemical techniques. Zoological Science 6: 409-420.
Received 30 June 1999. Accepted 5 November 1999.
Mammal Study 24: 115-119 (1999)
© the Mammalogical Society of Japan Short communication
A record of the food retention time of the Asiatic elephant,
Elephas maximus
Udayani R. Weerasinghe!, Palitha Jayasekara” and Seiki Takatsuki>
1Laboratory of Wildlife Biology, School of Agriculture and Life Sciences, The University of Tokyo,
Yayoi, Bunkyo-ku, 113-0032 Tokyo, Japan
2.3The University Museum, The University of Tokyo, Hongo 7-3-1, Bunkyo-ku, 113-0033 Tokyo, Japan
We carried out a brief feeding experiment in order to measure the food retention time of the
Asiatic elephant, Elephas maximus. For the experiment, a tame individual of the endemic
Sri Lankan subspecies, E. m. maximus, was used. Compared with the African elephant,
Loxodonta africana, the biology of the Asiatic elephant is poorly known, although there
have been classic studies on its physiology (Benedict 1936) and ecology (Sukumar 1989).
Because of economic development, the Sri Lankan elephant, whose present population
is estimated to be 3,000 or 4,000 (Santiapillai and Jackson 1990; Jayewardene 1994), is
confined in small areas. Because of their large body size, they sometimes heavily affect the
vegetation of their habitat. For the better management of the elephants and their habitat,
therefore, an understanding of the food-related biology of the Asiatic elephant is important.
Food retention time has been studied in both African (Bax and Sheldrick 1963; Rees
1982) and Asiatic elephants (Benedict 1936). However, previous studies have only shown the
elapsed time after intake to the first and last excretion of markers in the dung. During the
present study, based on the exact excretion pattern of two types of markers, we were able
to measure the elapsed time from the first intake to the first excretion, the time to peak of
excretion, the time to last excretion, and the mean retention time.
Materials and methods
A 48-year-old tame male elephant was used for the feeding experiment. Based on the
correlation between shoulder height and body weight of the Asiatic elephant (McKay 1973),
this individual, which stood 265 cm high at the shoulder, was estimated to weigh 3.8 tons.
The elephant was kept outside, and chained by his hind foot to a tree. Nearby ground-
covering vegetation was cleared away and known amounts of forage were given as food. He
was walked once a day to a pond, where he was able to drink water and bathe.
Benedict (1936) and Vancuylenberg (1977) both reported that an Asiatic elephant eats
about 150 kg of foods per day. On this basis, during the course of our experiment, from
19th to 26th May 1998, the tame elephant was fed 300 kg of fresh food at 15:00 everyday,
which should have been more than sufficient for its needs. This consisted of 150 kg of leaves
and twigs of Jak, Artocarpus heterophyllus; 100 kg of palm woods, Caryota urens; and 50 kg
of grasses, mainly Panicum maximum. On the second day of the experiment, a piece of
bread, inside which 1,000 plastic beads were hidden, was added to the daily ration. The
3To whom correspondence should be addressed. E-mail: taka@um.u-tokyo.ac.jp
116 Mammal Study 24 (1999)
beads were about 2mm in diameter and 3mm long. On the third day, five melons were
given as supplemental food as these contain many seeds. The melon seeds were flat and
spindle-shaped, measuring 4mm in width, 6mm long and 1 mm thick.
All of the elephant’s dung was collected at 08:00, 12:00 and 18:00. Each dropping was
weighed to the nearest gram using a kitchen balance. In addition, dung was collected as
frequently as possible, whenever the elephant was observed defecating. We sampled the
collected dung, breaking the droppings in order to count the number of seeds and beads they
contained. As most of the beads were found to have been completely or partly destroyed,
presumably by mastication, we counted only beads which maintained more than half of their
Original size, and ignored smaller portions. The weight contribution of the dung samples to
the total dung was 43.5%. After the peaks of the appearance of the two kinds of markers,
we extended the interval of fecal collection. As the intervals between dung collection were
not constant, but longest during the night, seed and bead numbers recovered from the sample
dung were converted to a total number according to dry weight, and then divided by the
time interval (hr) of collection. We assumed that the density of markers in dung during each
interval was constant.
The mean retention time (WRT) was calculated by the formulae:
MRT=>(Mx T)/=M
Where 7 is the length of time between dosing and excretion in the feces, and M is the total
amount of marker in that collection (Coombe and Kay 1965).
