ane card ee Pot food: nS Sear lqy ay de CUR VRS HRD Ti ONEC A the ped Letom er ail me peeery eigen ges Ma tet eine tie Tag ty teat iE ISR et asiaiiey. ea: Sutec arent a SRR SS Uy pees Wrslkgien ks a Baha BASILS S29 + bat Fevers *Bahiaciamuhaaa / Tibad | Seba eae sant ct saa, = Spates pes Be PNG A NORE Shah NSN Ey SSeS ATEN ate VhS08 SER WORE RES SELES Rom Aed be, eset Se Rota f us oe re SUE es Hyde eres st SR S14 Urge tae ga Tetetts “USte as Att Bree soe ry ePeirraies tue) AVNER x pit 258 eG 128%, tas tery ent Ta Sesere cs 9 menBED Re thangs BONA Lye ita ary nate tery MAkbthCes Brag ty shag Wie 25 “al eve OSD Re Hert M14 cg eee ct Bt tibia iid Bids hc et he pss serbeG eae s . sa ei: ed) 3a tH a4: SRE BCU TH time eons He Sigs rUP ero mety ee ee beecerestens Dod - fry i Fok The Continuation of the Journal of. the Mammalogical Society of Japan Sept, 1996 et x “0GIcAL soc®® The Mammalogical Society of Japan THE MAMMALOGICAL SOCIETY OF JAPAN OFFICERS AND COUNCIL MEMBERS FOR 1995 — 1996 President : Satoshi Shiraishi Secretary General: Takanori Mori Executive Secretary : Shusei Arai Treasurers : Seiji Ohsumi, Toshiro Kamiya Council Members : Hisashi Abe, Minoru Asahi, Kimitake Funakoshi, Yu- kibumi Kaneko, Takeo Kawamichi, Shingo Miura, Okimasa Murakami, Hideo Obara, Noriyuki Ohtaishi, Takashi Saitoh, Seiki Takatsuki, Kazuo Wada The Mammalogical Society of Japan publishes original papers in two journals: the Mammal Study (the continuation of the Journal of the Mammalogical Society of Japan) for papers written in English, and Honyurui Kagaku |Mammalian Science] for those submitted in Japanese. Each jour- nal is published twice a year. Submissions are considered on the understand- ing that they are being offered solely for publication by the Mammalogical Society of Japan. In principle, authors submitting articles to the journals should be members of the Mammalogical Society of Japan. Both journals are distributed free of charge to the members of the Society. The following are the annual dues for the membership : Domestic members ¥7,000 (Student ¥6,000) Overseas members US $60.00 Institutional subscriptions ¥20,000 All correspondence regarding application for membership, subscription, address change, and other matters should be addressed to: The Mammalogical Society of Japan Business Center for Academic Societies of Japan, Academic Society Center C21, 16—9 Honkomagome, 5-chome, Bunkyo-Ku, Tokyo 113, Japan - Mammal Study : the continuation of the Journal of Mammalogical | Society of Japan _ Editor-in-Chief : Seiki Takatsuki Editorial Secretary : Yukihiko Hashimoto, Masamichi Kurohmaru Editorial Board: Mark A. Brazil, Hideki Endo, Hirofumi Hirakawa, Toshio Kasuya, Takeo Kawamichi, Shingo Miura, Takashi Saitoh, Hitoshi Suzuki, Hidetoshi Tamate All correspondence regarding manuscripts and editorial matters | should be addressed to: Dr. Seiki Takatsuki Laboratory of Wildlife Biology, School of Agriculture and Life Sciences, The University of Tokyo, Yayoi 1-1-1, Bunkyo-ku, Tokyo 113, Japan Fax. 03-5800-3903, E-mail. staka @ uf. a. u-tokyo. ac. jp Mammal Study 21: 1-13 (1996) © the Mammalogical Society of Japan MAR 0 5 1997 dIBRARIES Age variation of the third upper molar i Eothenomys smithii Yukibumi KANEKO Biological Laboratory, Faculty of Education, Kagawa University, Takamatsu 760, Japan Fax. 0878-36-1652 Abstract. A study was made of age variation in the size and enamel patterns of the third upper molar of 99 Eothenomys smithii specimens from Japan. No significant age variation was found in either the frequency of the patterns, or the width of the dentine confluent space between the second and the third triangles. Deep lingual reentrant folds, on the posterior loop, appear in specimens where the condylobasal length (CBL) is of 22-24 mm, then the pattern with a shallow reentrant fold increases in frequency in larger CBL classes. The depth of the inner fold showed the same tendency as the changes in the patterns. A significant associa- tion, however, between five enamel patterns and age classes, depends on classification according to CBL or body weight. This proved insignificant in five CBL classes, but significant in three CBL or body weight classes. A gradual transition in the age variation of the posterior loop patterns was found among Eo- thenomys species which have rootless molars throughout life. The simple enamel pattern form significantly increased in fre- quency with advancing age in FE. andersoni and E. shansetus, resembling Clethrionomys glareolus and C. rufocanus ; on the other hand, in E. vegulus, E. inez, E. eva, E. chinensis, E. wardi, E. custos and E. proditor no age variation was found on the posterior loop, thus resembling Microtus pennsylvanicus. E. smithii shows a little age variation in the enamel patterns, the variation of which is of an intermediate type. Key words: age variation, enamel pattern, Eothenomys smithii, size of molar, third upper molar. With regard to the phylogeny of the Arvicolidae, Bauchau and Chaline (1987), and Chaline and Graf (1988), considered that, based on a comparison of molar structures, the occlusal enamel patterns of the third upper molar tended to vary from simple to more complex forms. The genus Clethrionomys develops molar roots with advancing age, whereas the genus Eothenomys develops no roots. The two genera, however, resemble each other in many other characters of the skull and dental morphology (Hinton 1926, Kaneko 1990, 1992), and in their karyotypes (Yoshida et al. 1989). Through the ontogenetic process of C. glareolus (Zejda 1960), C. rufocanus (Abe 1982) and E. andersoni (Miyao 1966, Kitahara 1995), a large proportion of molars changes from complex enamel 2 Mammal Study 21: 1996 patterns to simpler forms. No age variation was found, however, on the same molar in £. smithi (Tanaka 1971). Tanaka’s (1971) results for E. smithit may have been biased because of his relatively small sample group of specimens collected during just one period of the year, when fully adult animals may have been absent. The purpose of this study, therefore, was to reexamine the age variation in both size and enamel pattern of the third upper molars of E. smzthiz, and to compare the results with those of other Eothenomys species. MATERIALS AND METHOS A total of 99 specimens of E. smithii were collected at Minoura, Toyohama District, Kagawa Prefecture, Japan, (34°02’30”N, 133°37'30”E). Specimens in each of the 12 months were sampled at one period during the years 1977-80 (Kaneko 1989). The collecting site for this study was less than 50 km from Tanaka’s (1971) site on the same island, Shikoku. Five measurements of the third upper molar and the condylobasal length (CBL) were taken from cleaned skulls, these were: total length (TM3L), anterior length (AM3L), posterior length (PM3L), the width of dentine confluent spaces between the first and second triangles (WDC) and the depth of the third lingual reentrant fold or the posterior loop (DRF, Fig. 1). Tooth dimensions were measured to the nearest hak: YO a = DRE Fig. 1. Measurements taken (left), and enamel patterns (AQ-A3 and P1-P4) on the third upper molar according to Tanaka (1971). TM3L, AM3L, PM3L, WDC and DRF are ex- plained in text. Kaneko, Age variation of the molar in Eothenomys smithii 3 0.01 mm using a stereo-microscope (Nikon, SMZ-10) with an objective micro- meter (Kogaku, minimum interval=0.05 mm). The CBL was measured to the nearest 0.1 mm with a dial caliper (minimum interval=0.05 mm). Tanaka (1971) defined the enamel patterns formed on the occlusal surface by the enamel lamellae only in figures ; however, in this study more precise criteria have been used. Four patterns (A0-A3) in the shape of the dentine confluent spaces between the second and third triangles were recognized. In AO, the lamellae do not form two triangles, but a wide dentine confluent space instead. Aland A2 are intermediate patterns between A0 and A3 (Al shows a smaller protrusion of the enamel lamella, and A2 a larger protrusion). In A3 the lamellae form two complete triangles. Four other patterns (P1-P4) were observed on the posterior loop, or on the fourth salient angle. In P1 the pattern is complex, with three reentrant folds on the lingual side, with the third fold exceeding the transverse line at the anterior edge of the salient angle of the posterior loop. P2 is intermediate between patterns Pl and P3. P3 has three salient angles with a straight-sided posterior loop on the lingual side. In P4 the pattern is simple with two reentrant folds on the lingual side and without concavity on the posterior loop. Enamel patterns were observed on the right or left molar under a stereo-microscope with a X20 lens. In this study, CBL was used as an approximate indicator of age, because it correlates positively with age as defined by root development in Clethrionomys rufocanus (Kaneko 1990). As there have been no reports indicating sexual differences in either size or enamel patterns, both males and females were combined for analysis. RESULTS As CBL increased, both total length (TM3L) and anterior length (AM3L) increased significantly (v =0.661, <0.001 and d@. f=97 in TM3L; r=0.676, p< 0.001, d. f=97 in AM3L). As CBL increased, the posterior length (PM3L) increased until CBL reached 22.5 mm where it reached asymptote, though a significant regression coefficient was calculated throughout the size of CBL WS 05a 000

988 ° ° ) Ae © ° eo ° } 96 68 Re ° © 0% se @ 0902 0% 6 $8 2°° 8 @ © “6 ° 0 ° 8 8 er) ° 1.5 ‘ ° ° © ° © ° © AM3L ) a) 86° Co} 8 ° (oXo) AD go A G5 oo © 0 ° 80g © 09 8 (c) ° ° 9 8 Bene oO 1.0 Since Lemahig® ee oS 3 ° , fice ° © % 21 22 \ 235 °°24 25 26 C BL (mm) Fig. 2. Plots of TM3L, AM3L and PM3L against the condylobasal length (CBL). 04 DRF 5 i © 26 © fo} {o} COm O (0) © ©, eo <8 8°50 OPO BP © © © 6° © CEG ® © a) °°? © OB © i) oe 6 % e090 (0) (0) © © 6 Px) og @, © %9 i) 0, {o) sce 2) c QO _ 60 © OD Be Seo © poo PR oOBO © oP Ro fo .0 § fo} tol GOR 0 Ue8 oe Heo Y © aio 0) M9 St 4 — 21 DD 23 24 C BL (mm) Fig. 3. Plots of WDC and DRF against the condylobasal length (CBL). : 1996 Kaneko, Age variation of the molar in Eothenomys smithii 2) WDC was slightly longer in the 20 mm CBL class. The coefficient of variation was greater was DRF in the 25 mm CBL class (Table 1). The association of enamel patterns between left and right third upper molars was tested using the G-test with Williams’ adjustment (Sokal and Rohlf 1973). No independence was shown between right and left molars in the patterns of the dentine spaces between the second and third triangles (A0-A3 ; Gaaj — 30.66, P<0.005, d. f =9, Table 2), or between right and left patterns of the posterior loop (P1-P4; Gag =43.88, p<0.005, d. f=9, Table 2). Similarly no association was shown between the patterns of the dentine confluent spaces and those of the posterior loop (A0-A3 and P1-P4, Gag; =6.56, 2.s., d. f£ =9, Table 3). Consequently, the left third upper molar was used for further studies. In an analysis of the width of dentine spaces (WDC) and the enamel patterns (A0-A3) between the second and third triangles for each of the five size classes of CBL, the 0.05-0.10 mm WDC class and pattern A2 predominated in every CBL size class over 22.0 mm, and average WDC remained almost con- stant throughout the size classes (Fig. 4). No association was found between the enamel patterns and the five CBL size classes (Gag; =18.73, u.s., d. f =12, Table 4). When the frequency of the patterns was divided into three body weight classes, as defined by Tanaka (1971), or by CBL (20.5-, 23.0-, and 25.0- mm Table 1. Five measurements of the third upper molars of Eothenomys smithit. Five CBL classes (mm) Y)).5= OA UB 0= DAS Om 5) .0= N 5) 19 21 37 LY Total xX 1.508 1.720 1.769 1832 1.908 length SD 0.150 0.082 0.119 0.093 0.102 GOI) CV; 9.946 Ah SST 6.661 5.064 Deas (mm) Min. 137 1.50 155) 1.63 16 Max. Legs 1.86 1.99 2.00 2.08 Anterior DK 0.974 1.068 Wee IL, UDO) LAS length SID 0.060 0.060 0.073 0.080 0.087 (AM3L) CV 6.181 Do DMZ 6.534 6.679 CLO (mm) Min. 0.93 0.97 1.00 1.04 Os Max. 1.08 2,0 12S 36 14 Posterior IE 0.564 0.730 0.748 0.739 ORa2 length SD 0.144 0.071 0.073 0.076 0.087 CeIMBIL) (CV DS Ai 9.760 9.818 10.303 LL SILO (mm) Min. 0.43 0.57 0.61 0.56 0.60 Max. 0.80 0.88 0.90 0.90 0.93 Confluent X 0.094 0.050 0.064 0.056 0.059 width SD 0.026 0.028 0.029 0.032 0.032 (WDC) CV eae 55.800 44.479 7 AU yh AD (mm) Min. 0.05 0.00 0.00 0.00 0.00 Max. OW 0.10 @. Ju 0) 57 0.10 Depth of xX 0.170 02223 OB2ZZAl OAL 0.130 reentrant SD 0.082 0.076 0.088 0.083 0.087 fold (OW 48.177 34.187 39.638 38.199 67.154 (DRF) Min. 0.10 0.07 0.06 0.05 0.00 (mm) Max. 0.30 0.40 0.36 0.38 0.30 6 Mammal Study 21: 1996 N |} sb=0032 10 250- N=17 5 S$D=0032 15 240- N=37 10 5 SD=0029 23.0- 10 N=21 5 SD=0028 I9 920- 10 N=19 Ol CPrane AQAIA2A3 Fig. 4. Frequency distributions of WDC measurements and enamel patterns A0-A3 of the dentine space for five CBL classes. A closed triangle shows the average, and SD indicates the standard deviation of the average. Kaneko, Age variation of the molar in Eothenomys smithii N 10} s0=0087 250 - 2 N=17 ie| 9030083 240- 10 N=37 5 SD-0088 10 230- 5 N=21 SD=0076 10 af 7] SD=0082 ae O01 O02 03 O4mm P1P2P3 Pé ORF CBL (mm) Fig.5. Frequency distributions of DRF measurements and enamel patterns P1-P4 for five CBL classes. A closed triangle shows the average, and SD indicates the standard deviation of the average. 8 Mammal Study 21: 1996 Table 2. A test of independence for frequencies of the enamel patterns (A0-A3 and P1-P4) between the right and left molars of Eothenomys smithit. The left Confluent patterns of the 2nd and 3rd spaces AO Al A2 A3 Total The right AO 1 2 0 0 3 Al 1 iil 2 0 14 A2 0 6 59 4 69 A3 0 0 IL 2 13 Total 2 19 62 16 99 Patterns of posterior loop eal eZ P3 P4 Total The right ll 34 rot 0 1 42 eZ 10 24 ) 0 39 es 0 3 12 0 15 P4 0 0 2 3 Total 54 34 18 3 99 Table 3. A test of independence for frequencies between the enamel patterns (A0-A3 and P1-P4) of Eothenomys smithiz. Confluent patterns between the 2nd and 3rd spaces AO Al A2 A3 Total Posterior el 1 5 28 10 44 loop 12 0) a 24 3 34 patterns 3 1 6 9 2, 18 P4 0 IL 1 IL 3 Total 2 19 62 16 99 based on Table 4), no significant association was shown between the two dimensions (Gag, =8.13, .s., @d. f=9 for CBL; Gag =4.83, x.s., d. f.=6 for body weight, Table 5). Thus, the variation of the pattern of the dentine confluent spaces (A0-A3) is independent of age. In an analysis of the depth of the reentrant fold (DRF) and of the enamel patterns of the posterior loop (P1-P4) for each CBL size class, patterns P1-P3 appeared with similar frequencies in CBL classes from 22 mm to 24 mm, as did DRF, with almost the same average, though within a wide range between 0.05 and 0.45 mm (Fig. 5). In the 25 mm CBL class, average DRF became slightly shallower, and pattern P4 appeared for the first time, and P2 became the most frequent pattern. No association was found between the patterns of the posterior loop and the five CBL size classes at the 5% level (Gag =19.36, 0.05< p<0.1, d. f=12, Table 4). However, when the patterns of the posterior loop were classified into three body weight classes, as defined by Tanaka (1971), and Kaneko, Age variation of the molar in Eothenomys smithii 9 Table 4. A test of independence for frequencies between the enamel patterns (A0-A3 and P1-P4) and five CBL size classes of Eothenomys smithit. Confluent patterns between the 2nd and 3rd spaces AO Al A2 A3 Total Five X) = il 3 i 0) fs) CBE Un) ib 0 15) 3 19 classes opel) 0 4 14 3 21 (mm) PAA S 0 10 19 8 37 25>n0= 0 2 13 2 17 Total 2 19 62 16 99 Posterior loop patterns Pl eZ P3 P4 Total Five XY) = 1 y 2, 0) 5) CBE (id, = 18} 4 2 0) 19 classes 3) = lel 7 3 0) Al (mm) Ub 0= 17 1133 a ) 37 25), 0= 2 8 4 3 UG Total 44 34 18 3 99 Table 5. A test of independence for frequencies between the enamel patterns (A0-A3 and P1-P4) and three body weight classes of Eothenomys smithit. Confluent patterns between the 2nd and 3rd spaces AO Al A2 A3 Total Body 0 .0= 1 3 3 2 g weight 20 .0- 1 WZ 4] ut 65 (g) 30.0- 0 aI 18 3 75) Total 2 ky 62 16 99 Posterior loop patterns Pl lez es P4 Total Body OROS 3 3 3 0) 9 weight Z080m 36 ZAM 8 0) 65 (g) 3). 0- 5 10 7 3 29 Total 44 34 18 3 99 by CBL (20.5-, 23.0- and 25.0- mm based on Table 4), significant associations were found for both dimensions (Gag; =17.69, p<0.01, d. f =6, for CBL; Gag= ii p25" dsa—o, tor body weight Dable 5). When the total (TM3L), anterior (AM3L), and posterior (PM3L) lengths of the third upper molar were examined in relation to the four enamel patterns on the posterior loop (P1-P4) for each of the four CBL size classes (Fig. 6), it was found that average PM3Ls tend to decrease from P1 to P4 at the 24 and 25 mm CBL classes, whereas average AM3L increased slightly. 10 Mammal Study 21: 1996 alin CBL=250- See CBL=25.0- fo) CBL=230- Lf fe CBL=22.0- fo) | ae to} ————— P1 P2 P3 P4 P1 P2 P3 P4 P1 P2 P3 P4 Fig.6. Measurements of TM3L, AM3L and PM3L against enamel patterns P1-P4 for four CBL classes. A closed triangle shows the average, and a vertical line indicates the standard deviation of the average. Kaneko, Age variation of the molar in Eothenomys smithii ita DISCUSSION In revising the taxonomic position of Eothenomys smithit, Tanaka (1971) first showed that no age variation was found on the enamel patterns of the dentine confluence between the second and third triangles and the enamel patterns of posterior loop on the third upper molar. Sixty-six specimens used by Tanaka (1971) were collected at the end of July at 1700 m on Mt. Tsurugi, Tokushima Prefecture, Shikoku, Japan. The breeding season of this vole is at its peak during July when Tanaka (1971) collected specimens, and fully adult voles represented only a small proportion of the population (Kaneko and Morii 1976). In this study 99 specimens collected throughout a year were examined, and these included a larger proportion (26%) of old adults with body weight heavier than 30 g, than in Tanaka’s (1971) sample (16%). In the specimens collected for this study, however, the posterior loop of the third molar showed some age variation, as shown by the increase of the frequency of P2, the appearence of P4 (the simple form) and the shallower reentrant fold (DRF) in the largest CBL size class (Figs. 3 and 5, and Table 1). Table 6. The relationship between enamel patterns and skull sizes in species of Eothenomys (data from Kaneko 1990, 1992). Posterior loop patterns* Species Size (mm) Type 6 Type P2 Type P3 Type P4 Total E. shanseius WA 5 0 1 0 6 (I-M3) Ie 6 2 3 2 13 Gaaj =52.02 AS Oe il 6 9 3 19 Oh j= WP 15. 2= 0 2 8 16 26 p<0.05 iO, I= 0 il 6 10 e/ Total 12 11 Dil Sik 81 E. inez Ss 1 0 0 0 1 (I-M3) WEZ= 1 2 4 0 7 Gaaj =6.28 13, l= 0 8 WP 0 20 Gae— ORs S: 14.0- 0 2 3 0 5 Total 2 12 19 0 33 E. eva i B= 0 0 0 3 3 (I-M3) 12..2= 0 3 2 12 17 Gaaj =5.74 IBLE 0 0 9 20 29 @. j-=6, 7 &: 4h @= 0 0 0 i Il Total 0 3 11 36 50 E. regulus MAL = 1 2, 0 0 3 (CBL) 2200= il 3 0 0 4 Gaaj =8.94 G3) 0= 0 5 1 0 6 O., jx 15, 72. S ZAR On 0 6 2 0 8 2) 0= il 5 0 0 6 26 .0- 0 6 Z 0 8 Total 3 De 5 0 35 * Type 6 has three salient angles on the lingual side, a short posterior loop, and a confluent dental isthmus between triangles. Except for Type 6, all types appearing in Kaneko (1990, 1992) were followed in the present classification. n.s.: non-significant. 12 Mammal Study 21: 1996 A statistically significant association was found between the posterior loop patterns (P1-P4) and three CBL classes (20.5-, 23.0- and 25.0- mm, Table 4), because the DRF was nearly constant throughout the 22-24 mm CBL classes but decreased only in the largest 25 mm CBL class (Fig. 3 and Table 1). Further- more, a test between patterns P1-P4 and the three body weight classes would be significant (Table 5), because body weight correlates siginificantly with CBL (v=0.911, 6< 0.001, d.f.=97) and individuals with a CBL of more than 25 mm correspond with those of body weights of over 30 g. As age increases, the pattern of the posterior loop tends to become simple in Clethrionomys glareolus (Zejda 1960) and C. rufocanus (Abe 1982), which have rooted molars in older individuals. The simple form increases in frequency from the root ratio exceeding 63% in C. glareolus and 32% in C. rufocanus (Zejda 1960, Abe 1982). Due to the loss of the third reentrant fold with age, the proportion of the simple form increases in C. glareolus and C. rufocanus. In contrast, age variation was not observed on the loop in Microtus pennsylvanicus, which remains rootless throughout life (Oppenheimer 1965). Among ten species of Hothenomys having rootless molars throughout life, a gradual transition is found in the age variation of the posterior loop pattern : in E. andersoni the ratio of the simple form of the posterior loop increases with advancing age (Miyao 1966, Kitahara 1995), and in EF. shanseius the proportion of the simple form increases with increasing CBL, though samples from differ- ent populations were pooled (Table 6), resembling in this respect Clethrionomys glareolus and C. rufocanus. In contrast, age variation has not been observed in either E. inez, eva, regulus, chinensis, wardi, custos, or proditor, they thus resemble Microtus pennsylvanicus, though samples from different populations were pooled (Table 6 and unpublished data). Thus, E£. smithii is an intermedi- ate type between these two groups showing a little age variation. In E. smithiz, the posterior length of the third upper molar (PM3L) ceased to grow with age, though both the total molar length (TM3L) and the anterior length (AM3L) increased with age (Table 1 and Fig. 2). The growth of TM3L, therefore, is related to that of the anterior length. However, when PM3L was plotted against the four posterior loop patterns (P1-P4, Fig. 6), the posterior length tended to become relatively shorter from Pl to P4 as CBL increases. In C. rufocanus, the simple form (P4) increases greatly in frequency (Abe 1982), as the length decreases with advancing age (Abe 1973). It is suggested, therefore, that the increase in the frequency of P4 is due to a shortening of PM3L with advancing age. Furthermore, in FE. smithi it appears that PM3L does not decrease prominently with advancing age (Fig. 2), because the increase in the frequency of the simple P4 pattern is relatively lower than in C. rufocanus. Acknowledgements : My special thanks are due to Dr. K. Maeda, Nara Univer- sity of Education, for reading a draft, and to anonymous referees for reading and improving the final manuscript. Kaneko, Age variation of the molar in Eothenomys smithii 13 REFERENCES Abe, H. 1973. Growth and development in two forms of Clethrionomys. II. Tooth characters, with special reference to phylogenetic relationships. J. Fac. Agr. Hokkaido Univ. 57 : 229—254. Abe, H. 1982. Age and seasonal variations of molar patterns in a red-backed vole population. J. Mammal. Soc. Japan 9: 9—13. Bauchau, V. and J. Chaline. 1987. Variabilité de la troisiéme molaire supérieure de Clethrionomys glareolus (Arvicolidae, Rodentia) et sa signification évolutive. Mammalia 51 :587—598. Chaline, J. and J.-D.Graf. 1988. Phylogeny of the Arvicolidae (Rodentia): biochemical and paleontological evidence. J. Mammal. 69 : 22—33. Hinton, M. A.C. 1926. Monograph of the Voles and Lemmings (Microtinae), Living and Extinct. British Museum (Natural History), London, 488 pp. Kaneko, Y. 1989. Seasonal changes of the number collected and reproduction in Eothenomys smithii at the foot of a lower mountain, Minoura, Kagawa Prefecture, Japan. Kagawa Seibutsu (15/ 16) :67—74 (in Japanese with English abstract). Kaneko, Y. 1990. Identification and some morphological characters of Clethrionomys rufocanus and Eothenomys regulus from USSR, northeast China, and Korea in comparison with C. rufocanus from Finland. J. Mammal. Soc. Japan 14: 129-148. Kaneko, Y. 1992. Identification and morphological characteristics of Clethrionomys rufocanus, Eothenomys shanseius, E. inez and E. eva from the USSR, Mongolia, and northern and central China. J. Mammal. Soc. Japan 16: 71—95. Kaneko, Y. and R. Morii. 1976. Altitudinal survey of small rodents in Mt. Tsurugi, Tokushima Prefecture. Mem. Fac. Educ., Kagawa Univ. II 26 : 43—52 (in Japanese with English abstract). Kitahara, E. 1995. Taxonomic status of Anderson’s red-backed vole on the Kii Peninsula, Japan, based on skull and dental characters. J. Mammal. Soc. Japan 20:9—28. Miyao, T. 1966. Small mammals on Mt. Yatsugatake in Honshu. V. Variation of the third upper molar pattern in Clethrionomys andersoni. J.Growth 5:7—12 (in Japanese with English summary). Oppenheimer, J. R. 1965. Molar cusp pattern variations and their interrelationships in the meadow vole, Microtus p. pennsylvanicus (Ord). Am. Midl. Nat. 74: 39—49. Sokal, R. R. and J. Rohlf. 1973. Introduction to Biostatistics. W. H. Freeman, San Franciso and London, 368 pp. Tanaka, R. 1971. A research into variation in molar and external features among a population of the Smith’s red-backed vole for elucidation of its systematic rank. Japanese J. Zool. 16: 163— 176. Yoshida, I., Y. Obara and N. Matsuoka. 1989. Phylogenetic relationships among seven taxa of the Japanese Microtine voles revealed by karyological and biochemical techniques. Zool. Science 6 : 409— 420. Zejda, J. 1960. The influence of age on the formation of the third upper molar in the bank vole Clethrionomys glareolus (Schreber, 1780) (Mamm.: Rodentia). Zool. Listy 9: 159—166. (accepted 3 November 1995) ay i ; / genre ~s q ie i bi See i Mammal Study 21: 15-25 (1996) © the Mammalogical Society of Japan Phylogenetic implications of variations in rDNA and mtDNA in red-backed voles collected in Hokkaido, Japan, and in Korea Shigeharu WAKANA’, Mitsuru SAKAIZUMI’, Kimiyuki TSUCHIYA’, Mitsuhiko ASAKAWA‘*, Sang Hoon HAN?®, Keisuke NAKATA® and Hitoshi SUZUKI’* ‘Department of Genetics, Central Institute for Experimental Animals, Nogawa, Miyamae-ku, Kawasaki 213, *Department of Environmental Science, Faculty of Science, Niigata University, Niigata 950-21, 3Experimental Animal Center, Miyazaki Medical College, Kiyotake, Miyazaki 889-16, *Department of Veterinary Medicine, Rakuno Gakuen University, Ebetsu O69, °Institute of Applied Zoology, Faculty of Agriculture, Hokkaido University, Sapporo O60, °Hokkaido Forest Experiment Station, Bibai, 079-01, 7Division of Bioscience, Graduate School of Environmental Earth Science, Hokkaido University, Kita 10, West 5, Kita-ku, Sapporo O60, Japan (*To whom correspondence should be addressed) Fax. 011-706-2225, E-mail. htsuzuki @ eesbio. hopudai. ac. jp Abstract. Restriction fragment length polymorphisms (RFLPs) in nuclear ribosomal DNA (rDNA) spacers and mitochondrial DNA (mtDNA) were examined in red-backed voles collected in Hokkaido (Japan), and Korea. These voles have been classified into six species on the basis of morphological characteristics, such as dental morphology. The RFLPs of the rDNA allowed us to classify the voles into three distinct groups: rCrt (Clethrionomys rutilus), rCrf (C. rufocanus, C. sitkotanensis and FHEothenomys regulus) and rCrx (C. rex and C. montanus). The estimated sequence divergence between rCrt and rCrf and that between rCrf and rCrx were 4.8% and 2.3%, respectively. In the rCrf group, no major differences in mtDNA were observed among the populations from the mainland of Hokkaido, Rishiri Island, and Daikoku Islet. Similarly, in the rCrx group, mtDNA haplotypes from the main- land of Hokkaido and Rishiri I. were closely related each other, indicating that there have been genetic exchanges between the populations after speciation, or those haplotypes are derived from recent common origin. The Korean red-backed vole, which is sometimes referred to E. regulus, had rDNA identical to that of the rCrf group from Hokkaido. By contrast, the mtDNA haplotype of the Korean vole was substantially different from that of C. rufocanus in Hokkaido (8% sequence divergence). These results imply that the Korean red-backed vole and C. rufocanus in Hok- kaido are very closely related and that ancestrally diverged mtDNA haplotypes have been maintained in the different geo- graphic regions. Key words. Clethrionomys, mitochondrial DNA, restriction fragment length polymorphism, ribosomal DNA, the red-backed vole. 16 Mammal Study 21: 1996 Red-backed voles, which are small rodents that live in the fields and mountains of the Palaearctic Region, are extremely complicated in terms of taxonomy. Red-backed voles have been traditionally classified into two genera, Cleth- rionomys and Eothenomys, on the basis of differences in morphological charac- teristics, such as the presence or absence of rooting of the molars (Hinton 1926). However, it is uncertain whether or not such criteria are phylogenetically appropriate. In terms of morphological criteria, the red-backed voles living in Hokkaido, Japan, are classified as Clethrionomys because of the presence of rooting of the molars. On the mainland of Hokkaido, three different forms of vole are known: the Northern red-backed vole (C. vutilus or C. r. mtkado) ; the gray red-backed vole (C. rufocanus or C.r. bedfordiae); and a recently identified form, represented by C. vex and C. montanus (Imaizumi 1971, 1972). Morphologically, C. rufocanus and C. rex are similar and some taxonomists question the classification of C. vex as a distinct species (Aimi 1980, Corbet 1978, Musser and Carleton 1993). Another taxonomic issue is the classification of voles on the peripheral islands of Hokkaido, and on Rishiri Isiand in particular, where the existence of two different forms of the red-backed vole, namely, C. stkotanensis and C. vex, have been reported (Imaizumi 1971). C. stkotanensis has, however, been considered as synonymous with C. rufocanus by Abe (1984) and Kaneko and Sato (1993). According to Imaizumi (1972), C. vex-like voles on the mainland should be designated C. montanus, a species different from C. vex on Rishiri I. However, Abe (1984) considered that C. vex and C. montanus are synonymous. It is of interest, moreover, that voles living on Daikoku Islet, adjacent to the southeastern coast of Hokkaido, are usually classified as C. rufocanus but display morphological characteristics of both C. rufocanus and C. vex (Abe 1984). Therefore, the unequivocal taxonomic classification of the voles on Daikoku I. has not yet been made (Abe 1984). The Korean red-backed vole provides another intriguing question with respect to classification. It has been included in the genus Clethrionomys and classified as a species, C. vegulus, that is endemic to Korea (Corbet 1978). Ina detailed morphological study of voles from Russia and Korea, Kaneko (1990) showed that all of the examined specimens from Korea had rootless teeth, in contrast to the individuals from Russia and have subsequently been classified as Eothenomys regulus (Corbet and Hill 1991). The true geographical demarca- tion line between C. rufocanus and E. regulus lies on the western and southern boundary of the Kaima Plateau, North Korea (Kaneko 1990). Morphological studies have not provided sufficient information about the classification of red-backed voles and a single morphological characteristic, such as rooting of molars, is insufficient for classification of a given species. Karyological studies have been made on some members of the complicated genera of Clethrionomys and Eothenomys. However, the karyotypes appear to be very similar and no informative variations have been reported (Kashiwa- bara and Onoyama 1988, Tsuchiya 1981, Yoshida ef al. 1989). Both rDNA and mtDNA provide powerful diagnostic markers for the identification of populations because 1) both mtDNA and rDNA exist as Wakana et al., Molecular phylogeny of red-backed voles Wi multiple copies in the mammalian genome and, thus, are easily analyzed, and 2) many RFLPs are specific to each population. Combined analyses, exploiting both cytoplasmic and nuclear markers, should provide much more reliable information on the timing of divergence and the topology of the phylogenetic tree among populations of given animal species. In the present study, we compared variations in rDNA and mtDNA among six morphologically different forms of red-backed voles collected on the mainland of Hokkaido, on Rishiri I., on Daikoku I. and in Korea. Here we demonstrate that the six taxa can be classified as three distinct species. MATERIALS AND METHODS 1. Voles A total of 36 voles (Table 1), collected from eight localities (Fig. 1), was used for the analysis of rDNA and mtDNA. 