Results
The process of excretion of the dietary markers was expressed as a percentage of the
number of markers recovered at collections to the total number voided.
Melon seeds first appeared 14 hrs after ingestion, and quickly increased to reach a sharp
peak (40.1% of the total number of excreted seeds) at 18 hrs after ingestion (Fig. 1). The
seed numbers then decreased to 11.0%, and thereafter it gradually decreased until 48 hrs
after dosing. The last seed was found 72 hrs after ingestion, though the single seed was
found from over 5 kg of dung.
The pattern of the passage of beads was similar to that of passing melon seeds. The
beads first appeared in dung 17 hrs after ingestion, and rapidly increased to reach a peak at
25 hrs after ingestion. The peak, however, was not as sharp as found for melon seeds, and
the decrease following the peak was also more gradual (Fig. 1). The continuous voiding of
the beads continued up to 63 hrs after ingestion. Thereafter, no beads appeared for a while,
but then one bead appeared at 73 hrs after dosing when we ended the collection. The mean
retention time was calculated as 20.2 hrs for melon seeds and 29.7 hrs for beads.
A total of 311 beads were recovered. From the total weight of dung voided, it was
estimated that 714.9 beads (71.5%) appeared during the experiment, indicating that 28.5%
were destroyed during the digestion process, probably mainly during mastication.
Weerasinghe et al., Food retention time of elephant Ty
45
40
35 Fe © Melon seeds
4 ii e@ Beads
25 og
20
1.)
Number (%) / hr
Hours after ingestion
Fig. 1. Numbers of beads and melon seeds recovered from dung of an Asiatic elephant after ingestion. The
numbers are percentages of the total numbers recovered.
Discussion
Description of the experiment
As soon as food was provided at 15:00 each day, the elephant began to eat, and clearly
preferred the marker foods (the bread containing the beads, and the melons). During
the first hour he ate great amounts of food, and thereafter fed at a more leisurely pace
throughout the night (Somaratna personal communication). We did not see him eating in
the mornings when we resumed dung collection at 08:00, which suggests that he was satisfied
after feeding during the night. The average fresh weight (SD) of his daily intake was 123.8
(427.5) kg (Weerasinghe et al. unpubl.), which was similar to the amounts described in
previous studies (McKay 1973; Vancuylenberg 1977).
Markers
It is known that retention times are different among different foods (Rees 1982). In this
study, the bead markers appeared, and peaked, later than the melon seeds. The markers
differed in two ways. They differed firstly in their quality. Since the beads were made from
plastic, they were non-digestible despite having been heavily masticated and broken into
smaller pieces, and this may have contributed to them being passed more slowly than the
melon seeds. However, since we did not count the number of melon seeds in advance of the
feeding experiment, the differences in the digestibility between the two markers is not known.
Secondly, the difference in size and shape of the markers may have also affected their
passage. The flatter shape of the melon seeds, together with the jelly-like attachment
around them, may have facilitated their rapid passage, despite the fact that they were
slightly larger than the beads. Relative weight may also affect passage rates. It seems
possible that, because of their small size, if they were light, they would be passed to the
118 Mammal Study 24 (1999)
lower tracts with liquids faster than fibrous plant materials. However, we did not measure
the relative weights of the two markers.
Pattern of passage
Previous studies of through-put times for elephants have concentrated simply on show-
ing the first and the last appearance of dietary markers (Benedict 1936; Bax and Sheldrick
1963; Rees 1982). Benedict (1936) fed rubber pieces to an Asiatic elephant and determined
that the first and the last appearances were about 24 and 51 hrs after ingestion, respectively.
Bax and Sheldrick (1963) briefly mentioned that an African elephant excreted orange seeds
between 11 and 14 hrs after feeding and continued to produce them up to 19 hrs later. Rees
(1982) fed beetroot to an African elephant and found that passage took between 21 and 46
hrs. This study then, is the first that has examined the patterns of excretion of dietary
markers. The peaks of passage occurred between 17 and 25 hrs after ingestion.