2. Blot analysis Nuclear DNA was prepared from the liver of each vole as described by Maniatis et al. (1982). Southern blot analysis was carried out as described by Suzuki et al. (1994b). DNA was digested with eight restriction enzymes for the analysis of mtDNA (Aatl, Apal, BamHI, Dral, EcoRI, Aindill, PstI and Xbal) and with ten restriction enzymes for the analysis of rDNA (AatI, BamHI, BglII, Table 1. List of samples used and specific types of morphology, rDNA and mtDNA. Serial no. Name of species, mtDNA haplotypes and as typed with rDNA (no. of individuals locality morphological repetype with common characteristics haplotypes) Hokkaido, Japan 1. Bekkai C. rutilus eA Cictt mCrtly (1) 2. Teshio C. rufocanus 1G Cts mCrfl (4) C. montanus Cie mCrx1 (4) 3. Tobetsu C. rufocanus iA Ciat oar (2). wala (S) mCrf3 (1) 4. Naganuma C. rufocanus in Cieit aatCieill (UU), weakCiai (2) mCrf4 (3) 5. Ohtaki C. rufocanus nCick mCrf3 (1) GS, IniSavbat I C. stkotanensis Cia onlay (UU) CC, WB TO 1ox Tan © rexel) 7. Daikoku I. C. rufocanus idCiat mCrfl (8) Korea 8. Mt. Chiri E. regulus rCrf mErgl (2) 18 Mammal Study 21: 1996 Fig 1. Localities at which red-backed voles were sampled. Numbers assigned to localities are the same as in Table 1. Dyal, EcoRI, Hindlll, PstI, Pvull, Sacl, and Xbal). The digested DNAs were immobilized on nylon filters and then allowed to hybridize sequentially with 32P-labeled probes of rDNA, namely, 28S, 18SB, and INT (Suzuki e¢ al. 1994b). A mtDNA probe used was the whole mtDNA genome that was prepared from the liver of a hamster, as described by Wakana ef al. (1986). After hybridiza- tion, filters were washed twice with 2 X SSC (0.3 M NaCl-0.03 M Na citrate solution with pH 7.0) containing 0.1% (w/v) sodium dodecyl] sulfate at room temperature. Autoradiographs were obtained either by exposing hybridized membranes to X-ray film or with an image analyzer (Bio Image Analyzer, BAS2000, Fuji Film, Japan). Wakana et al., Molecular phylogeny of red-backed voles 19 3. Construction of restriction maps of the rDNA From the patterns of hybridization after single digestions, restriction maps were constructed for the coding and internal spacer regions of rDNA because most restriction sites in the coding region as well as a Dval site in the internal Spacer were conserved. By reference to restriction-site maps of the coding and the internal spacer regions, the location of the restriction sites on the external spacer region, which flanked the genes for 18S and 28S rRNA, was estimated by single digestion and hybridization with the 18SB and 28S probes. Since the probes were localized to the distal end of the coding regions, only the restriction sites nearest to the distal end of the genes for 18S or 28S rRNA could be mapped. Although length polymorphisms within the genome were observed in certain regions of the external spacer in most samples investigated, only the most prominent bands were taken into account for construction of the physical maps. 4. Construction of phylogenetic trees To estimate the sequence divergence among the three major rDNA re- petypes we compared the arrangement of restriction sites between pairs of repetypes and counted the number at common and different sites. The sequence divergence among haplotypes of mtDNA was estimated from the number of common and different restriction fragments observed. Employing a method developed by Gotoh ef al. (1979), in which backward mutations and parallel mutations are taken into account, we produced a matrix of sequence divergences among all possible combinations of rDNA repetypes (Table 2) and mtDNA haplotypes (Table 3). Then we constructed phylogenetic trees using the unweighted pair-group (UPGMA) method (Sokal and Michener 1958) and the neighbor-joining (NJ) method (Saitou and Nei 1987). Table 2. Sequence divergence among the rDNA repetypes (upper right), based on the number of common and different restriction sites (lower left). Sequence divergence (%) 1 Ora GOIex Oral rCrt —= 6.4 4.8 rCrx 28S* 6 4es 18S Bey 4135 = Dee INT 1/3 total 12 5/5 TaOrati 28S 6/4 8/2 18S 65/305 8/2 = INT Dy) D5 D, M5 total 5/10 3) 5/ 55 * The external (28S, 18S) spacer region and the internal spacer and coding regions (INT). **Number of sites (common/different). 20 Mammal Study 21: 1996 Table 3. Sequence divergence among the mtDNA haplotype (upper right), based on the number of common and different restriction fragments (lower left). Haplo- Sequence divergence (%) type mCrtl ViammalsSoesapan lon 95: Kaneko, Y. and M. Sato. 1993. Identification and distribution of red-backed voles from Rishiri Is., Hokkaido (preliminary study). Rishiri Town Museum Annual Report 12:37—47 (in Japanese). Kashiwabara S. and K. Onoyama. 1988. Karyotypes and G-banding patterns of the red-backed voles, Clethrionomys montanus and C. rufocanus bedfordiae (Rodentia, Microtinae). J. Mam- mall, Soe: Jajoam leess3—Ail, Maniatis, T., E. F. Fritsch and J. Sambrook. 1982. Molecular Cloning: a Laboratory Manual. Cold Spring Harbor Laboratory, New York, 545 pp. Musser, G.G. and M.D. Carleton. 1993. Family Muridae. Jn (D. E. Wilson and D. M. Reeder, eds.) Mammal Species of the World 2nd edition. pp. 501—755. Smithsonian Instit. Press, Washington Saitou, N. and M. Nei. 1987. The neighbor-joining method: a new method for reconstructing phylogenetic trees. Mol. Biol. Evol. 4: 406—425. Sokal R. R. and C. D. Michener. 1958. A statistical method for evaluating systematic relationships. Univ. Kansas Sci. Bull. 28 : 1409—1438. Suzuki, H., Y. Kawamoto, O. Takenaka, I. Munechika, H. Hori and S. Sakurai. 1994a. Phylogenetic Wakana et al., Molecular phylogeny of ved-backed voles 25 relationships among Homo sapiens and related species based on restriction site variations in rDNA spacers. Biochem. Genet. 32 : 257—269. Suzuki, H., N. Miyashita, K. Moriwaki, R. Kominami, M. Muramatsu, T. Kanehisa, F. Bonhomme, M. L. Petras, Z. Yu and D.Lu. 1986. Evolutionary implication of heterogeneity of the non- transcribed spacer region of ribosomal DNA repeating units in various subspecies of Mus musculus. Mol. Biol. Evol. 3: 126—137. Suzuki, H., K. Moriwaki and E. Nevo. 1987. Ribosomal DNA (rDNA) spacer polymorphism in mole rats. Mol. Biol. Evol. 4 : 602—607. Suzuki, H., K. Tsuchiya, M. Sakaizumi, S. Wakana, O. Gotoh, N. Saitou, K. Moriwaki and S. Sakurai. 1990. Differentiation of restriction sites in ribosomal DNA in the genus Apodemus. Biochem. Genet. 28 : 137-149. Suzuki, H., K. Tsuchiya, M. Sakaizumi, S. Wakana and S. Sakurai. 1994b. Evolution of restriction sites of ribosomal DNA in natural populations of the field mouse, Apodemus speciosus. J. Mol. Bvol-3o. 107—1k2: Tegelstrém, H. 1987. Transfer of mitochondrial DNA from the northern red-backed vole (Cleth- rionomys rutilus) to the bank vole (C. glareolus). J. Mol. Evol. 24 : 218—227. Tsuchiya, K. 1981. On the chromosome variations in Japanese cricetid and murid rodents. Honyur- ui Kagaku [Mammalian Science] 42 :51—58 (in Japanese). Wakana, S., IT. Watanabe, T., Hayashi, T. and Tomita, Y. 1986. A variant in the restriction endonuclease cleavage pattern of mitochondrial DNA in the domestic fowl, Gallus gallus domesticus. Animal Genet. 17: 159—168. Wilson, A. C., R.L.Cann, S.M. Carr, M. George, U. B.Gyllensten, K. M. Helm-Bychowski, R. G. Higuchi, S. R. Palumbi, E. M. Prager, R. D. Sage and M. Stoneking. 1985. Mitochondrial DNA and two perspectives on evolutionary genetics. Biol. J. Linn. Soc. 26 : 375—400. Yonekawa, H., K. Moriwaki, O. Gotoh, N. Miyashita, N. Matsushima, L. Shi, X.-L. Zhen and Y. Tagashira. 1988. Hybrid origin of Japanese mice “Mus musculus molossinus” : evidence from restriction analysis of mitochondrial DNA. Mol. Biol. Evol. 5:63—78. Yoshida, I., Y. Obara and N. Matsuoka. 1989. Phylogenetic relationships among seven taxa of the Japanese microtine voles revealed by karyological and biochemical techniques. Zool. Sci. 6: 409 — 420. (accepted 15 July 1996) ‘ f ide is ai vs 7 — ~ D} ay ; : ; ae oy Nee 7 y ys ew os ; =J0 af ae “ahah p va = {rae Z se es, nll ; savant eee io ae pa Me Ming aii 4 sneak RE os rs al ie Mammal Study 21: 27-35 (1996) © the Mammalogical Society of Japan Home range of female sika deer Cervus nippon on Nozaki Island, the Goto Archipelago, Japan Akira ENDO and Teruo DOI Department of Biology, Faculty of Science, Kyushu University, Fukuoka 812, Japan Fax. 092-642-2645, E-mail. aendoscb @ mbox. nc. kyushu-u. ac. jp Abstract. The home ranges and habitat preferences of female sika deer (Cervus nippon) on Nozaki Island, in the Goto Archipel- ago were studied by radio-tracking. Six radio-tagged females were tracked continuously during June, August, October and December 1991. Female deer remained in small home ranges including both open and forest habitats throughout the year. These ranges overlapped to a considerable extent, however, indi- viduals moved independently of each other. The females tended to select open habitats from spring to autumn and forest habitats in winter. Key words: dynamic interaction, female sika deer, habitat preference, home range, radio-tracking. Among the Cervidae, intraspecific variation in social systems has been found in species which have extensive geographical distributions. This has previously been discussed in the context of the differences in their habitat preferences (Langbein and Thirgood 1989). The sika deer (Cervus nippon) occurs very widely in Japan, from the cool temperate zone of Hokkaido in the north to the subtropical zone in the Nansei Shoto in the south, and exhibits considerable clinal variation in body size from north to south (Ohtaishi 1986). Intraspecific variation in male mating tactics have also been among populations of sika deer (Miura 1986). According to Davies (1991), it is likely that the variation in spatio-temporal dispersion of female sika deer may affect the intraspecific variation in male mating tactics. Many previous studies have reported on female home ranges in the cooler northern and central parts of Japan (Miura 1977, Maruyama 1981, Shigematsu ef al. 1994, Yabe 1994), but none have been made so far in the warm temperate zone of southern Japan. In the present study, we describe the seasonal changes in size and spacing patterns of home ranges, and the “dynamic interaction” (Macdonald et al. 1980) between individual female sika deer on Nozaki Island, in the Goto Archipelago. STUDY AREA Nozaki Island is a small (740 ha) island situated in the Goto Archipelago, west of Nagasaki Prefecture (33°10’N, 129°8’E), Kyushu. Most of the island is 28 Mammal Study 21: 1996 covered with secondary evergreen broad-leaved forests dominated by Castanop- sis cuspidata, Camellia japonica and Machilus thunbergit. The remainder is covered with young plantations of Pinus thunbergi, bushes of Glochidion obovatum or semi-natural Miscanthus sinensis, Imperata slyndorica and Zoysia japonica grasslands (Kawahara 1983). About 700 deer live on the island (Doi and Endo 1992), varying in density from 0.6/ha in forest to 3.1/ha in open grassland. No hunting or predation occurred during the study period. Home ranges of female sika deer were studied at the Nozaki site (about 30 ha) in the central part of the island, where the density of deer was highest. About 40 females utilized this area. METHODS In 1991, we captured six female deer using bag net traps (Doi et al. 1986) and attached radio neck-collars (50MHz, weight 50 g, ALKITEC Co. Ltd.). Radio-fixes on females were obtained by triangulation with a portable receiver (FT-690, YAESU MUSEN Co. Ltd.), and one or two additional fixes were regularly taken from other points to ensure accuracy. Radio-fixes, dates and times were all plotted on a1: 2500 map. Tracking in 1991 was carried out in June (early summer, parturition season), August (mid-summer, milking-sea- son), October (autumm, rutting season) and December (winter). Tagged deer were radio-fixed at three hour intervals for several days. Since cumulative home range sizes were saturated by the fourth to seventh day, tracking was terminated on the seventh day. The radio-collar on deer F1 fell off before December 1991, thus data was only collected for deer F2 to F6 during December. The home range sizes were calculated using the convex polygon method (Mohr 1947). Seasonal shifts in range use were expressed by the degrees of range overlap (RO) between two seasons. It was calculated as: _ size of range overlap between two months (ha) IRQ= : home range size (ha) The percentage overlap of two home ranges is most useful for identifying spatial distribution (Macdonald et al. 1980). It does not, however, indicate the utilization distribution within the shared parts of overlapping ranges (Doncas- ter 1990). This aspect can be elucidated by testing for the dependency in the simultaneous movements of a pair of individuals (dynamic interaction). Analyses of dynamic interactions between females indicate whether two females are more (positive dynamic interaction) or less (negative dynamic interaction) likely to maintain a certain separation given the configuration and utilization of their home ranges (Doncaster 1990). To test dynamic interaction, a nonparametric comparison was made between the observed distribution of separations between N paired fixes (taken from each animal simultaneously or within 30 minutes of each other), and an expected distribution based on all possible combinations (N?’) of the fixes (Doncaster 1990). A critical separation is chosen within which presence of dynamic interaction is of interest, such as Endo and Doi, Home range of female sika deer 29 the furthest separation at which two females could be aware of each other. Since we have no information about the sensitive distance for sika deer, we determined the critical separation as 20 m based on observations of white- tailed deer (Odocotleus virginianus, Schwede et al. 1993). Expected and ob- seved numbers of paired separations <20 m were compared using the y’ - test (p<0.05). When observed numbers of paired separations <20 m was signifi- cantly greater than expected, it indicates that those individuals tended to move simultaneously. In examining habitat preference, the study area was classified into forest and open habitat types. “Forest” includes secondary evergreen broad-leaved forests and young pine plantations in old crop fields, and “open” includes young Glochidion obovatum bushes in old crop fields, and grasslands dominated by Zoysia japonica in old crop fields and abandoned rice fields. Habitat selection was expressed by Ivlev’s electivity index (£; ; Ivlev 1961). This index was calculated as: E,=(%—N3)/(%+ Ni) where 7; is the proportion of the size of the zth habitat type to home range size in each season, and JN; is the proportion of the size of the 7th habitat type to the annual home range size. RESULTS 1. Size and Spatial Distribution of Female Home Ranges Mean home range sizes ranged from 3.0 to 3.6 ha, and were not significantly different between seasons (Friedman’s test: 7?=0.360, p=0.948, see Table 1). Ranges did not shift seasonally (Fig. 1). The rate of overlap was more than 0.5 and there was no significant difference between seasons (Friedman’s test : eA —).585, Lable 2): Table 1. Seasonal changes in home range size of female sika deer on Nozaki Island. Number of females shown in parenthesis. Home range size(ha) owt Mean == SDN) Tin: 3.47 + 0.57(6) ie 3.27 + 1.25(6) Oct. 3.03 + 0.99(6) DEE. 3.60 + 0.33(5)* *radio-collar of F1 fell off before December 1991. 30 Mammal Study 21: 1996 sere a en JUNE een eee ee AUGUST OCTOBER ---------- DECEMBER 0 100m ANNUAL Fig. 1. Home ranges of six female sika deer (F1-F6). Endo and Doi, Home range of female sika deer Sil FOREST Fig. 2. Annual home rages of six female sika deer (F1-F6) in relation to hatbitat type. 2. Dynamic Interactions of Females Annual home ranges were found to overlap considerably with each other (Fig. 2), suggesting that females permit each other to enter their own ranges, and that they form home range groups (Miura 1976). To evaluate the depen- dency in the simultaneous movements of pairs of females, we analyzed dynamic interactions among them (Table 3). Paired separations of less than 20 m were less frequent than those of more than 20 m for all dyads. Expected and observed number of paired separations <20 m were not significantly different except in one case (Table 3). In this case, only 4 out of 114 (3.5%) observed sepapations were < 20 m, thus evidence of dynamic interactions was limited to just two specific females. Generally, however, there was no dependency in the simultaneous movements of pairs of females, even though their home ranges overlapped. Table 2. Degrees of range overlaps (RO) of female sika deer between seasons. RO was calculated as: size of overlap between two months (ha) / home range size (ha). Numbers of females are shown in parenthesis. Jun.—-Aug. Jun —Oce Jun.--Dec. Jiuns——Oct: Aug.-—-Oct. Oct-Dec Jun. Jun. Jun. Oct Oct. Oct: 0.66+0.19 ORGS == (i wil se0) 1h 0). (2220, 19 0.64+0.07 () Gil ae(0). 1133 (N=6) (N=6) (N=5) (N=6) (N=6) (N=5) Jun.—-Aug. Aug.——Oct. Aug.—-Dec. Uitin Dec Aug.—-Dec. Oct.—-Dec. Aug. Aug. Aug. Dec. Dec. Dec. Os 7Sae0 2! 0.66+0.16 OF60220F5 Q), SilaeO . 133 0.54+0.14 Q) ae 0) 77 (N=6) (N=6) (N=5) (N=5) (N=5) (N=5) 32 Mammal Study 21: 1996 Tabl 3. Frequencies of N paired and N?-N unpaired distances, and those below and over the critical distance of 20 m. Fl F2 PS F4 Ie Paired Unpaired Paired Unpaired Paired Unpaired Paired Unpaired Paired Unpaired 3. Habitat Preference Home ranges of female deer included both forest and open habitats. n.s.: non-significant. F2 F3 F4 F5 F6 <20m 20mS \<20m 20m=" <20m” 20m= ~<20m > 20m= V20nee2 ime 4 116 4 ju 8 120 6 100 5 99 452 13828 356 12984 586 15670 324 10806 39 mhOS2 il x’=0, ns. x7=.053, n.s. H2= 1.84, ns. X2=1.90, u.5. v7?=.132, ns. 1 132 3 141 6 121 2 123 309)» 2 ay 300 20292 332 15670 301 15199 y7=.30, n.s. vy’? =.076, 7.s. v7?=3.12, ns. v7?=0, 1.5. 9 37 4 110 3 109 668 19072 116 =12766 LA 2285 yv7?=2.97, ns. y?=5.794, p<0.05 y?=1.027, x-s. 2 116 2 1122 14 S659 158 15094 v’?=.045, x-s. xv’?=.035, n.s. 7 114 396 14124 yv7?=3.127, ns. The seasonal changes of habitat preference for forest and open habitats were expressed by the electivity index (£,)(Fig. 3). £; for open habitats were positive ELECTIVITY INDEX 0.200 0.100 0.000 -0.100 -0.200 JUN. Fig. 3. AUG. OCT. MONTH DEC. The seasonal changes in habitat preferences. OPEN M FOREST Endo and Doi, Home range of female sika deer BS) from June to October, but significantly negative in December (Friedman’s test : v’=10.680, 6<0.05). In contrast, &; for forests was negative from June to October and positive in December, though they were not significantly different (Friedman’s test: v?