The retention time of the Asiatic elephant seems to be shorter than ruminants, when
taking in to account their body size. The mean retention times of ungulates, which are much
smaller than elephants, were 15-30 hrs for sheep, Ovis aries (Coombe and Kay 1965), 20-40
hrs for the white-tailed deer, Odocoileus virginianus (Mautz 1971), 35-45 hrs for the goat,
Capra hircus (Castle 1956), and 70-90 hrs for cattle, Bos taurus (Balch 1950). Retention
time, or the rate of passage of food through the digestive tract, can be expected to depend
on the length of the digestive tract, and as ruminants have very long intestines, it is not
surprising, therefore, that their retention times are very long for their body sizes. Unfor-
tunately, no information is available on the length of the digestive tract of elephants. The
short retention time of the Asiatic elephant may result from it having a simple stomach, and
short intestines (Clements and Maloiy 1982). This simple digestive system seems to enable
the ingesta to pass through the tracts rapidly, though the African elephant at least has a
well-developed colon and caecum (Clements and Maloiy 1982). In contrast, ruminants have
complex stomachs where the ingesta are retained and fermented, and hence food is passed
very slowly through the alimentary canal.
Acknowledgements: We greatly appreciate the assistance of Mr. Samantha Ariyasinghe, the
owner of the elephant named Bande, in providing us with a chance to study Bande. Mr.
Somaratna, Bande’s mahout, contributed valuable information on elephant behavior, and
Mr. Shantha assisted us in collecting the droppings during our absences from the study site.
We deeply appreciate Dr. M. Brazil who kindly read and improved our earlier draft. This
study was partly supported by the Pro-Natura Foundation of the Nature Conservation
Society of Japan.
References
Balch, C. C. 1950. Factors affecting the utilization of food by dairy cows, 1. The rate of passage of food through
the digestive tract. British Journal of Nutrition 4: 361-388.
Bax, N. P. and Sheldrick, D. L. W. 1963. Some preliminary observation on the food of elephants in the Tsavo
Royal National Park (East) of Kenya. East African Wildlife Journal 1: 40-53.
Benedict, F. G. 1936. The Physiology of the Elephant. Publ. No. 474, Carnegie Institute, Washington, 302 pp.
Castle, E. J. 1956. The rate of passage of food stuffs through the alimentary tract of the goat, I. Studies on adult
Weerasinghe et al., Food retention time of elephant 119
animals fed on hay and concentrates. British Journal of Nutrition 10: 15-23.
Clements, E.T. and Maloiy, G.M.O. 1982. The digestive physiology of three East African herbivores: the
elephant, rhinoceros and hippopotamus. Journal of Zoology, London 198: 141-156.
Coombe, J. B. and Kay, R.N. B. 1965. Passage of digesta through the intestines of the sheep, retention times in
the small and large intestines. British Journal of Nutrition 19: 325-338.
Jayewardene, J. 1994. The Elephant in Sri Lanka. Colombo, 128 pp.
McKay, G. M. 1973. Behavior and ecology of the Asiatic elephant in southeastern Ceylon. Smithsonian Contribu-
tions to Zoology 125: 1-113.
Mautz, W. W. 1971. Comparison of the *!CrCl,; ratio and total collection techniques in digestibility studies with a
wild ruminant, white-tailed deer. Journal of Animal Science 32: 999-1002.
Rees, P. A. 1982. Gross assimilation efficiency and food passage time in the African elephant. African Journal of
Ecology 20: 193-198.
Santiapillai, C. and Jackson, P. 1990. The Asian Elephant: An Action Plan for Its Conservation. IUCN. (cited in
Jayewardene 1994)
Sukumar, R. 1989. The Asian Elephant — ecology and management. Cambridge University Press, Cambridge,
251 pp.
Vancuylenberg, B. W. B. 1977. Feeding behaviour of the Asiatic elephant in south-east Sri Lanka in relation to
conservation. Biological Conservation 12: 33-54.
Received 12 April 1999. Accepted 3 September 1999.
enti? rinse ;
a f
reine
Seral
ue ne)
Mammal Study 24: 121-124 (1999)
© the Mammalogical Society of Japan Short communication
Seasonal change in reproductive states of the Formosan squirrel
on Izu-Oshima Island, Japan
Noriko Tamura!
Tama Forest Science Garden, Forestry and Forest Products Research Institute, Todori 1833, Hachioji,
Tokyo 193-0843, Japan.
The Formosan squirrel, Callosciurus erythraeus thaiwanensis, was introduced to Japan and
now occurs in several areas of the country (Yamaguchi 1988; Kawamichi 1997). The breed-
ing season of this species has been investigated in Taiwan, ROC, where it is indigenous.
There, dissection of 100 females revealed that although they reproduce throughout the year
there are two peaks, from January to March, and again from May to August (T’sui et al.