=7.800, p>0.05). &; for open habitat was significantly positive in June (Student’s ¢-test, t=3.069, 6<0.05), while it was significantly negative in October (t=3.088, )<0.05). They were not significant in August (t=2.248, p=0.0745) and December (t=-1.895, f >0.05). These results indicate that the females preferred open habitats from June to October and forest habitats in December. DISCUSSION Previous studies on the home ranges of sika deer have been made mainly on populations in the northern and central parts of Japan (Miura 1977, Mar- uyama 1981, Shigematsu et al. 1994, Yabe 1994). ‘This is the first study from southern Japan. The mean size of the annual home ranges of resident females in the Hokkaido population was 325.2 ha (Yabe 1994). In Nikko in central Japan, the monthly home range sizes of males and females varied from 21.0 to 284 ha (Maruyama 1981), and in Chiba Prefecture, the female annual home ranges varied from 46.1 to 246.3 ha (Shigematsu ef a/. 1994). For the Nara population, the mean summer home range was 11.7 ha (Miura 1977). Compared to these results, the home ranges of the Nozaki population were considerably smaller. This difference may result from four factors. First, in the northern areas seasonal migration serves to enlarge home range size, as leaves fall in autumn reducing cover, and as snow cover reduces food availability in winter, deer are forced to move to lower altitudes (Mar- uyama eft al. 1976, Maruyama 1981, Ito and Takatsuki 1987, Takatsuki 1992). On Nozaki Island, in contrast, warm temperature, lack of snow, and the presence of evergreen forests enable the deer to remain in one area all year without migrating. Second, home range size is related to body size. In Hokkaido, adult females weighed about 75.0 kg (Kaji et al. 1988, Yabe 1994), on Mt. Goyo (Takatsuki 1992) and in Chiba about 45.0 kg (Shigematsu ef a/. 1994), whereas the mean body weight of females on Nozaki Island was considerably less at just 32.2+1.6 (SD) kg (N=6). Even when the effect of migration was excluded, home range sizes varied among resident populations. Therefore, the small range size of females on Nozaki Island are a reflection of their smaller body weight. Third, the type of vegetation affects home range size. For resident populations of sika deer, two types of home ranges (small stable type, and large) were reported in Chiba (Shigematsu e?¢ a/. 1994) and in the Ashio popula- tion (Koganezawa and Satake, pers. comm.). The small stable type included Zoysia-type grasslands whereas the large type did not. Shigematsu ef al. (1994) explained this variation by the presence of the highly productive Zoysza- type grasslands enabling the deer to thrive in smaller home ranges. Miyazaki 34 Mammal Study 21: 1996 et al. (1977) suggested that highly productive Zoysza-type grasslands were also an important resource for the Nara deer population. On Nozaki Island, female home ranges also included Zoysza-type grasslands. The electivity index showed their high preference for open habitats in all seasons except winter (Fig. 3). It seems likely that the high productivity of Zoysiza-type grassland facili- tates the use of smaller home ranges by females in the Nozaki population. Finally, deer density reached as high as 3.1/ha (Doi and Endo 1992) on Nozaki Island, which is higher than in other populations. Other studies of natural populations have reported highest densities as just 0.3/ha in Chiba (Ochiai and Asada 1993), 0.5/ha on Nakanoshima (Kaji et al. 1988), 0.6/ha on Kinkazan Island (Ito 1987) and 2.0/ha on Mt.Goyo (Takatsuki 1992). In addition to these four factors, spatial restriction on the island may also be an important factor affecting home range size. Acknowledgments : We are indebted to Professor Y. Ono, of Kyushu University, for reading the manuscript and providing valuable comments. We are also indebted to members of the Laboratory of Ecology for their kind assistance throughout the study. We are very grateful to Dr. H. Grimmett, Mr. D. Bruce Banwell, and Dr. Mark Brazil for their valuable comments and improving the English manuscript. Special thanks are due to the people of Nozaki and Ojika Islands for their kindness during the field work. This study was partly suppor- ted by a Grant-in-Aid for Scientific Research from the Ministry of Education, Science and Culture, Japan (Nos. 6148006 and 03269214) REFERENCE Davies, N. B. 1991. Mating systems. Jn (J. R. Krebs and N. B. Davies, eds.) Behavioral Ecology, An Evolutionary Approach, 3rd. ed. pp. 263—294. Blackwell, Oxford. Doi, T. and A, Endo. 1992. A report on a census of sika deer in Nozaki Island, the Goto Islands. Ojika Town. 9 pp (in Japanese). Doi, T., A. Endo, Y. Ono and C. Torisu. 1986. A simple sika deer bag net trap. Honyurui Kagaku [Mammalian Science] 11:77—79 (in Japanese with English summary). Doncaster, C. P. 1990. Non-parametric estimates of interaction from radio-tracking data. J. Theor. Biol. 143 : 431—443. Ito, T. 1987. Population dynamics of sika deer on Kinkazan Island. In Reports of Research on the conservation plan on the wildlife of Kinkazan island, III]. Miyagi Prefecture, 73 pp (in Japanese). Ito, T. and S. Takatsuki. 1987. The distribution and seasonal movements of sika deer Cervus nippon in the Mt. Goyo area, Iwate Prefecture. Bull. Yamagata Univ. Nat. Sci. 11: 411—430 (in Japanese with English summary). Ivlev. V.S. 1955 (1961). Experimental Ecology of the Feeding of Fishes (transl. by D. Scott). Yale Univ. Press, New Heaven, 302 pp. Kaji, K., T. Koizumi and N. Ohtaishi. 1988. Effects of resource limitation on the physical and reproductive condition of sika deer in Nakanoshima Island, Hokkaido. Acta Theriol. 33: 187— 208. Kawahara, H. 1983. Vegetation of Nozaki-jima, the Gotoh Islands. Bull. Nagasaki Inst. Appl. Sci. 24 : 239—247 (in Japanese with English summary). Langbein, J. and S. J. Thirgood. 1989. Variation in mating systems of fallow deer (Dama dama) in Endo and Doi, Home range of female sika deer 0) relation to ecology. Ethology 83:195—214. Macdonald, D. W., F. G. Ball and N. G. Hough. 1980. The evaluation of home range size and configu- ration using radiotracking data. Jn (C.J. Amlaner and D. W. Macdonald, eds.) A Handbook on Biotelemetry and Radio Tracking. pp. 405—424. Pergamon, Oxford. Maruyama, N. 1981. A study of the seasonal movements and aggregation pattern of sika deer. Bull. Fac. Agric. Tokyo Univ. Agric. Technol. 23, 85 pp (in Japanese with English summary). Maruyama, N., Y. Totake and R. Okabayashi. 1976. Seasonal movement of sika deer in Omote- Nikko, Tochigi Prefecture. J. Mammal. Soc. Japan 5/6: 187—198. Miura, S. 1976. Ecological studies on sika deer in Nara Park with reference to spatial structure. Ann. Rep. Nara Deer Res. Assoc. 2: 47—61 (in Japanese with English summary). Miura, S. 1977. Social studies on sika deer in Nara Park with reference to individual distribution and behavior. Ann. Rep. Nara Deer Res. Assoc. 3: 3—41 (in Japanese with English summary). Miura, S. 1986. A note on evolution and social system in Cervidae. Honyurui Kagaku [Mammalian Science] 53:19—24 (in Japanese). Miyazaki, A., M. Morimoto and T. Morita. 1978. The seasonal changes in yield and chemical composition of Zoysia-type grassland in Nara Park (II). Ann. Rep Nara Deer Res. Assoc. 5: 133—143 (in Japanese with English summary). Mohr, C. O. 1947. Table of equivalent populations of North American small mammals. Amer. Midl. Nat. 37 : 223—249. Ochiai, K. and M. Asada. 1993. Distribution, density and number of sika deer on the Boso Peninsula. In Reports of management for sika deer of Boso peninsula in Chiba prefecture, I. Chiba Prefecture, 48 pp (in Japanese). Ohtaishi, N. 1986. Preliminary memorandum of classification, distribution and geographic variation on sika deer. Honyurui Kagaku [Mammalian Science] 53: 13—17 (in Japanese). Schwede, G., H. Hendrichs and W. McShea. 1993. Social and spatial organization of female white- tailed deer, Odocotleus virgianus, during the fawning season. Anim. Behav. 45: 1007-1017. Shigematsu, Y., K. Ochiai and M. Asada. 1994. Animal tracking by radio-telemetry. Jn Reports of management for sika deer of Boso peninsula in Chiba prefecture, II. Chiba Prefecture, 59 pp (in Japanese). Takatsuki, S. 1992. A report of fundamental study for sika deer of Mt. Goyo, Ill. Ofunato City, 68 pp (in Japanese). Yabe, T. 1994. Management of Wildlife Habitat. Ph. D. thesis, Fac. Agr. Hokkaido Univ., 123 pp (in Japanese). (accepted 28 May 1996) Mammal Study 21: 37-42 (1996) © the Mammalogical Society of Japan Distribution of cardiac musculature in the pulmonary venous wall of three species of the genus Mustela Hideki ENDO, Eiichi HONDO’, Daishiro YAMAGIWA?, Teruhiko WAKAYAMA”, Masamichi KUROHMARU? and Yoshihiro HAYASHI? Department of Zoology, National Science Museum, Tokyo 169, Japan ; ‘Department of Veterinary Anatomy, Faculty of Agriculture, Obihiro University of Agriculture and Veterinary Medicine, Hokkaido 080, Japan ; *Department of Veterinary Anatomy, Faculty of Agriculture, The University of Tokyo, Tokyo 113, Japan Fax. 03-3364-7104 Abstract. An examination was made of the distribution of car- diac musculature in the pulmonary venous wall of three Mustela species (ermine, American mink and ferret) of different body size. Only the ermine possessed cardiac myocytes in the tunica media of the intrapulmonary venous walls continuing from the left atrium, whereas the two other species had the musculature restricted to the large extrapulmonary vein. The distribution of the mus- culature is thought to depend on the body weight and heart rate of various species. These findings confirm the supposition that, whereas smaller mammals have more extensive cardiac mus- culature, even in the intrapulmonary venous wall, in order to regulate venous blood return and to resist reflux resulting from frequent atrial systole, the larger species may not require cardiac musculature in the distal vein. Key words: cardiac myocyte, Mustela, pulmonary vein. Arnstein (1877) and Stieda (1877) reported that striated musculature occurs in the intrapulmonary venous wall of several mammals. Since the late 1870s, it has been accepted that cardiac myocytes are present not only in the heart, but also in the pulmonary venous wall, in various mammals (Favaro 1910, Granel 1921, Karrer 1959a,b, Policard et al. 1959, Klavins 1963, Kramer and Marks 1965, Ludatscher 1968, De Almieda et al. 1975, Endo et al. 1992a,b,1995). Kramer and Marks (1965) suggested that the distribution of cardiac musculatur- e differed between rodent species. This was confirmed by Endo e¢ al. (1992a), who found that among three species of South American rodents differing in body size. The larger species, with lower heart rates, had cardiac musculature restricted just to the large pulmonary veins. So far however, the distribution of this musculature has not been compared among taxonomically closely- related species which would serve to avoid the phylogenetic influence. The group Mustela (Carnivora) provides an eminently suitable opportunity for a study of comparative morphology, as there are various species differing in body size and heart rate within a single genus. In this study, we examined 38 Mammal Study 21: 1996 the ermine (Mustela erminea) which has a body weight of 42-258 g and a heart rate of 300-420 beats/min. ; the American mink (Mustela vison) weighing 681- 2310 g and a heart rate of 216-242 beats/min., and the ferret (Mustela putorius) weighing 500-1500 g and a heart rate of 272-414 beats/min. (Altman and Dittmer 1974, Walker 1983). The aims of this study were to clarify the relation- ship between the distribution of cardiac musculature in the pulmonary vein in relation to body size and heart rate. MATERIALS AND METHODS One ermine (Mustela erminea), two American minks (M. vison) and one ferret (MM. putorius) were examined in this study (Table 1). Because the ermine is very rare, we examined a formalin-fixed specimen, considered to be adult on the basis of its head and body length. No gross lesions were recognized in the heart or lung of animals during macroscopic pathological observation. Table 1. Biological data of the animals used in this study. Species Sex Body Age Head and Origin weight (month) body length (g) (mm) ermine* male = = 174 Minami-Aizu, Fukushima pre. American male 2250 1135 435 maintained mink famale 1100 13 392 (conventional) ferret male 2080 9 420 maintained (conventiaonal) *A formalin-fixed specimen from the National Science Museum (Specimen No. : M16000): the body weight was not recorded and the age has not been determined. The American minks and ferret were euthanized under deep sodium pentobarbital anesthesia. They were perfused with physiological saline. The lung lobes were excised with part of the left atrium, cut into small pieces, immersed in Bouin’s fixative for 2-48 hr and dehydrated in ethanol. The fixed tissues of ermine were immediately dehydrated. The blocks were embedded in paraffin and cut into serial sections at 4 wm. The sections were stained with phosphotungstic acid hematoxylin (PTAH) and/or Heidenhain’s iron hematox- ylin, and observed under a light microscope. RESULTS Cardiac musculature, with its characteristic blue or black PTAH and Heidenhain’s iron hematoxylin stained cytoplasm with its thin layer structure Endo et al., Pulmonary Venous Wall of Mustela 39 peculiar to cardiac myocytes, was easily recognized. In the ermine, cardiac musculature was confirmed to occur in the tunica media of both extra- and intra-pulmonary venous walls (Figs.1-2). A few well-developed circular layers were found in the tunica media. The musculature was observed even in the primary branch of the intrapulmonary vein of about 300 wm in diameter (Fig. 2). In the American mink, cardiac musculature was found in the large extrapulmonary vein (Fig. 3). The musculature consisted of some longitudinal layers between tunica interna and thin fibrous tunica adventitia. However, the layers in the extrapulmonary area gradually diminished in number and disappeared completely in a portion of more than 1 mm in diameter (Fig. 4). In the ferret, the end of the musculature distribution was seen in the extrapul- monary venous wall (Fig.5). The venous tunica media composed of well- developed collagen fibers was thicker than that in the American mink. In the intrapulmonary vein, collagen fibers were observed in the tunica media (Fig. 6), whereas cardiac myocytes were not discerned. DISCUSSION It is suggested that the pulmonary venous musculature may act as a pump and valve regulating the venous blood return and resisting reflux from the left Fig.1. Large extrapulmonary vein of the ermine. Some circular myocyte layers are obser- ved in the tunica media (arrows) ; stained with phosphotungstic acid hematoxylin. Bar :50 pm. Fig. 2. Cardiac musculature is seen in the tunica media of intrapulmonary venous walls of the ermine (arrows). The portion is equivalent to the first branching point in the intrapul- monary vein; stained with phosphotungstic acid hematoxylin. Bar:50 um. 40) Mammal Study 21: 1996 Fig. 3. Longitudinal section of the extrapulmonary vein in the American mink. Longitudi- nal cardiac musculature (M) is well-developed in the tunica media. L, lumen; stained with phosphotungstic acid hematoxylin. Bar: 30 wm. Fig. 4. Extrapulmonary vein at hilus area of the American mink. A few cardiac myocyte layers disappear in this portion (arrow). Collagen fibers are shown in more distal venous wall (arrowhead). C, tracheal cartilage; stained with phosphotungstic acid hematoxylin. Bar: 100 um. -o) Fig.5. Longitudinal section of the extrapulmonary vein in the ferret. The end of the cardiac musculature (M) is shown in the well-developed fibrous tunica media (arrow). L, lumen ; stained with phosphotungstic acid hematoxylin. Bar: 20 um. Fig.6. Small intrapulmonary vein of the ferret. The tunica media is composed of collagen fibers (arrows) ; stained with phosphotungstic acid hematoxylin. Bar:50 um. Endo et al., Pulmonary Venous Wall of Mustela 4] atrium by active contraction (Kramer and Marks 1965, Endo et al. 1992a). From data pertaining to rodents, it seems likely that the distribution of the musculature is dependent on animal body size (Kramer and Marks 1965). Small rodents, with higher heart rates, may require a large area of musculature to assist venous blood return from the pulmonary circulation to the heart. Mammals with body weights of less than 500 g, such as the chinchilla (Chin- chilla laniger), have extensive musculature in the intrapulmonary venous walls (Endo et al. 1992a). In order to demonstrate the musculature area-body size relationship, a study of closely-related species was necessary. The comparative morphology of three Mustela species also demonstrates that smaller mammals, with body weights of less than 500 g, have musculature in the intrapulmonary venous wall, whereas the American mink and the ferret do not, as was indicated in our previous study on larger caviomorphs (Endo et al. 1992a). It is suggested that the extensive venous wall musculature in smaller mammals serves to avoid blood reflux caused by frequent atrial systole. The relationship between musculature distribution and body weight is likely also to be confirmed in groups other than carnivores and rodents in the future. Only one or two animals were used in three species in this study. How- ever, individual variation and sexual dimorphism have not previously been found in the musculature distribution of mammalian species (Kramer and Marks 1965, Ludatscher 1968, Endo eft al. 1992a, b, 1995). Because we excised tissues from normal adult animals in this study, our histological findings indicate musculature distribution typical of each species. In contrast, the Siberian weasel Mustela sibivica differs significantly in body size and weight between males (650-820 g) and females (less than 500 g) (Walker 1983), making it an interesting species for a future study of sexual variation in musculature distribution. Previous histochemical and biochemical studies have confirmed the pres- ence of atrial natriuretic polypeptide (ANP) in the mammalian pulmonary vein and have suggested that the musculature has developed as an endocrine organ secreting ANP (Asai et al. 1987, Larsen et al. 1987, Endo ef al. 1995). It will be interesting to examine whether the pulmonary venous wall in Mustela species may also be an ANP synthesis, storage and secretion organ. Acknowledgements : We wish to thank Dr. Kaoru Kohno of Taiyo Mink Co., Ltd. (Hokkaido, Japan) and Dr. Masaharu Mikuriya, for providing the animals used in this study. Weare grateful to Drs. Junzo Yamada and Nobuo Kitamur- a, and to the staff of the Department of Veterinary Anatomy, Obihiro Univer- sity of Agriculture and Veterinary Medicine, for their valuable assistance in the histology, and to Miss Tomoko Ogoh of the Department of Zoology, National Science Museum, for her support and encouragement throughout this work. REFERENCES Altman, P. L. and D.S. Dittmer. 1974. Heart rate. Jn (P. L. Altman and D. S. Dittmer, eds.) Biology 42 Mammal Study 21: 1996 Data Book. vol. 3. pp. 1688-1692. Federation of American Society on Experimental Biology, Bethesda. Arnstein, C. 1877. Zur Kenntnis der quergestreiften Muskulatur in den Lungenvenen. Zentralbl. Med. Wiss. 15 : 692-694. Asai, J., H. Nakazato, H. Toshimori, S$. Matsukura, K. Kangawa and H. Matsuo. 1987. Presence of atrial natriuretic polypeptide in the pulmonary vein and vena cava. Biochem. Biophys. Res. Commun. 146 : 1465-1470. De Almieda, O. P., G. M. Bohm, M. P. Calvalho and A. P. De Calvalho. 1975. The cardiac muscle in the pulmonary vein of the rat: A morphological and electrophysiological study. J. Morphol. 145 : 409-434. Endo, H., M. Kurohmaru, M. Tanigawa and Y. Hayashi. 1992a. Morphological differences in the musculature of the pulmonary venous wall between three species of caviomorph, the nutria, guinea pig and chinchilla. J. Mammal. Soc. Japan. 17: 111-118. Endo, H., M. Kurohmaru, T. Nishida, S. Hattori and Y. Hayashi. 1992b. Cardiac musculature of the intrapulmonary vein in the musk shrew. J. Vet. Med. Sci. 54: 119-123. Endo, H., M. Motokawa, S. Hattori, M. Yoshiyuki, M. Kurohmaru and Y. Hayashi. 1995. Cardiac musculature of the intrapulmonary venous wall as an endocrine organ of atrial natriuretic polypeptide in the watase’s shrew (Cvocidura watasei) and musk shrew (Suncus murinus). J. Mammal. Soc. Japan. 20: 109-116. Favaro, G. 1910. Il miocardio polmonare. Contributi all’istologia umiana e comparata dei vasi polmonari. Internat. Monatsch. Anat. Physiol. 27 : 375-401. Granel, F. 1921. Sur la musculature striée des veines pulmonaires du rat. Compt. Rend. Soc. Biol. 84 : 291-294. Karrer, H. E. 1959a. The striated musculature of blood vessels. 1. General cell morphology. J. - Biophys. Biochem. Cytol. 6 : 383-392. Karrer, H. E. 1959b. The striated musculature of blood vessels. 2. Cell interconnections and cell surface. J. Biophys. Biochem. Cytol. 8: 135-150. Klavins, J. W. 1963. Demonstration of the striated muscle in the pulmonary veins of rat. J. Anat. Oe DSORVAUL. Kramer, A. W. and J.S. Marks. 1965. The occurrence of cardiac muscle in the pulmonary veins of rodentias Ja Morphole mh als51150) Larsen, T. H., O. Arjamaa, M. Jarvinen and T. Saetersdal. 1987. Immunohistochemical localization of ANP in the pulmonary veins of the rat. Acta Histochem. Cytochem. 20 : 471-476. Ludatscher, R. M. 1968. Fine structure of the muscular wall of rat pulmonary veins. J. Anat. 103: S45 =O0Me Policard, A., A. Collet and S. Prégermain. 1959. La gaine myocardiaque des veines intrapulmonaires éudiée chez le rat au microscopie électronique. Bull. Micr. Appl. 9: 5-9. Stieda, L. 1877. Ueber quergestreifte Muskelfasern in der Wand der Lungenvenen. Arch. Mikr. Anat. WATSZAS SAS. Walker, E. P. 1983. Genus Mustela. In (R.M. Nowak and J. L. Paradiso, eds.) Walker’s mammals of the world, vol. 2, 4th ed. pp. 987-994. Johns Hopkins Univ. Press, Baltimore and London. (accepted 20 December 1995) Mammal Study 21: 43-57 (1996) © the Mammalogical Society of Japan Preliminary study on kinematic gait analysis in mammals Norihisa INUZUKA Department of Anatomy, University of Tokyo, Faculty of Medicine, Hongo, Tokyo 113, Japan Fax. 03-5800-6848 Abstract. The gait of several extant mammals was analyzed so as to provide basic data for the restoration of the terrestrial locomotion of extinct animals. An attempt has been made to establish the correlation between the gaits and the morphological data, as the latter can be obtained even from fossils. Animals walking naturally were recorded on videotape, appropriate frames were then printed for analysis. Five kinds of gaits are illustrated here with supporting graphs. In addition, some diagrams were drawn using variables of the gait cycle, the rhythm of limb work, the rhythm of locomotion and the hindlimb length ratio to the trunk. Changes in the four joint angles during a gait cycle were measured and graphed for comparison with each limb joint among mammals with four typical foot postures. The kind of gait was determined in relation to the limb length ratio, the gait cycle and the position of the center of gravity. The joint angle of limbs is in relation to foot posture. The wrist joint in walking is analo- gous to the knee joint in the degree, direction and timing of flexion. Key words. gait analysis, joint angle, locomotion, mammal, restoration. Some previous studies have been made on mammalian gaits (Sukhanov 1974, Gambaryan 1974, Hildebrand 1976), but not with the purpose of the restoration of the locomotion of extinct animals. There are two possible approaches to the restoration of the terrestrial locomotion of extinct mammals: firstly, to collect and analyze gait data from as many extant mammals as possible, so as to establish correlations between gait and the information obtainable from fossils such as body size, limb proportion and so on. Locomotion speed has not been addressed in this study, because it is difficult to estimate it exactly in extinct species. Secondly, the skeleton of an extinct animal can be mounted so that its limb joints can be moved, so as to confirm whether the assumed limb movements can actually be realized by the skeletal model. A lateral-type limb posture for the desmostylian form which possesses mammalian joint morphological characteristics has been proposed (Inuzuka 1984). Notwithstanding its joint characteristics, if the stylopodium has the reptilian lateral-type limb posture, then the desmostylia should walk in a manner distinct from either reptiles or ordinary mammals. In order to elucidate this situation an attempt was made to analyze the gait 44 Mammal Study 21: 1996 Diagonal sequence Lateral sequence Fig. 1. Sequences of leg movements. a Ce pees sy) of living mammals first. The restoration of locomotion could prove whether the form of a restored skeleton, considered using static methods, is reasonable or not. The frozen moment of an actual step would be best selected as a display pose in exhibition. In this study walking mammals were videotaped, and frames at 1/60 second intervals were analyzed. Six kinds of gait were observed, and correlations between the gait cycle and the gaits, and between the foot posture and the flexion angles of limb joints in walking, became clear. Terms used here relating to locomotion follow Gambaryan (1974), who divided terrestrial quadrupedal locomotion into symmetrical and asymmetrical gaits. Symmetrical gaits are further divided into diagonal, or lateral, sequences depending on the order of footfall (Fig. 1). Table 1. Specimens examined for the gait analysis. Order Family Species English name Primates Cercopithecidae Macaca fuscata Japanese macaque Carnivora Canidae Canis aureus golden jackal Ursidae Ursus arctos brown bear Thalarctos maritimus Polar bear Helarctos malayanus sun bear Ailuropodidae Atlurus fulgens lesser panda Felidae Acinonyx jubatus cheetah Proboscidea Elephantidae Loxodonta africana African elephant Elephas maximus Asiatic elephant Perissodactyla Equidae Equus caballus horse Equus ferus Przewalski’s wild horse Equus grevyi Grevy’s zebra Artiodactyla Hippopotamidae Choeropsis liberiensis pigmy hippopotamus Giraffidae Giraffa camelopardalis giraffe Inuzuka, Gait analysis in mammals 45 MATERIALS AND METHODS Fourteen extant mammal species, representing nine families, and five orders, were videotaped at Ueno Zoo, Tama Zoo, and the Avalon Horse Riding School in Tokyo, Dusit Zoo in Bangkok and the Taklahn “Villege of Ele- phants” in Thailand (Table 1). Animals walking naturally in a cage or a field were recorded on 8mm videotape using a telescopic lens held perpendicular to the ambulatory path, and as level with the animal as possible. A full gait cycle in one direction was selected and edited from among the several series taken. By means of a freeze frame video deck images every 1/60, 1/30 or 1/20 second of a cycle were displayed on a monitor, and successive frames were photographed with a motor-driven camera and printed. These prints were used for the gait ana- lyses. One gait cycle is divided into the rise and fall of each foot, and the length of each phase was calculated from the number of pictures of the phase. The support formula was derived from the change of the number of supporting limbs in a cycle, leading to the gait. The support limb graph was made from the limb name and the supporting time of the limb provided, giving both the limb and locomotion rhythm. For four representative mammals with typical foot postures, the sub-unguligrade Asiatic elephant, the unguligrade giraffe, the digitigrade cheetah and the plantigrade Polar bear, the flexion angles of all four limbs, the elbow, wrist, knee and ankle joints, were measured every 0.1 second so that representative line graphs could be drawn for comparison of each animal and each joint. Because the position of a limb bone cannot be known exactly in life, it is represented by a line divided an angle into two equal parts between two lines representing the anterior and posterior margins of the leg. RESULTS 1. Gait and Support Six kinds of gait were observed. These consisted of five symmetrical gaits: very slow diagonal walk, slow trot-like walk, slow rack-like walk, normal walk and slow trot, and one asymmetrical gait: slow canter. Among the symmetrical gaits, only the slow trot-like walk is a lateral sequence. The slow trot is a trot, and the rest are all diagonal sequences. These gaits, except for the slow trot, are illustrated in Figs. 2-6. The number of each picture corresponds to that of its support graph. The footfalls seen from above are shown with black circles in the middle of the support graphs, and so the upper circles denote the left side and the lower the right side. Four bars are distribut- ed in pairs above and below the footfall formulas, the outer bars corresponding to the hindlimbs and the inner ones to the forelimbs. The crosshatched part of the bar denotes the support phase andthe nonhatched part the free transit 46 Mammal Study 21: 1996 Cogah Ere} Gah ore Cossaf ensad HP777z7AL ALLARD AA PE Bd Fl __ OV AAAI IAL P LAL LAALM AA AALAA@ LAMP AZAD? L ee ee oe a |} R xy ee r) 33 3 &6 ee 66 »> FPP LAs iss essssg~,_. VsLse si sss sty HUZLL4Z SPA FLEE EAE LENE LL LLL LD Pee Oh eGov Oo en 6 Fig.2. Very slow diagonal walk of the pigmy hippopotamus and its support graph. For explanation, see in text. LIL, sLJV ALJ sAAsAHssassssp ssi ssp}, __+l> > -, SILI IVIOINID EOL SC. I III IIIS III I ODI LS. H F L ee ge ry} ee _@ 52 R @ @ @ % rT oo oe »> F (VAAL IVILZABALLALLLLALLZALLALLAL AL H SSeS ESS) [esr eee] (LLLLLLLY L422) COIN IDL OLII ODI ING GOL 1 OP aman Ve BL) 6 7 8 Fig. 3. Slow trot-like walk of the Japanese macaque and its support graph. For explana- tion, see in text. Inuzuka, Gait analysis in mammals 47 i Sah “ya, Ti aps H PIPAILLZZLZVAZAZAZYIAAALAYELSALALALA £2 F Wea lee eer. IIa LS a paz z zzz ay eames 5S a8 R 66 a6 I Sind IAAZALZALZZLZLZA | (FAs s ss sss sssZA ff KK | | WHAAPALAALALALALLLL S| 1 2 3 4 5 6 Z/ Fig. 4. Slow rack-like walk of the Japanese macaque on a downward slope and its support graph. For explanation, see in text. VLLLLLYN £2) LEASES CLL ALLL) an aman) oi) Es ae SSSIISISA SLATE aDADASaaa DSS e H F L 3 Es a 8 co ae zs 2 RRL AEE H SRE SSeS GR II 77 4'F 4 GHTIDS: 4 ae QR @ [pean lc pee: Fig.5. Normal walk of Przewalski’s horse and its support graph. For explanation, see in tox 48 Mammal Study 21: 1996 VLLLLLLALEL AL LLL ALLL, || __] Ee ISIS INI IS ISIE SS) ) eee L e Ree ete OU St Ue es WOSIILIDN ILL Ss SC 77, HUWZZZ2Z227 1 a SOLS LILI LL s io 9°" 4 5" Homans Fig.6. Slow canter of the horse and its support graph. For explanation, see in text. phase. The bar length is determined in proportion to the duration of each phase. 2. Gait Cycle and Limb Rhythm Correlation between the gait cycle and the rhythm of limb work reveals that the latter decreases as the cycle becomes shorter, that is, the duration of limb support shortens, as the walking speed increases (Fig. 7). Correlation between the gait cycle and the hindlimb length ratio to the trunk length reveals that the gait cycle lengthens and the leg length, in proportion to the trunk, shortens, as body size increases in the elephant (Fig. 8). In the carnivores, the cycle tends to be inversely related to the hindlimb length ratio. Inthe diagram (Fig. 9) of examining the correlation between the rhythm of limb work and the rhythm of locomotion, values of 0-5% on the vertical scale correspond to the rack or pace, 5-45% corresponds to the diagonal sequence, 45-55% to the trot, and more than 55% to the lateral sequence. In the diagonal sequence, Fig. 9 reveals that the slow rack-like walk changes to the normal walk as the speed increases. Inuzuka, Gait analysis in mammals 90 85 eo? e ee A An x A A g 75 Q A = 7 ° re) A ys e E o o = 65 £ @ . - 60 o 55 on (2) 0.5 1 1) 2 Gait cycle (sec) A Aa 2.5 eo h6OUhUP 49 very slow walk slow trot-like walk slow rack-like walk normal walk slow trot slow canter 3.5 Fig.7. Scattergram showing correlation between the gait cycle and the rhythm of limb work. 200 180 160 140 e 120 Jackal Hindlimb length ratio to the trunk (%) 100 80 Carnivora Asiatic elephant @ 132 A 132 1.5 Gait cycle (sec) 2D Very slow walk Slow trot-like walk Slow rack-like walk Normal walk Slow trot Slow canter 3.5 Fig. 8. Scattergram showing correlation between the gait cycle and the hindlimb length ratio to the trunk. Numerals show the shoulder heights in cm and M3 refers to age using the last molar. 50 Mammal Study 21: 1996 70 @ 60 Lateral e © ® Elbow joint > @ Wrist joint Se A Knee joint @ Ankle joint @ D S © (2 oO ic Forelimb support phase Ser) ras TS sasllin support Phecee Gait cycle (sec) Fig.10. Joint angles of the sub-unguligrade Asiatic elephant. Time, from the footfall of the hindlimb, is shown on the X-axis, and the flexion angle, from the position of extension, on the Y-axis. In the ankle joint, dorsiflexion is indicated with + and plantarflexion with—. ” Giraffe (unguligrade) 60 22) ® © 50 e oe f S wlhe 2 es . DO) 30 @ © — g ‘ j @ Elbow joint v1 @ Wrist joint : A Knee joint @ Ankle joint Forelimb Supe er pase c Ee -20 Fig.11. Joint angles of the unguligrade giraffe. Time, from the footfall of the hindlimb, is shown on the X-axis, and the flexion angle, from the position of extension, on the Y-axis. In the ankle joint, dorsiflexion is indicated with + and plantarflexion with—. 52, Mammal Study 21: 1996 100 Bias: Cheetah (digitigrade) @ Elbow joint @ Wrist joint a \ A Knee joint D x @ Ankle joint ® o) _ D 60 ® & o) ro 40 (S © = * ; © Forelimb support phase Gait cycle (sec) -40 Fig.12. Joint angles of the digitigrade cheetah. Time, from the footfall of the hindlimb, is shown on the X-axis, and the flexion angle, from the position of extension, on the Y-axis. In the ankle joint, dorsiflexion is indicated with + and plantarflexion with—. a Polar bear (plantigrade) 100 @ 80 ~ ’ 2 < D a 60 S ® 40 oD S © 20 £ | oO : Forelimb support phase ; =) § (je mello __ _Hindlimb support phase 1 ; -20 - / ® -40 : @ Elbow joint e ». fe 60 @ Wrist joint a baa sf A Knee joint - ae) ee po a ‘e 4 . a @ Ankle joint Se Gait cycle (sec) Fig. 13. Joint angles of the plantigrade Polar bear. Time, from the footfall of the hindlimb, is shown on the X-axis, and the flexion angle, from the position of extension, on the Y-axis. In the ankle joint, dorsiflexion is indicated with + and plantarflexion with—. Inuzuka, Gait analysis in mammals 5S} 4. Comparison of Joint Flexion Angles In all species examined, except for the Asiatic elephant, the elbow joint is flexed even during the support phase, and flexes even further during the free transit phase (Fig. 14). The wrist joint is mostly extended during the support phase, except in the plantigrade Polar bear where it is in dorsiflexion. It flexes further in the free transit phase in all species studied, with the greatest variation observed in the elephant and the bear. The change in angle, between the maximum and minimum, for the wrist, is the largest among the four joints (Fig. 15). During the support phase the knee joint is extended in the elephant and the bear, whereas it is flexed in the giraffe and the cheetah. It flexes further in the free transit phase in all species and this motion is most distinctive in the bear. The change in angle, between the maximum and minimum, for the knee, is the smallest among all joints (Fig. 16). The angle of the ankle joint varies little on the whole, though each species is clearly distinct as a result of differences in foot posture. The ankle flexes just before the foot is raised and this motion is most distinctive in the bear (Fig. 17). Comparing the flexion angles of joints during the support phase between species, the orders for the elbow and ankle joints are the same, and as follows: sub-unguligrade < unguligrade < digitigrade < plantigrade. The order for the wrist joint is the exact reverse. The order for the knee is the same as the wrist except in the Asiatic elephant. 