1982). In Kamakura, Japan, where the same species has been introduced, mating behavior
has been observed throughout the year, but with two peaks, the first during March and April
and the second from July to September (Tamura et al. 1988). In captivity, the gestation
period of the Formosan squirrel is 47-49 days, and the young squirrels leave the nest 40-50
days after birth (Tamura and Terauchi 1994). On the basis of these captive studies, weaned
juveniles can be expected to appear in the wild during July and August, and during the
period from November to January. This expectation is borne out, with juveniles weighing
less than 200 g (just after weaning) being captured in live-traps most frequently during these
months (Tamura 1989).
Formosan squirrels have also been introduced to Izu-Oshima (3445'N, 139°22’E), an
island of approximately 9,100 ha south of Tokyo. Since their introduction there ca. 60
years ago they have increased rapidly and spread all over the island with the exception of the
unvegetated volcanic areas. Because the squirrels feed on Camellia seeds and other agri-
cultural products on the island, they are considered a pest and several hundreds individuals
have been killed each year since 1970. The reproductive strategy of Formosan squirrels on
Izu-Oshima has not previously been studied, so here I will present data on the breeding
cycle of this species on this island, which may prove helpful in controlling the population.
Methods
Squirrels shot as pests during the period from November 1996 to February 1997, from
May to October 1997, from February to April 1998, and from October to November 1998
were examined for this study. The squirrels had been shot at sites scattered across the
island, with the exception of the area around the crater of Mt. Mihara in the center of the
island, and the volcanic eastern part of the island. All specimens were sexed and weighed
immediately after shooting, then frozen and transported to the laboratory for analysis.
After subsequent thawing of the specimens, the snout-vent length of all females was
‘E-mail: haya@ffpri.afjrc.go.jp
122 Mammal Study 24 (1999)
measured, and the condition of the teats and vaginal opening were recorded. The teats were
defined as either projecting or not projecting, and used as an indication of whether females
were lactating or not. The stage of estrous was assessed on the basis of the color of the
vaginal opening. During the period 5-7 days before copulation the vaginal opening became
pink and swollen whereas most of the time it was small, inconspicuous, and gray in color.
More detailed analysis was made of the ovaries and uterine horns after they had been
dissected out. Ovaries were sectioned longitudinally and the stage of developmental of the
follicles was observed under a binocular microscope (x 80). Four stages of sexual maturity
were recorded using T’sui et al.’s (1982) criteria. These were: 1) mature (ovary with Graafian
follicles, and with projecting teats); 2) young mature (ovary with Graafian follicles, but
non-projecting teats); 3) subadult (ovary with several secondary solid follicles and a few
secondary vesicular follicles), and 4) immature (ovary with only primary follicles). The
number of fetuses found in the uterine horns was also recorded.
Results and discussion
Of the total of 190 females, 132 with projecting teats, indicating that they had ex-
perienced lactation, were defined as mature. The mean body weight of mature females was
376.5 g+29.6 (SD); range 320-440 g, n=132). The mean snout-vent length of the same
females was 21.06 cm=+0.88 (SD); range: 19.5-23.3 cm, n=132). Forty-three of the mature
females were carrying fetuses in their uterine horns.
The remaining 58 females examined had non-projecting teats, however, one of them
had fetuses in the uterus, and 10 of them had swollen vaginae, indicating that they were in
heat. As these 11 individuals all had Graafian follicles in their ovaries, they were defined as
young mature females. The mean body weight (+ SD) of these young mature females was
318.3 g+36.2 (range: 280-390 g, n=11), and their snout-vent length averaged 20.7 cm=+0.7
(range: 19.5-21.5 cm, n=11).
Seven females with non-projecting teats and vesicular follicles in their ovaries were
defined as subadults. They averaged 325.0g+22.9 (SD) (range: 300-360 g, n=7) and
measured 20.4 cm=+0.8 (SD) (range: 19.0-22.0 cm, n=7) from snout to vent.
The remaining 40 females with non-projecting teats, had no vesicular follicles in their
ovaries, so they were defined as immature. The mean body weight (+ SD) of these immature
Table 1. The reproductive state of female squirrels each month. Numerals in parentheses indicate the number of
females in estrous.