90 Elbow joint 80 70 60 Cheetah _ Giraffe 50 Polar bear 40 30 m= Asiatic elephant Flexion angle (degrees) \ support phase free transit phase (sec) -10 Fig. 14. Change of angles in the elbow joint. Time from the footfall of both limbs is shown on the X-axis, and the moment when the foot is raised, is shown by arrows. D4 Mammal Study 21: 1996 3 80 oO L a L 8 Wrist joint < 60 2 x< ® 4 ( © Asiatic a elephant Ps support phase , Cheetah _ free transit phase 0 Mare Stee 2 (sec) S oO 2 Polar bear x< £2 5S LO y) — O QO -60 -80 Fig. 15. Change of angles in the wrist joint. Time from the footfall of both limbs is shown on the X-axis, and the moment when the foot is raised, is shown by arrows. 80 a a Knee joint 70 ¥ . aa .)) % . Giraffe x ~ GS ey a” Asiatic elephant Flexion angle Polar bear 2 (sec) free transit phase Fig. 16. Change of angles in the knee joint. Time from the footfall of both limbs is shown on the X-axis, and the moment when the foot is raised, is shown by arrows. 20 Inuzuka, Gait analysis in mammals — — oO Ankle joint (Ce) Oo Polar bear / Cheetah ~ (2) C54] (o>) Sgn, SS Quang € SEI Wag, SK Giraffe ie) (o) Sak Dorsiflexion angle (degrees) Asiatic elephant : 2 free transit phase a support phase Fig. 17. Change of angles in the ankle joint. Time from the footfall of both limbs is shown on the X-axis, and the moment when the foot is raised, is shown by arrows. DISCUSSION Usually, primates walk using the lateral sequence, making then different from other mammals. However, primates have been observed walking down- hill in a diagonal sequence supporting Iwamoto and Tomita’s (1966) theory that gait type is related to the center of gravity, because the forelimbs support more weight than usual on a downward slope. A diagram of correlation between the rhythm of limb work and the rhythm of locomotion corresponds to a diagram (Fig. 18) by Hildebrand (1976). Common features shared by the Asiatic elephant, giraffe, cheetah and Polar bear are that the wrist joints vary most markedly during a cycle, show marked flexion during the free transit phase, and also that the moment of maximum flexion is earlier in the wrist than in the elbow in the forelimb, and earlier in the knee than in the ankle in the hindlimb. Comparison of flexion angles of joints during the support phase, indicates that: foot posture is closely related to the angles of limb joints; the elbow is analogous to the ankle and the wrist to the knee, and that the sub-unguligrade posture of the elephant is unique. The other results from the comparison of joint angles may be summarized as follows: The knee joint is not so synchronized with the ankle as is the elbow with the wrist. The wrist joint is analogous to the knee joint in the degree, direction and timing of flexion. This is another analogy of fore- and hind- limbs differing from the analogy of the forearm and foot, which explains the 56 Mammal Study 21: 1996 WALK | RUN Se Tr) Pace ® Ww = O © it ” =) 20 5 g = n = & < a : g 40 5 fe) 2 Trot £ im once O ro Zz — LU =) ® 6) : 2 = 2 @W 80 Zz S 5 ® < Oo Q D> O Pace ‘© 00 oS % of cycle that each foot is on the ground Fig. 18. A diagram showing the rhythm of limb work and the rhythm of locomotion after Hildebrand (1976). position of the elbow and knee which appears with the emergence of the mammals. Extrapolating from these results, one of the possible gaits of the desmos- tylian is a very slow diagonal walk using a diagonal sequence. Estimation of locomotion velocity, maximum velocity and gait are subjects for future study. Acknowledgements : | am much indebted to B. Endo, K. Adachi, S. Nishizawa and N. Yaguramaki, of the Department of Anthropology, Faculty of Science, University of Tokyo, for their considerable assistance with the videotape analyses. I am also grateful to M.Okada of the Department of Applied Anatomy, Tsukuba University for providing valuable references, and wish to thank S. Nemoto, K. Sotani and Y. Kawaguchi for collecting the samples. The study was partly supported by a Grant-in-Aid for Scientific Research in 1993 -1995 from the Ministry of Education, Science and Culture, Japan (No. 05804024). REFERENCES Gambaryan, P. P. 1974. How Mammals Run. John Wiley, New York, 367 pp. Hildebrand, M. 1976. Analysis of tetrapod gait : general consideration and symmetrical gaits. Jn (R. H. Herman ef al., eds.). Neural Control of Locomotion pp. 203—236. Plenum Press, New Inuzuka, Gait analysis in mammals Dil York. Inuzuka, N. 1984. Skeletal restoration of the desmostylians: herpetiform mammals. Mem. Fac. Sci., Kyoto Univ. Ser. Biol. 9 : 157—253. Iwamoto, M. and M. Tomita. 1966. On the movement order of four limbs while walking, and the body weight distribution to fore and hind limbs while standing on all fours in monkeys. J. Anthrop. Soc. Nippon 74 : 228—231. Sukhanov, V. B. 1974. General System of Symmetrical Locomotion of Terrestrial Vertebrates and Some Features of Movement of Lower Tetrapods. Amerind, New Delhi, 274pp. (accepted 17 May 1996) Mammal Study 21: 59-63 (1996) © the Mammalogical Society of Japan Short Communication Spatial segregation between the Japanese field vole Microtus montebelli and the Japanese wood mouse Apodemus speciosus on the Naka River flood plain, northern Kanto Kohtaro URAYAMA* Department of Biology, Faculty of Science, Ibaraki University, Mito 310, Japan The Japanese field vole Microtus montebelli and the Japanese wood mouse Apodemus speciosus often occur sympatrically in Honshu and Kyushu, Japan, whereas only A. speciosus occurs in Shikoku and Hokkaido. These two species differ in several ecological features. For example, MM. montebelli inhabits grasslands, including flood plains, and eats mainly grass leaves, stems and roots, while A. speciosus occurs in a wide range of habitats from woodlands and secondary forests to grasslands, and eats nuts, berries, seedlings and insects (Tatsukawa and Murakami 1976). Despite these differences, the two species often occur together in cultivated fields (Kaneko 1973, 1979) and flood plains (Kaneko 1979, Saito et al. 1980, Sasaki et al. 1989). Kaneko (1979) investigated the habitat preferences of the two species using snap-traps in western Honshu, and suggested that A. speciosus was subordinate in habitats where VM. montebel- li predominated. In this study the spatial distribution of M. montebelli and A. speciosus sympatrically inhabiting a flood plain with heterogeneous vegetations is examined and the interspecific interactions between the two rodent species are briefly discussed. STUDY AREA AND METHODS The field study was conducted along the Naka River flood plain, at Mito (36°25’ N, 140°26’ E), central Japan. The vegetation of the study area was heterogeneous dominated by the perennial reed Phragmites communis and the perennial forb Solidago altissima with sparse patches of shorter grasses and forbs (Fig. 1). A total of 64 trapping stations, spaced at seven meter intervals, were set on the flood plain to form an approximately 0.25 ha (49 m X 49 m) open grid (Fig. 1). A single Sherman-type live-trap was placed at each trap station. Traps baited with sunflower seeds and were set at about 17:00 hrs and checked the *Present address: Laboratory of Ethology, Department of Veterinary Medicine, Faculty of Agriculture, Tokyo University of Agriculture and Technology, Fuchu 183, Japan 60 Mammal Study 21: 1996 Pe (3) & Sa Q) Sa (5) Pe (1) & Sa (4) BON OS REOPEN ai ie Ge eke +———+ 7m Fig. 1. Distribution and quantity of the two dominant plants, Phragmites communis (Pc) and Solidago altissima (Sa), in the study area along the Naka River. Numerals in parentheses indicate the coverage class of these two species (0: <1%, 1: 1-10%, 2 : 10-25%, 3: 25-50%, 4: 50S (a0, D2 (a= l00%6): following morning at about 08:00. Trapping took place 13 times during the period from 6 June to 18 July 1991. All individual MM. montebelli and A. speciosus caught were sexed, weighed (to the nearest 0.5 g with a spring balance) and marked individually by toe-clipping. The trap location was also noted. Trappings were repeated every two or three days during the research period. Microhabitat segregation between M. montebelli and A. speciosus was examined using multiple regression analysis based on the total number of captures at each trap station for M. montebelli (variable X,) and for A. speciosus (variable X,) and the coverage class (0: <1%, 1: 1-10%, 2: 10-25%, 3: 25-50%, 4:50-75%, 5: 75-100%) of two dominant plants, Solidago altissima (variable X;) and Phragmites communis (variable X.). In the analysis for /. montebelli the criterion variable was X, and the explanatory variables were Xz, X; and X,, and for A. speciosus the criterion variable was X, and the explana- tory variables were X,, X3 and X4. Urayama, Spatial segregation of voles and mice 61 RESULTS AND DISCUSSION A total of 318 captures of 78 individuals were made during the study, of which 261 captures (82.1%) of 63 individuals were of M. montebelli and 56 captures (17.6%) of 14 individuals were of A. speciosus. The only other small mammal captured was a single (0.3%) Japanese white-toothed shrew (Crocidur- a dsinezumt). Population densities, estimated using the Jolly-Seber method, for both species from 6 June to 18 July showed little fluctuation, with mean densities of 126.2+8.1 (SD)/ha for M. montebelli and 24.2+5.7/ha for A. speciosus. Kanamori and Tanaka (1968) suggested that the typical population density of M. montebelli was 50 /ha, while the maximum density so far reported was 1120 /ha on the flood plain of the Tone River (Kitahara 1980). The density of the Naka River flood plain population is known to have been 171 /ha in the autumn of 1990 (Inada, pers. comm.). The population density of A. speciosus is generally fairly constant within a range of 10-50 /ha (e.g., Murakami 1974, Doi and Iwamoto 1982). In the present study, the population density of WM. montebelli was somewhat higher than the typical level, while that of A. speciosus was relatively low, indicating that W/. montebelli was the predominant species in this area. The mean lengths of home ranges (based on the minimum polygon method) of individuals caught more than four times during the research period were 16.145.4 (SD) m for M. montebelli and 26.6+8.8 m for A. speciosus. The facts that the mean range lengths for both MW. montebelli and A. speciosus were longer than the distances between neighboring traps (7 m), and that the home ranges of most animals included several trap stations, suggest that multi-collisions of animals at each trap station was not so frequent as to greatly affect the observed number of captures. Captures of A. speciosus were concentrated along southern and eastern edges of the grid, whereas WM. montebelli was less frequently captured there than in other parts of the area (Fig. 2). The number of M. montebelli captured at each station was negatively correlated with that of A. speciosus (vy =0.496, n=64, p<0.001). Multiple regression analysis showed that the most important variable determining the spatial distribution of WM. montebelli was the presence of S. altissima (X;), while the most important variable affecting A. specizosus was the distribution of MM. montebelli (X,)(Table 1). These results support Kaneko’s (1979) conclusion that A. speciosus hardly intrudes into microhabitats where M. montebelli is predominant. The present results also support Kaneko’ s (1982) supposition that M. montebelli is the dominant rodent in Tohoku, Kanto and Chubu districts, while it is subordinate from Kansai to Kyushu districts. 62 Mammal Study 21: 1996 (a) M. montebelli N=261 (b) A. speciosus N=56 = INS OY CN SS) C9 MPN wWw BH A NX Oo A -B-C Di EE eiGeer 1 2.3 4 '5. 6 7 3 eeomnG Fig. 2. Total number of captures at each trap station for (a) Microtus montebelli and (b) Apodemus speciosus between 6 June and 18 July 1991. Circle sizes indicate the number of voles and mice captured. Acknowledgments : | thank Dr. J. Kojima for his valued comments on an earlier draft of the manuscript, and Dr. H. Tamura, Dr. H. Morino and Mr. T. Inada for their helpful suggestions throughout the study. I am also grateful to anony- mous reviewers for valuable comments on the manuscript. Table 1. Results of the multiple regression analysis on the spatial distribution of Microtus montebelli and Apodemus speciosus at each trap station of the study grid. Variables X,, X2, X; and X, are the number of MM. montebelli and of A. speciosus captured and the degree of coverage of Solidago altissima and of Phragmites communis, respectively. Criterion Explanatory Regression Standerd ple ae Za Propeller variable variable coefficient error M. montebelli xe -().596 0-200 2.878 60 0.006 (X,) xe =i085 0.314 3 aS 60 0.001 X4 -0.569 0.296 G22 60 0.059 A. speciosus xe -0.204 0.071 2.878 60 0.006 (X;) X3 0.229 0.199 1.150 60 ORZ55 X, 0.156 OPM 0.877 60 0.384 Urayama, Spatial segregation of voles and mice 63 REFERENCES Doi, T. and T. Iwamoto. 1982. Local distribution of two species of Apodemus in Kyushu. Res. RopulsEcoleZ4= 1022: Kanamori, M. and R. Tanaka. 1968. Studies on population ecology of the vole, Microtus montebelli, in mountain grasslands of Sugadaira and its adjacent areas. I. Results of research on five populations in 1966-1967. Bull. Sugadaira Biol. Lab. Tokyo Kyoiku Univ. 2:17—39 (In Japanese with English summary). Kaneko, Y. 1973. Geographically small scale distribution of Japanese meadow mice, Microtus montebelli. Distribution pattern of small rodents in the alluvial area of Kyoto City. Mem. Fuc. Educ., Kagawa Univ. II (224): 1—13 (In Japanese with English abstract). Kaneko, Y. 1979. Habitat preference of Apodemus speciosus and Microtus montebelli in lowland habitats in western Honshu and northern Shikoku, Japan. J. Mammal. Soc. Japan 7 : 254— 260. Kaneko, Y. 1982. An approach to distribution studies in Japanese small field rodents. Honyurui Kagaku (Mammalian Science) 43°44: 145—160 (In Japanese with English summary). Kitahara, E. 1980. Notes on ecological respects of high dense Microtus population. J. Mammal. Soc. Japan 8: 144—147 (In Japanese with English abstract). Murakami, O. 1974. Growth and development of the Japanese wood mouse (Apodemus speciosus). I. The breeding season in the field. Jpn. J. Ecol. 24:194—206 (In Japanese with English synop- Sis). Saito, T., K. Machida, S. Inoue and M. Takahashi. 1980. Reproductive activity of Microtus montebel- li at Okegawa City in Saitama Prefecture. J. Mammal. Soc. Japan 8: 122—128 (In Japanese with English abstract). Sasaki, M., T. Saito and M. Takahashi. 1989. Small mammal fauna of Okegawa City in Saitama Prefecture. Bull. Saitama Mus. Nat. Hist. 7:25—32 (In Japanese with English abstract). Tatsukawa, K. and O. Murakami. 