Reproductive
States Jan. Feb. Mar. Apr. May Jun. “Jul: Aus. “Sept Oct aNows = Dee:
Mature 4 De 9 Vf 4 2) 7 19 8 11 10 9
(0) (3) (0) (0) (0) (6) (3) (1) (1) (1) (0) (3)
Young mature 0 0 1 1 1 4 2, 0 0 1 1 0
(0) (0) (1) (1) (1) (3) (2) (0) (0) (0) (1) (0)
Subadult 0 0 0 0 0 0 0 1 0 1 3 2
Immature 4 2 4 4 3 5 3 6 1 2 4 2
Total 8 24 14 12 8 3) 12 26 9 13) 18 13
Tamura, Breeding season of the Formosan squirrel 123
10
60 1996
m 1997
% pregnant
Jan. eld, Juee, LN ores May Jun. Jul Aue Sep. Oct. 1 DECK
Month
Fig. 1. Seasonal changes in the percentage of pregnant females. Numerals above bars indicate sample sizes.
females was 298.8 g+ 42.2 g (range: 195-350 g, n=40), and they averaged 19.9 cm+1.3 (SD)
(range: 17.0-22.0 cm, n=40) from snout to vent.
There were no apparent seasonal changes in the proportion of squirrels in each of the
four reproductive states (Table 1). The proportion of immature females in relation to the
total number of females caught each month, showed no seasonal trend, and ranged from
8% to 50% with a mean of 23.6%. This proportion was similar to that found in Taiwan
(20.5%; T’sui et al. 1982). Although the sample size was small, females in estrous were
captured more frequently during February, June and July than in other months (Table 1).
A total of 44 females was found with pregnancies recorded in every month except
December. The pregnancy rate was highest during March to April and again from July to
October (Fig. 1). These seasonal trends in pregnancy rates were coincident with the number
of estrous females. The seasonal changes in the pregnancy rates observed on Izu-Oshima
were similar to those in Kamakura, Kanagawa Prefecture (Tamura 1989; estimated from the
dates litters were weaned). In Taiwan, however, pregnancies peaked during the period from
January to March, and also from May to August, two months earlier than on Izu-Oshima
and in Kamakura (T’sui et al. 1982).
Although the number of fetuses recorded ranged from one to four with a mean of
Table 2. The number of fetuses observed among 44 pregnant females.
No. fetuses
1 D, 3 4 Total
No. females 4 23 15 y 44
124 Mammal Study 24 (1999)
2.4+0.7 (SD) (see Table 2), the number of weaned juveniles observed in Kamakura, Japan,
was one or two with a mean of 1.30.5 (SD; n=47), and in Kenting, Taiwan, the number
of weaned juveniles was 1.1+0.3 (SD; n=29) (Tamura 1989). In neither Kamakura nor
Kenting did I observe females accompanied by more than two weaned juveniles, indicating
that not all neonates survive to be weaned.
Acknowledgements: I thank Mr. S. Suganuma and Mr. K. Doi in the Oshima Government
Office for their help in collecting samples, and Dr. Mark A. Brazil for kind revision of the
manuscript.
References
Kawamichi, T. (ed.) 1997. Red List of Japanese Mammals by the Red Data Committee of the Mammalogical
Society of Japan. Bunichisougou-shuppan, Tokyo, 279 pp. (in Japanese).
Tamura, N., Hayashi, F. and Miyashita, K. 1988. Dominance hierarchy and mating behavior of the Formosan
squirrel, Callosciurus erythraeus thaiwanensis. Journal of Mammalogy 69: 320-331.
Tamura, N. 1989. Sociobiological studies on the Formosan squirrel, Callosciurus erythraeus thaiwanensis
(Bonhote). Ph.D. thesis, Tokyo Metropolitan University, Tokyo, 138 pp.
Tamura, N. and Terauchi, M. 1994. Variation in body weight among three populations of the Formosan squirrel,
Callosciurus erythraeus thaiwanensis. Journal of Mammalogical Society of Japan 19: 101-111.
T’sui, W.H., Lin, F. Y. and Huang, C.C. 1982. The reproductive biology of the red-bellied tree squirrel,
Callosciurus erythraeus, at Ping-Lin, Taipei Hsien. Proceedings of National Science of Council, Sec. B, ROC.
6 (4): 443-451.
Yamaguchi, Y. 1988. Formosan squirrels and Siberian chipmunks. In (Museum of Kanagawa Prefecture ed.)
Introduced Animals in Japan. Pp. 52-54. Nogeinsatu-sha, Kanagawa (in Japanese).
Received 3 August 1999. Accepted 12 October 1999.