1976. On the food utilization of the Japanese wood mouse, Apodemus speciosus (Mammalia: Muridae). Physiol. Ecol. Japan 17:133—144 (In Japanese with English synopsis). (accepted 3 March 1996) Ee “Hiei, ee % < relive ini el alae "2 oki alagos a — nck Sli ae c j Ki ri x ae hy sta each Sc bonne eet oti m sepern i re 1 day -- fe rset fit VO: a sowie ® sa — ney =< = Mammal Study 21: 65-69 (1996) © the Mammalogical Society of Japan Short Communication Longevity of captive shrews in Hokkaido Satoshi OHDACHI* Institute of Low Temperature Science, Hokkaido University, Kita-ku, Sapporo O60, Japan Fax. 011-706-7142, E-mail. ohdachi @ bio. hokudai. ac. jp Information concerning the longevity of animals is invaluable for various biological studies. The longevity of some shrew species (Soricidae) has been reported both from the wild and in captivity (Churchfield 1990). Churchfield (1990) also showed that captive shrews tended to live longer than those in the wild in general, because of the preferential conditions in the laboratory. For a shrew species of Hokkaido, Inoue (1990) reported a maximum estimated life span of 511 days for Sovex unguiculatus in the field. For S. unguiculatus in captivity, Yokohata (1989) reported a maximum keeping period of 493 days and estimated that the oldest might live for 710-830 days. However, longevity for Sorex caecutiens and S. gracillimus, other common soricine species in Hokkaido, is little known. In the present study, all the three species were kept in the laboratory, slightly modifying Yokohata’s (1989) rearing method. The purpose of the present study is to report the longevity of captive Sorex caecutiens and S. gracillimus along with that of S. unguiculatus. MATERIALS AND METHODS 1. Animals examined Shrews were collected in June 1992 and 1993 from Tomakomai (Yufutsu moor), and in June 1992 and August 1993 from Horonobe near the Teshio Experimental Forest of Hokkaido University. The methods of capturing shrews were essentially the same as those described by Ohdachi (1992). Seven- teen S. caecutiens, 22 S. gracillimus, and 28 S. unguiculatus were used for analy- SIS. The animals examined for the present report were originally used for behavioral laboratory experiments (Ohdachi 1994, 1995a, b). During the exper- iments, laboratory conditions were maintained at either 16L8D, 20°C or 10L14D, 9-15°C. After the experiments, the animals were kept in order to record their longevity, but photoperiodic cycle was no longer controlled. Mixed paste diets of pork meat, pork liver, canned tuna, dog food and rabbit pellets were supplied every day. In addition to the mixed pastes, living mealworms (Tenebrio sp.), living earthworms and frozen silkworm pupae (Bombyx mori) were given occasionally. The supplementary natural foods seemed to contribute to the *Research Fellow of the Japan Society for the Promotion of Science 66 Mammal Study 21: 1996 greater longevity of these captive shrews. Animals that were sexually im- mature when captured experienced neither copulation, pregnancy, nor parturi- tion during their lives. The most significant difference between Yokohata’s (1989) rearing methods and those in the present study was that I always kept cages clean while Yokohata did not. See Ohdachi (1994) for more detailed methods. 2. Estimation of Longevity Two methods for estimating longevity were used depending on the age of the shrews when captured ; the first is for young of the year, and the second for individuals that have overwintered. Ages at capture were assessed on the basis of wear to hair and body weight (Abe 1958, Ohdachi and Maekawa 1990). The young shrews that were caught were all considered to be fully indepen- dent from their mothers. Inoue (1990), who reviewed the literature concerning lactation periods (~the period from birth to independence) of six soricine species (Sovex cinereus, S. vagrans, S. araneus, Cryptotis parva, Neomys fodiens and Blarina brevicauda), concluded that the lactation periods ranged from 16 to 30 days. Inoue (1990) also estimated that the lactation period of S. un- guiculatus in the field averaged 27.6 days. Churchfield (1990) considered that the period from birth to complete independence in S. avaneus lasted 25 days. In the light of these studies, it is assumed that for the three soricine species in Hokkaido, the period from birth to independence averages 25 days. Therefore, in order to estimate the life span of the individuals that were captured as youngsters, 25 days were added to their survival periods in the laboratory, thus, giving a minimum estimate of longevity, as 25 days is the estimated minimum age of the young animals captured from the wild. Most soricine species bear young from spring to autumn (mostly in spring) and new-born individuals, usually, do not become sexually mature until the following spring (e.g., Crowcroft 1957, Churchfield 1990). In S. unguiculatus of central Hokkaido, most females bear offspring between April and September (Inoue 1990). Pregnant female S. caecutiens and S. gracillimus were recorded no later than in late September, although some females are known to survive until November (Ohdachi unpublished data). It is assumed, therefore, that the last possible birth date of shrews in Hokkaido is October Ist. Thus, in order to estimate the age of shrews that were captured after they had overwintered (z.e., sexually mature individual), the period from October lst of the previous calendar year to the date of capture was added to the period survived in the laboratory. Again, this method of estimation provides only a minimum life Span, since the estimated period survived in the wild is also a minimum. RESULTS AND DISCUSSION Most wild-captured shrews were successfully introduced into the labora- tory, although several died during transportation. Two out of 17 S. caecutiens, 2 out of 22 S. gracillimus, and 4 out of 28 S. unguiculatus which were success- Ohdachi, Longevity of shrews 67 fully introduced to the laboratory died within the first week. Most S. caecutiens and S. unguiculatus which survived the first week in the laboratory survived for more than 100 days. In contrast, 13 out of the 20 surviving S. gracillimus died within 100 days (mean = 52.4 days). In most cases, animals died suddenly without apparent symptoms, and the cause of death were un- known. The maximum estimated life span for S. caecutiens was 609 days, for S. gracillimus 419 days and for S. unguiculatus 946 days (Fig. 1). The maximum life span for S. caecutiens would, in fact, have been longer, had it not died as a result of its water supply failing. The maximum of 946 days for S. un- guiculatus reported here is one of the longest life span records among the Soricinae (Churchfield 1990). Churchfield (1990) pointed out that larger shrew species tended to live longer than smaller species, which seems to be related to activity and basal metabolic rates. S. unguiculatus is the largest species and S. gracillimus the smallest among the three species in Hokkaido, and in the present study S. gracillimus tended to live shorter lives than the other two species (Fig. 1). It seems, therefore, that interspecific differences in the maximum estimated life spans of Hokkaido shrews seems to be related to body size, as pointed out by Churchfield (1990). Acknowledgments : Students at the Institute of Low Temperature Science and the Laboratory of Applied Zoology, Faculty of Agriculture, Hokkaido Univer- sity, especially Y. Yamaga and K. Nishimura, kindly assisted me in taking care of the shrews. T.Segawa and H. Ishii, and other technicians of the Institute made devices for keeping the shrews. Dr. K. Sasa, Dr. K. Ishigaki, T. Shida, A. Nishihara, and H. Takemoto supported my field work, and Dr. Y. Yokohata made useful suggestions for keeping shrews. I express my deep gratitude to all of them. 68 Mammal Study 21: 1996 S. caecutiens | a rere eee | C10 Ege || Bi di! 2j,t di? ad.? 2j,t st 609 days ! 3a,h ] st ! 419 days Mi life span in laboratory [_] minimum period in the field | 3a,h 29 3a,h 3a,h open AA 2j,t 2j,t 2j,h f) 2a,h | 2a,h 3a,h 3a,h 3a,h 2j,t 2j,h 2a,h 2a,h o& | 3ah 3a,h 3a,h 3a,h 3a,h ' 946 days St J :di (euthanasia by ether) 0 200 400 600 800 1000 days Fig.1. The estimated longevity of three species of Sovex in captivity in Hokkaido. Black bars indicate the actual period shrews survived in the laboratory, and white bars indicate the estimated minimum duration in the field (see text for calculation). Young animals surviving fewer than 100 days in the laboratory were omitted from the figure. Letters to the left of the bars indicate dates of capture and localities (“2j, t” = June 1992 in Tomakomai, “2j, h” = June 1992 in Horonobe, “2a, h” = August 1992 in Horonobe, and “3a, h” = August 1993 in Horonobe). Letters to the right of the bars record the causes of death (ac = accidental kill, di = disease, st = starvation or a lack of water, in = injured, and no letter = unknown). Double sex symbols denote sexually mature animals when captured, and single ones immature animals (ad.? = sex-unknown but mature individual). Ohdachi, Longevity of shrews 69 REFERENCES Abe, H. 1958. Individual and age variation in two species of genus Sovex, Insectivora in Hokkaido. Mem. Facul. Agr., Hokkaido Univ. 3: 201—209. Churchfield, S. 1990. The Natural History of Shrews. A & C Black Ltd., London, 178 pp. Crowcroft, P. 1957. The Life of the Shrew. Max Reinhardt, London, 166 pp. Inoue, T. 1990. Study of Social Structure and Life History of Sovex unguiculatus Dobson. A Special Reference to Sexual Variation in Dispersal of the Young. Ph. D. dissertation at the Graduate School of Agriculture, Hokkaido University, Sapporo, 134 pp. (In Japanese). Ohdachi, S. 1992. Home ranges of sympatric soricine shrews in Hokkaido, Japan. Acta Theriol. Sf 3 QUO Ohdachi, S. 1994. Total activity rhythms of three soricine species in Hokkaido. J. Mammal. Soc. Japan 19: 89—99. Ohdachi, S. 1995a. Burrowing habits and earthworm preferences of three species of Sovex in Hokkaido. J. Mammal. Soc. Japan 20: 85—88. Ohdachi, S. 1995b. Comparative Ecology and Ethology of Sympatric Soricine Shrews in Hokkaido: A Special Reference to Their Interspecific Interactions. Ph. D. dissertation at the Graduate School of Science, Hokkaido University, Sapporo, 116 pp. Ohdachi, S. and K. Maekawa. 1990. Relative age, body weight, and reproductive condition in three species of Sovex (Soricidae ; Mammalia) in Hokkaido. Res. Bull. Coll. Exp. For., Facul. Agr., Hokkaido Univ. 47 : 535—546. Yokohata, Y. 1989. Rearing of big-clawed shrew, Sovex unguiculatus. Honyurui Kagaku [Mam- malian Science] 29: 23—28 (In Japanese with English summary). (accepted 14 June 1996) Reviewers of the Journal of the Mammalogical Society of Japan, Volumes 18-20 The Editorial Board thanks the following persons for reviewing manu- scripts. Hisashi Abe Motokazu Ando Shusei Arai Minoru Asahi John M. Bedford Katsuhiro Fukuda Nobuo Goto Masashi Harada Noriko Hayashi Hirofumi Hirakawa Akira Hirotani Shin-Ichi Horino Tetsuji Hosoda Hiroshi Ikeda Yoshiharu Imaizumi Tadayuki Inoue Nobuo Ishii Shis-ichi Iwasaki Masako Izawa Koichi Kaji Noriyuki Kaneko Nobuo Kanzaki Mieko Kawamichi Takeo Kawamichi Yoshinari Kawamura Eiji Kitahara Ryousuke Kishimoto Yuko Koike Ryo Kusunose Tsutomu Mano Shingo Miura Tetsuo Morita Okimasa Murakami Keisuke Nakada Yoshitaka Obara Keiji Ochiai Senichi Oda Teruki Oka Minoru Onchi Keiichi Onoyama Takashi Saitoh Tsuneo Sekijima Satoshi Shiraishi Hitoshi Suzuki Norihisa Takaragawa Seiki Takatsuki Naoyuki Takemura Naoyuki Take Masahiko Takeuchi Hidetoshi B. Tamate Tsutomu Tanikawa Mikihiko Tokuriki Kimiyuki Tsuchiya Kouji Uraguchi Tsuneaki Yabe Masami Yamanaka Yasushi Yokohata Mayumi Yokoyama Mizuko Yoshiyuki 8 °L “9 °G ‘bE ST SSIA ‘ZIT ‘TIT “dd : z soquiny “0z owmyjo, WINE INSTRUCTIONS TO CONTRIBUTORS The Mammal Study (the continuation of the Journal of the Mammalogical Society of Japan) publishes original Articles and Short Communications, written in English, on all aspects of mammalogy. In principle, membership of the Society is a prerequisite for the submission of papers, but non-members may be co-authors. Manuscripts are submitted to qualified referees for critical scientific reviewing. Authors are notified, with referees’ comments, on acceptance, rejection or need for revision. The editor also customarily sends manuscripts to qualified reviewers for English editing. Manuscripts should be submitted typewritten on one side of the paper (use A4 21.0 cm X 29.7 cm paper), and double-spaced. An approximately 3 cm margin should be left on all sides. Do not hyphenate words at the right margin. Manu- scripts should be arranged in the following order: the title, name(s) of author(s) and affiliation, fax number and E-mail number if available, abstract (fewer than 200 words) and key words (five words or fewer), main text, acknowledgments, references, tables, figure legends, figures. Titles of papers must be accurate and concise, and (for abstraction services) include any relevant taxonomic name. A Japanese title and a Japanese abstract should be written on separate sheets. Text pages should be numbered through from title to references. Manuscripts should be line-numbered, every five lines, in the left margin. Short Communications do not exceed four printed pages. Abstracts and key words are omitted from Short communications. Tables and figures should be simple and self-explanatory, and their preferred locations should be indicated in the right margin of the text. The ratio of tables and figures to text pages cannot exceed 1:2 and they should be as few as possible. The author’s name and figure numbers should be written on the back of original figures and on the surface of copies. Scientific names should be underlined. All measurements should be in metric units. The following abbreviations should be used. Length : km, m, cm, mm, etc. ; eaealanamimea nec: volumes km, m->. kil milk etce.; weight: ke. o mes. etc. : HiMmMerminemiin Sec, etc; others: cal, keall (C, Hz, p (orobability), SD) SE, etc. Arabic numerals should be used for numbers exceeding 10. References in the text should follow the forms: “Uchida and Shiraishi (1985) stated that ...” (Abe and Kawamichi 1990), and (Miura et al. 1993). More than one reference within the same parentheses should be listed chronologically, alphabeti- cally if of the same year. Full references cited must be listed alphabetically by the first author according to the following examples: Abe, H., S. Shiraishi and S. Arai. 1991. A new mole from Uotsuri-jima, the Ryukyu islands. 3. Mamme: Soc. Japan 15: 47—60: Hisenberg, J. F. 1981. The Mammalian Radiations. Univ. of Chicago Press, Chicago, 610 pp. Geist, V. 1982. Adaptive behavioral strategies. Im (J.W. Thomas and D.E. Toweill, eds.) Elk of North America. pp. 219—277. Stackpole, Harrisburg. Obara, Y. 1991. Karyosystematics of the mustelid carnivores of Japan. Honyurui Kagaku [Mammalian Science] 30: 197—220 (Gn Japanese with English abstract). Authors are recommended to refer to recent issues of the journal for details of style and layout. Manuscripts should be submitted in triplicate, with a separate sheet giving the title, author(s) name(s) and address(es) for editorial correspondence, a running head (fewer than 20 letters), the numbers of main text pages, tables and figures, and the number of copies of reprints requested. Galley proofs will be sent to the author. Reprints may be purchased in blocks of 50. Mammal Study 7 Vol. 21, No.1 September 1996 CONTENTS ORIGINAL PAPERS , Kaneko, Y : Age variation of the third upper molar in Eothenomys smithi SCHOSSCSOHSHSHSHSHSSSHOHHOSHHSHOHOHSEHHOCHOHOHSHOHSHHHOHSHSOHHHOHSHSHOHOHHEHOHHSHSETHHOHOHHHEHHOHEHHHOHSHOHSTEHHHOHOHSHHOESOHOHHOHHOSOHOHHSHSHOCTEESSEZESEO Wakana, S., M. Sakaizumi, K. Tsuchiya, M. Asakawa, S.H. Han, K. Nakata and H. Suzuki: Phylogenic implications of variation in rDNA and mtDNA in red-backed voles collected in Hokkaido, Japand and Korea ***:**+*++++**+* Endo, A. and T. Doi: Home range of female sika deer Cervus nippon on Nozaki Island, the Goto Archipelago, Japan 0010 0 © 0) 0's 0/0 ele 0 «10 0/0 c101p e0\0/0\0 010/0 c10)0)s)eleleloleleleiele)eleleleinletelarelelatelstetata Endo, H., E. Hondo, D. Yamagiwa, T. Wakayama, M. Kurohmaru and Y. Hayashi: Distribution of cardiac musculature in the pulmonary venous wall of three species of the genus Mustela p0000000000 Felelelelclelalelcloleleletelelelelalalolclaletalalctalalaleteteleletetete Inuzuka, N: Preliminary study on kinematic analysis in mammals **°***+***+***** 3 SHORT COMMUNICATIONS . Urayama, K: Spatial segregation between the Japanese field vole Microtus montebelli and the Japanese wood mouse Apodemus speciosus on a flood — plain of the Naka River, northern Kanto «ois oo dave sieldleidie « 0 b.ce ocic.cieniee ae teen Ee ee eee Ohdachi, S: Longivity of captive shrews in Hokkaido °-:-:- SER GUE DODSboSuocab coos. occa. | The Mammalogical Society of Japan su a ey sei Beare * = | The Continuation of the Journal of the Mammalogical Society of Japan b& E ‘Y, “a, pice > OGIcaL soc’™ The Mammalogical Society of Japan’ THE MAMMALOGICAL SOCIETY OF JAPAN OFFICERS AND COUNCIL MEMBERS FOR 1995 — 1996 President : Satoshi Shiraishi Secretary General : Takanori Mori Executive Secretary : Shusei Arai Treasurers : Seiji Ohsumi, Toshiro Kamiya Council Members : Hisashi Abe, Minoru Asahi, Kimitake Funakoshi, Yu- kibumi Kaneko, Takeo Kawamichi, Shingo Miura, Okimasa Murakami, Hideo Obara, Noriyuki Ohtaishi, Takashi Saitoh, Seiki Takatsuki, Kazuo Wada The Mammalogical Society of Japan publishes original papers in two journals: the Mammal Study (the continuation of the Journal of the Mammalogical Society of Japan) for papers written in English, and Honyurui Kagaku |Mammalian Science] for those submitted in Japanese. Each jour- nal is published twice a year. Submissions are considered on the understand- ing that they are being offered solely for publication by the Mammalogical Society of Japan. In principle, authors submitting articles to the journals should be members of the Mammalogical Society of Japan. Both journals are distributed free of charge to the members of the Society. The following are the annual dues for the membership : Domestic members ¥7,000 (Student ¥6,000) Overseas members US $60.00 Institutional subscriptions ¥20,000 All correspondence regarding application for membership, subscription, address change, and other matters should be addressed to: The Mammalogical Society