ACTA
THERI OLOGICA Auctore Augusto Dehnel condita
Founded by August Dehnel in 1954 is an international journal of mammalogy, covering all
aspects of mammalian biology. It publishes original research reports, short communications
(Fragmenta Theriologica), and book reviews. The journal also includes review papers.
Editor-in-Chief: Zdzistaw PUCEK
Assistant Editors: Anna M. WOJCIK, Jan M. WOJCIK
Current Editorial Board: Roman Andrzejewski (Warszawa), Wiestaw Bogdanowicz (Warszawa),
Gilbert L. Dryden (Ashland), Jifi Gaisler (Brno), Joanna Gliwicz (Warszawa), Ilkka Hanski (Helsinki),
Lennart Hansson (Uppsala), Kazimierz Kowalski (Krakéw), William Z. Lidicker (Berkeley), Sandro
Lovari (Sienna), Brian K. McNab (Gainesville), Gerhard Storch (Frankfurt am Main), Peter Vogel
(Lausanne), Nikolay N. Vorontsov (Moscow), January Weiner (Krakéw).
e Among subjects included are ecology, behaviour, bioenergetics, morphology, development,
reproduction, nutrition, paleontology and evolution of mammals. Papers demonstrating a comparative
perspective in anatomy and physiology of mammals are also welcomed.
Papers represent mammalogical research in over 40 countries, including Eastern Europe and the
Commonwealth of Independent States.
Published now quarterly, in English.
Exchanged or subscribed in 63 countries.
Indexed in: Biological Abstracts, Elsevier BIOBASE/Current Awareness in Biological Sciences,
Current Contents A, B & ES, Ecological Abstracts, Polish Scientific Journals Contents—Agric. &
Biol. Sci., Referativnyi Zhurnal, Science Citation Index, Wildlife Review, Zoological Record.
Edited since 1958, and now also published by the Mammal Research Institute, Polish Academy of
Sciences, Biatowieza, Poland.
Special emphasis is payed on a series of papers
e Bisoniana — over 110 papers devoted to anatomy, physiology, ecology, behaviour, of the European
bison and its hybrids with domestic cattle.
e Studies on the European hare — over 50 papers have been published on hare morphology,
reproduction, and different aspects of population ecology.
e@ Monothematic issues or supplements — Ecology of the bank vole (1983), Ecological genetics in
mammals I (1993), II (1995), III (1998), Developmental homeostasis in natural
populations of mammals: phenetic approach (1997).
More information are available on Internet: http://bison.zbs.bialowieza.pl/acta/acta.html
Manuscripts for consideration should be sent to:
The Editor, Acta Theriologica, c/o Mammal Research Institute, Polish Academy of Sciences,
17-230 Biatowieza, Poland
e@ Manuscripts are peer-reviewed @ No page charges e Fifty reprints free of charge
Subscribe today or request a free sample copy by filling in the order form
Subscription rates: Institutions 102.00 USD per volume, Individuals 68.00 per volume
Postage included. Full air mail delivery (on request) is possible.
Back issues are available.
ORDER FORM for PERSONAL/INSTITUTIONAL SUBSCRIPTION
Please tick appropriate box and send an order card to: Polish Academy of Sciences,
Mammal Research Institute,
17-230 Bialowieza, Poland,
e-mail: acta@bison.zbs.bialowieza.pl
LJ Please enter my subscription, beginning with: Volume 42/1997, Volume 43/1998, Volume 44/1999
L} Please accept my cheque for
CL} Please send me a sample copy. UI Please send me instructions for contributors.
EVOLUTION OF SHREWS
Edited by JM. WOJCIK and M. WOLSAN
In spite of an apparent recent increase of interest in shrews (Soricidae) and an impressive bibliogra-
phy on the evolution of this fascinating group of mammals, until now there has been no compre-
hensive work that deals with current problems in shrew evolutionary research. This book represents
an attempt to redress this omission, by offering a volume that seeks to review the present state
of our knowledge of shrew evolutionary biology.
CONTENTS: Introduction; A Classification of the fossil and Recent shrews; Fossil history of shrews in
Europe; Fossil history of shrews in Asia; Fossil history of shrews in Africa; Fossil history of shrews in North
America; Dental adaptations in shrews; Chromosomal evolution in shrews; Chromosomal evolution: the
case of Sorex araneus; Protein evolution in shrews; Mitochondrial DNA evolution in shrews; Evolution of
energetic strategies in shrews; Evolution of social systems in shrews; Shrew mating systems; Appendix: A
list of the living species of shrews; Taxonomic index.
Published by Mammal Research Institute, Polish Academy of Sciences
Date of publication: May 1998
Number of pages: xii + 458
ISBN 83-90752 1-0-7
Cover: hardback
Price: 38 USD + postage
To order and for further information please contact: Library, Mammal Research Institute, Polish
Academy of Sciences, 17-230 Biatowieza, Poland; Tel./Fax (+48) 85 6812289
E-mail: evolbook @ bison.zbs.bialowieza.pl
To order by Internet see: http://bison.zbs.bialowieza.pl/evol/evol.htm
ORDER FORM
Please fill in this order card and send it to the above address.
O Yes, | would like to order... copy/ies of Evolution of Shrews
EY Please Dill’ me/IMy IMSUMUTION -....cc. cc cecccscseeccccesssceconscecceteteersebcteereceesesdessacesrveieete eugene oy ones err
Name CFE a 1 ES ae oe Eee oe aon ad suas caacudcoonoa desc ocooaccucacnacsoccotoae
PROGRESS: ccc ee ON i es
Instructions to contributors
Mammal Study publishes original Articles, Short Communications and Reviews, written
in English, on all aspects of mammalogy. In principle, membership of the Society is pre-
requisite for the submission of papers except for invited papers, but non-members may be
co-authors. Manuscripts are submitted to qualified referees for critical scientific reviewing.
Authors are notified, with referees’ comments, on acceptance, rejection or need for revision
within three months. The editor also customarily sends accepted manuscripts to qualified
reviewers for English editing.
Manuscripts should be submitted typewritten on one side of the paper (use A4
21.0 x 29.7 cm paper), and double-spaced. An approximately 3 cm margin should be left on
all sides. Do not hyphenate words at the right margin. Manuscripts should be arranged in
the following order: the title, name(s) of author(s) and affiliation, fax number and E-mail
address, abstract (fewer than 200 words) and key words (five words or fewer), main text,
acknowledgments, references, tables, figure legends, figures. Titles of papers must be ac-
curate and concise, and (for abstraction services) include any relevant taxonomic name.
Text pages should be numbered through from title to references. Manuscripts should be
line-numbered, every five lines, in the left margin. Short Communications do not exceed
four printed pages. Abstracts and key words are omitted from Short Communications.
Tables and figures should be simple and self-explanatory, and their preferred locations
should be indicated in the right margin of the text. The author’s name and figure numbers
should be written on the back of original figures and on the surface of copies.
Scientific names should be written in italic. All measurements should be in metric units.
The following abbreviations should be used. Length: km, m, cm, mm, etc.; area: km?, m2,
etc.; volume: km?, m?, kl, 1, ml, etc.; weight: kg, g, mg, etc.; time: hr, min, sec, etc.; others:
cal, kcal, °C, Hz, df, P (probability), SD, SE, CV, etc. Arabic numerals should be used for
numbers exceeding 10.
References in the text should follow the forms: “Uchida and Shiraishi (1985) stated that
..., (Abe and Kawamichi 1990), and (Miura et al. 1993). More than one reference within
the same parentheses should be listed chronologically, alphabetically if of the same year.
Full references cited must be listed alphabetically by the first author according to the fol-
lowing examples:
Abe, H., Shiraishi, S. and Arai, S. 1991. A new mole from Uotsuri-jima, the Ryukyu Is-
lands. Journal of the Mammalogical Society of Japan 15: 47-60.
Eisenberg, J. F. 1981. The Mammalian Radiations. University of Chicago Press, Chicago,
610 pp.
Geist, V. 1982. Adaptive behavioral strategies. In (J. W. Thomas and D. E. Toweill, eds.)
Elk of North America. Pp. 219-277. Stackpole, Harrisburg.
Obara, Y. 1991. Karyosystematics of the mustelid carnivores of Japan. Honyurui Kagaku
[Mammalian Science] 30: 197-220 Gn Japanese with English abstract).
Authors are recommended to refer to recent issues of the journal for details of style and
layout.
Manuscripts should be submitted in triplicate, with a separate sheet giving the title,
author(s), name(s), and address(es) for editorial correspondence, a running head (fewer than
20 letters), the numbers of main text pages, tables and figures. Do not send original figures
until the paper has been accepted.
Galley proofs will be sent to the author. Reprints may be purchased in blocks of 50.
Mammal Study
Vol. 24, No. 2, December 1999
‘Contents
Original papers Ne - eo
Takada, Y., Sakai, E., Uematsu, y. and Tateishi, T.: Morphometric variation
| of house mice (Mus musculus) on the Izu Islands --2:2--+-:- BopcopoReL gabon o: ee :
Dokuchaev, N.E., Ohdachi, S. and Abe, H.: Morphometric status of s shrews: bie :
of the Sorex caecutiens/shinto group in Japan QubSocsaascoo age: pebagbes 2c: Sones ss 67
Jiang, Z. and Takatsuki, S.: Constraints on feeding type in ruminants: a CaSe a
for morphology over phylogeny MN |
Ochiai, K.: Diet of the Japanese serow (Capricornis crispus) on the Shimokita i) ll
- Peninsula, northern J agen in reference to variations with a 16-year |
TEE illest sed he ene eso tan Oa hh ome een oe eae ner eee shoe) foe 8 91 |
Iwasa, M. A., Obara, Y., Kitahara, E. and Kimura, Y:: Synaptonemal | com-
plex analyses in the XY chromosomes of six taxa of Clethrionomys and uk
Eothenomys from Japan : SGUDHOOUBSOOSODOCOOUUOOODDOC OO HC OOUOOD COO Ce ON Ma OS
Short communications
Weerasinghe, U.R., Jayasekara, P. and Takatsuki, S.: A record of the food ae a
retention time of the Asiatic elephant, Elephas maximus ------.-~- ores 6 bol
Tamura, N.: Seasonal change in reproductive states of the Formosan squirrel Sa
on Ikan Oshima Island, Japan ---: tenets = al ae ee see 121 —
jae
The Mammalogical Society of Japan
HECKMAN
BalN GD wee Rey; IGNEG:
Bound-To-Please®
MAY 00
N. MANCHESTER, INDIANA 46962
ASHP dy
Mev Shee
HST,
Cette te
Le:
ho
Oe hete sa,
f.
oe335)
WP er, 2
date ae
Whe ee
7
4
ey
>
2 Les r
ti a y
s > t..
Fa 23
Fi ‘+
: f
\
Ys
eee
Sa ht
Toe va ye See Od tate BS Ht we
o
Pah
oes
AIP Whar yme tes
Wee ea ee
Ley ek Sestoue,
FENPUS RP YS EPUTE eo iia
ree
Stresecs
“S* SSS > ey x
SPER Gat
i
a
ie useEe
ETE TRPLN Ses
=r
ew one
py
bored
uty
We Wee is ey
sterting
fee u= Suey s)
eyrlisive athe
»
a me x feu
Bicboie 9 U7 Bs be pasar yh
weer Wen ering ees ic
Breceeys a
SREB Pe yveg sciu
Saran vga
PGi BS yey
¥
FERS opie
bam
Uxiegeae
mae
Riga y Gace ee
ae
niecene
HLPse he
ATE SBS
Sey
sritin sy;
ia
biscet mentaner
Mop Set
aa)
Maa URGES
PRA ©
Neataraery
PREVA RUT
oy =
D8 arn rsr any
Pes \
Sh Sey
ay
eet SVE Day.
POSE ae aS
VENUS
sh ty
a benoit ge
eet a TOS UNO
Water k SHEADMIAD fy AFany
PEP NPYROT pares
SS eiSte fin ty f
ay Uhl ai oy
UPD RD utr gs
Deyimyuns v he)
KNEEU UPTO SH Ta Ses dia ys
yyune: eh ris
Late
Pour hve se
FEV MME Beery
siege
PUEMYE
HESS
BiS\EEyynicgrdnite
fe PMT Nae)
PUP
EOYs
TUTE raays
Mreueciy
DEM SUPD HS Begin.
seo eeay
Satyr
i beg
WG Webs Phere pap gYesy= ke EY
Rata tee Dury prey
Chery asar ey ge”
Wars erene
952)
FUSE i
BiyGcoe ices AY ure i
! Bian
Nts
SS Voth Beye
aD be ces
aL erat Te
erteh ery rf
Uilegioyiye
PRSU Hind Het
unis ks
Wap DRe
wie
Poverty
hele: Rosy
Uitiba Ya Vat
Bre un)
Caray.
We oh vee
UNSER ant
_ Awe
PUPUSS Face
CPR OGL aH a
PSPOP MEd
Wy veins rahe
NS PDESIRES INS CRUD AT
¢ tira
PAF ru
WP read
WADE
ia
NYG Varig y