of Japan Business Center for Academic Societies of Japan, Academic Society Center C21, 16-9 Honkomagome, 5-chome, Bunkyo-Ku, Tokyo 113, Japan Mammal Study : the continuation of the Journal of Mammalogical Society of Japan Editor-in-Chief : Seiki Takatsuki Editorial Secretary : Yukihiko Hashimoto, Masamichi Kurohmaru Editorial Board: Mark A. Brazil, Hideki Endo, Hirofumi Hirakawa, Toshio Kasuya, Takeo Kawamichi, Shingo Miura, Takashi Saitoh, Hitoshi Suzuki, Hidetoshi Tamate All correspondence regarding manuscripts and editorial matters should be addressed to: Dr. Seiki Takatsuki The University Museum, The University of Tokyo, Hongo 7-3-1, Bunkyo -ku, Tokyo 113, Japan Lax 03 .o0l5—(0as. e-mMalle waka @ sum U-tokyonacamm Mammal Study 21: 71-87(1996) © the Mammalogical Society of Japan Habitat factors affecting the geographic size variation of Japanese moles Hisashi ABE Laboratory of Applied Zoology, Faculty of Agriculture, Hokkaido University, Sapporo O60, Japan Abstract. Japanese moles of the genus Mogera show remarkable geographic variation in body size. In order to determine which habitat factors affect them, 260 specimens of Mogera imaizumii were collected from 27 localities, 280 specimens of /. wogura were collected from 23 localities, and 41 specimens of M/. tokudae were obtained from two localities. The relationships between size, geographic location and seven habitat factors consisting of habitat (rice field) area, soil hardness, and five meteorological compo- nents, were analyzed. All three species showed a positive correla- tion between greatest skull length and habitat area. Populations of M. imaizumi from areas with heavy snow were significantly smaller than those from areas with little or no snow and this variation was also explained by the negative correlation with total annual precipitation. In addition, the size of M. zmaizumzi varied positively with the variation in annual mean temperature. In the correlation between skull size of WM. wogura and habitat area, there was a significant difference in the Y-intersept between the popula- tions from central Honshu and those from southern Honshu, Shikoku and Kyushu. This variation was well explained by the negative correlation between skull size and mean minimum temp- erature. This variation, however, was not constant across all populations examined, because M. wogura were smaller in narrow valleys, even where mean minimum temperatures were low. Key words. geographic size variation, habitat factors, Mogera. Three species of Mogera, M. wogura, M. imaizumiit and M. tokudae occur in Japan (Abe 1995, Motokawa and Abe 1996). MM. wogura occurs in the southern half of Honshu, in Shikoku, Kyushu and smaller islands such as Oki, Tsushima, Goto, Tanegashima and Yakushima. M. itmaizumii occurs mainly in the north- ern half of Honshu and on the small island of Awashima, but also has some scattered relic populations in certain mountainous regions in southern Honshu and Shikoku and on the small island of Shodoshima in the Inland Sea of Japan (Fig. 1). The relic populations are surrounded by populations of M. wogura. M. tokudae is restricted to the central part of the Echigo Plain, Honshu and to Sado Island, located off the west coast of the plain. The ranges of these three species are usually sharply segregated from each other except in some moun- tainous regions with very complicated topographies, as for example in Ashiu, Kyoto Prefecture, and Hiwa, Hiroshima Prefecture (Sagara et al. 1989, Yuka- AD Mammal Study 21: 1996 i T=M. tokudae M=M. imaizumii W=M. wogura f : M1 Noheji = 130° MS Sannai = M6 Jumoji La memege M8 Mogami. M2 Morioka M7 Tachikawa M9 Awashima M11 Echigo M3 Hanaizumi T2 Echigo ; M16 Tokamachi TI ae M4 Semine M19 Joetsu M17 Nozawaonsen M10 Koriyama = =" = — —< —— M18 Nakano — Z M20 Toyama M12 Bange ——} M21 Tsubata _—> W1 Mikawa M13 Takazato _————4 M24 Shiojiri M14 Yanaizu ——— W8 Okinoshima ——e@ M25 Agematsu iste dsen _———4 ae W6 Agematsu ——— W11 Hiroshima M22 Numata ———"— W10 _ Togouchi EJ ~—SCOWW12: Houhoku M23 Sano v4 ad W1 9 ae yereushine W2 Tatsuno W5 Gotenba W3 Chiyo i W4 Iwata ee W7 Inazawa W13 Tokushima M27 Tsurugisan W15 Hikosan W16 Ukiha W17 Zendoji M26 Kozagawa W9 Nara W18 Yatsushiro W20 Hitoyoshi W21 Kagoshima “ POG mee Gann W22 Tanegashima “W23 Yakushima W19 Ashikita _ 0 100 200km aS Fig. 1. The distribution and collecting sites of the three species of Japanese moles. For the locality numbers, refer to Tables 1 and 2. Abe, Geographic variation of Japanese moles 13 wa 1977). The Japanese moles are highly variable from range to range and in the past this has caused confusion in taxonomy (Abe 1967). Geographical variation in these moles has generally been described in relation to Bergmann’s rule (Ima- izumi 1966, 1970). The variations to be observed among Japanese moles, however, are not so simple as to be totally explained by this rule. Factor analysis, based on many probable habitat factors is required for a further understanding (Abe 1967). In this study, therefore, correlation analyses between the sizes of the moles and certain habitat factors believed to influence variation, have been carried out. MATERIALS AND METHODS A total of 260 MM. imaizumi were collected from 27 localities, 280 M™. wogura were collected from 23 localities and 41 M. tokudae were collected from two localities (Appendix 1). The body sizes of the specimens were expressed by the greatest skull length (GSL) measured to the nearest 0.01 mm with dial calipers. An average GSL for each local population was adopted as the representative size of moles in that population. It has been shown empirically that the size of moles varies with habitat area, especially when the habitat consists of more or less flat fields with deep damp soft soil (Abe 1967). In Japan, this kind of habitat usually consists of rice fields, which are distributed from low alluvial plains to montane valleys. Rice fields are usually among the best habitats for moles. As an indicator of habitat size, therefore, the area (km?) of rice field in each locality was measured on a topographical map of 1/50,000 or 1/200,000. Mountains, narrow gorges and rocky slopes all represent potential barriers to mole distribution (Abe 1974, 1985) ; therefore the area of contiguous rice fields more or less isolated from others by such the barriers was measured, representing the size of the habitat surrounding the collecting site (Tables 1 and 2). When the collecting site was located in a montane area without any rice fields, the size of the habitat was recorded as 0.01 km’. Soil hardness (kg/cm?), an important habitat factor, was measured with an intrusive proctor needle (Daiki-rika-kogyo, DIK-5520) to a depth of 60cm. The hardness values used in the analyses were taken every 5cm from 12 layers (5~60 cm depth). Such measurements were taken at about 15 points for each habitat. From field surveys in Nagano Prefecture where the distributions of M. wogura and M. imaizumii are parapatric, it has been noticed that soft soils being less than 10 kg/cm? in hardness and also deeper than about 30cm are necessary for the larger M. wogura to survive (Abe unpubl.). In terms of soil hardness, therefore, the deepest level at which soft soils (<10 kg/cm?) can be found at more than 50 percent of the survey points, is an important indicator of the depth of habitat appropriate for moles. Meteorological data for the collecting localities were obtained from nearby 74 Mammal Study 21: 1996 Table 1. Location, sample size (N), greatest skull length (GSL), and seven habitat factors of M. imaizumit. Locality N GSL Habitat area Soft soil Monthly mean temperature(C) Annual (mm) (km?) depth Annual Max. Min. Max. precip. (cm) mean range* mean* mean (mm) 1 Noheji 6 33.60 8.10 60 9.5 24.9 OVRZI ae 2 Morioka MY 83525 4.00 60 OE7 28 “= OIC O27 Ro is 3 Hanaizumi 147 53503 21.20 60 10-9" 28-9 —0; SoZ sn ommeeele 4 Semine QAO S68 U0) .00 60 10 (2.3255; a Osea 995 5 Sannai 3 B18 1.80 60 09) lots 0) 2 2ZeG e225 6 Jumoji 0 33.083 681.00 90 IO.3. Zs) OP 2350, G2 7 Tachikawa Aeon oll 984.00 30 UL 2038 ey LIMO 8 Mogami Seo. 9 35). 90 60 3.9 2530 023-2, gale 9 Awashima AL BOocu) 0.01 IS.4 Zo.0 0)..59'4 Zot ne woul 10 Koriyama ® FO J 734.00 45 9 = 238 05.240) 325 plea 11 Echigo IG 33.25 ilo7l.0o 60 We 208 ee AD- ISSS 12 Bange ASA 70 330.00 60 ee Aine SO 23 — Ze 13 Takazato 5) B04 8.40 45 I 26.8 0 2454 ge 14 Yanaizu Al 33} 19) 2.90 30 10.5 — 26.5 0, 2358eryz02i 15 Tadami Ae 1.20 20 OP eZ 5s 234 e2268 16 Tokamachi S401 149.10 60 ks 277.0 Os Z5s0 2055 17 Nozawaonsen 2 33.26 2.10 60 O25 ZH. We Z8scr ISS 18 Nakano IG 35.06 298.00 60 LORS 2626 0, 24507 S388 19 Joetsu Goel! 320.00 60 IIe Zaleth OF 2250 E285" 20 Toyama 4 35.64 1061.00 60 Wt Biss O25 57 eas 21 Tsubata A 83.39) 457.00 60 IAD ZS.0 As, = 2489 22 Numata (eo 5eo 4 33.80 D5 IDS 40.5) 0), 36) 9923 50m meno aa 23 Sano 4 36.58 1000.00 60 See 280 2 V4 925) 6y SteSG 24 Shiojiri ZA SASS 3.70 60 10 2807: 0789 23s ees 25 Agematsu 1G, 33.79 190 30 10.4" 20.3) 028) 22 Roe lee 26 Kozagawa 3 ego 0.06 WR G8 3.74 2525 eo 27 Tsurugisan Aeole 69 0.01 WD MOS 0 “WS vdiekeZ 814 *In localities with continuous heavy snow cover (> 25 cm in depth) during winter, the average temperature at ground level was adjusted to a constant 0°C in those months. Abe, Geographic variation of Japanese moles (5) Table 2. Location, sample size (N), greatest skull length (GSL), and seven habitat factors of M. wogura and M. tokudae. Locality N GSL Habitat area Soft soil Monthly mean temperature(’C) Annual (mm) (km?) depth Annual Max. Min. Max. precip. (cm) mean range* mean* mean (mm) M. wogura 1 Mikawa iy 3). 95 456.80 60 MAO 279) OS00R265 255 82262 2 Tatsuno 13 429) 202.80 55 ORAS 202519) O22 oe 535 3 Chiyo by BYEZ 0.43 Boo - ZIcO- les Adele ZS 4 Iwata Calis AY 410.40 15.6 2408 DML AS.3 IGE) 9 Gotenba 7 40.68 38.40 Wane) ZANT DUS 2324552908 6 Agematsu 26 38.90 30 60 USS) AG) 59) OMS 23.5. + Zoey) 7 Inazawa 15 Soe coe LOO0R00 30 Wy, 25).5) ZS Bod U7 8 Oki 30> Sy e00 2.80 Us Adal BM) B52 NAO 9 Nara Hy 49) 401.00 45 3 Ade Il D000 As. — sey! 10 Togouchi I Bi 6.90 29 Ue ile ZAG aI 203 75.4 ikekow 11 Hiroshima I) sealoesilh 86.50 ay) = 2559) a0) AI.0 MAI 12 Houhoku a4 89 3.0 ICO ZS50 GO Ad IA 13 Tokushima A384 344.80 IG 2A? G54 ADS)" Sy25i/ 14 Tsushima Bosov! 2.00 We 258) AZO 2045 15 Hikosan a) FSO 0k 0.38 25 102RO 2658 0.08 22.6 2469 16 Ukiha WA: Sls OO 44.60 20 yeh Adel 4.03 25.5 1868 17 Zendoji Seon 0e) we Z00200 20 15gSiey 22674 Ana eile Ome plik 18 Yatsushiro OY Bl ss 453.70 60 GAS e250 D033 20.0 AVOZ 19 Ashikita Gerson 6.80 30 GRO 92269 GROG ZOOM a9G8 20 Hitoyoshi 8 BOoa8 142.70 45 WA Zda2 D4 25.9. Zax 21 Kagoshima Ub 9 SHO 0.20 60 eS) 2838S Gs ZI, ZAM 22 Tane 18 34.41 SAY) I. IS lO Zr, 225"! 23 Yaku i Ball 0.24 Il 20.4 WO.G3 ArcZ = Say M. tokudae 1 Sado OOS 104.40 1330) 43.58 oe Zag Isoe/ 2 Echigo DA Atel shoe 00 60 e820) aks 25.0 a *Refer to Table 1. 76 Mammal Study 21: 1996 meteorological observatories or stations. Mean values for the 16 years from 1967 to 1982 were used (Takahashi 1983) except for those from Hikosan where data from 1980 to 1994 were used. Data collected included: the annual mean temperature ; the maximum annual range of monthly mean temperatures; the mean of monthly minimum temperatures; the mean of monthly maximum temperatures, and the mean of total annual precipitations. In localities with continuous heavy snow cover (>25 cm in depth) during the winter months, the average temperature at ground level was adjusted to a constant 0°C, irresp- ective of ambient temperatures recorded during those months. Fifteen local- ities in northwest Honshu and on Mt. Tsurugisan (alt. 1995 m), Shikoku, are located in area with heavy snow falls. A multiple or simple regression analysis was performed to detect the relationships between size variation of moles and habitat factors. ANCOVA test was used for the intraspecific comparison of geographic variations between two groups of localities, and Mann-Whitney’s U-test was used for the comparli- son of two samples with different variances. RESULTS Japanese moles are highly variable geographically (Fig. 2). The two main species, M. imaizumi and M. wogura, however, differ in their trends of latitudinal variation. A multiple regression analysis between GSL, a depen- dent factor, and seven independent habitat factors: the log-transformed area of habitat ; the log-transformed depth of soft soil (except for M. wogura, where many localities lacked data); the annual mean temperature; the maximum annual range of monthly mean temperatures; the mean of monthly minimum temperatures ; the mean of monthly maximum temperatures, and the mean of annual precipitation. The regression was significant for both M. imaizumii (R?=0.734> F—6:317, p—0.0011) and MM wogura (R7—0.692, F 5:99 p00): The mean of annual precipitation (f=0.0106) for M. zmaizumi and habitat area (pb =0.0007) for MW. wogura were significantly correlated with size (Table 3). In M. imaizumit, the size of Echigo specimens was considerably smaller than all others, probably, as discussed later, due to factors other than habitat and asa consequence the regression model was not significant (p=0.1804). When re- calculated ignoring the data from Echigo, the regression was refined (p< 0.0001), and the correlation between mole size and habitat area became signifi- cant (p=0.0496). Thus the sizes of both species varied positively with habitat area. Based on a stepwise regression analysis, the crucial habitat factors were reduced to: habitat area, annual mean temperature, and annual precipitation in M. imaizumit (R?=0.797, F=28.839, p<0.0001), and habitat area and mean maximum temperature in M. wogura (R?=0.682, F=21.448, p=0.0001). For a detailed examination of the variation in some local mole populations, further analyses were carried out for habitat factors selected above. Populations of M. tmaizumii from areas with heavy snow appeared to Abe, Geographic variation of Japanese moles Mel. Sado Is.. Niigata § —_—_—_—_ M. tokudae Echigo, Niigata ———_——— EEE SS Noheji. Aomori —emeee— =) Morioka. Iwate we ese ee eeeses — oa Hanaizumi, Iwate 8} $a — Semine, Miyagi = ——SE Sannai, Akita 5. ae Jumoji. Akita x —}-——Ss Tachikawa, Yamagata a ee Mogami. Yamagata —+— Awashima Is., Niigata epee — Ss Koriyama, Fukushima a Echigo. Niigata ee Bange, Fukushima —_—j— Takazato, Fukushima ——_—— Yanaizu, Fukushima ay: x ——j— Tadami. Fukushima M. imaizumi eape— = =Tokamachi, Niigata os eH Nozawaonsen, Nagano ——— Nakano, Nagano == Joetsu, Niigata —_— Toyama, Toyama —- Tsubata, Ishikawa —___ Numata, Gunma -asioe Sano, Tochigi ae —Shiojiri, Nagano epee — 9 Agematsu. Nagano +— —_ Kozagawa. Wakayama n°) = Tsurugisan, Tokushima 2 o Mikawa. Ishikawa —— o ae Tatsuno, Nagano aaa Chiyo, Nagano —————__——_——— Iwata, Shizuoka) fe Gotenba, Shizuoka SS Agematsu, Nagano ——————_ Inazawa, Aichi — Oki Iss., Shimane SS M. wogura Nara, Nara —— Spe Togouchi, Hiroshima a — Hiroshima, Hiroshima | Houhoku, Yamaguchi — Tokushima, Tokushima —emmmfee— 2 Tsushima Iss.. Nagasaki aS Hikosan, Fukuoka ee, te. —eepee— kia, Fukuoka eee — Zendoji, Fukuoka ——emeepee— = Yatsushiro, Kumamoto —emmfjeeee— = Ashikita, Kumamoto —emhes = Hitoyoshi, Kumamoto ———S Kagoshima, Kagoshima —emjee- ane 's.. Kagoshima ——_—emeee— Ss Yak Is., Kagoshima ae. aa Se er 8S cr" ) 31 32 33 34 35 36 37 38 39 40 41 42 43 44 Greatest skull length (mm) Fig. 2. Geographic variation in greatest skull length of three species of Japanese moles. Localities are arranged from south (lower) toward north (upper) for each species and those connected with dotted lines are localities situated along a river basin. The horizontal line indicates the total variation of the sample; the broad portion of the line, one standard deviation on each side of the mean; the vertical line, the mean. 78 Mammal Study 21: 1996 Table 3. Results of the regression analyses between greatest skull length and habitat factors. C. coefficient, SC. standard coefficient. (1) Multiple regression analysis Cc: SC. p-value M. imaizumi All populattions Ann. mean temp. OU 0.141 0.7164 Max. range temp. ORS3 0.187 0.4000 Mean min. temp. 0.057 0.028 0.8793 Mean max. temp. 0.164 0.148 0.7238 Ann. precip. -0.001 =() Sol 0.0106 Log area 0.300 0.286 0.1804 Log soil depth =02278 -0.020 0.8865 Intercept 27.945 0.0050 M. wogura All populations Ann. mean temp. 0.189 0.224 ORS a7 Max.rangetemp. -0.168 =) LEG 0.6647 Mean min. temp. =, SU =(() 4174 0.5701 Mean max. temp. -0.512 >) Aya 0.5467 Ann. precip. 0.0001 OR055 0.7645 Log area 1.234 05725 0.0007 Intercept 01.609 <0.0001 (2) Simple regression analysis M. imaizumiu Heavy snow area’s populations C. SC: p-value Sample excluding Echigo pop. 0.154 0.169 0.5782 0.165 URZa9 0.1988 0.151 0.076 0.6143 Dedisill 0.116 0.7218 -0.001 -0.538 0.0047 0.364 0.340 0.0496 = 0.019 SOROOM 0.9904 ZOR O29 0.0013 Little or no snow area’s populations. Log area 0.509 0) 7 0.0012 0.543 0.742 0.0140 Intercept SY) SRY) <0.0001 34.620 <0.0001 M. imaizumi All populations All populations Ann. precip. O00 —OROZS 0.0005 Ann. mean temp. 0.328 OL SIL7 0.0068 Intercept 36.478 <0.0001 30.643 <0.0001 M. wogura Northern populations Southern populations Log area 0.422 0.637 0.0651 0.904 0.834 0.0002 Intercept 39.432 <0.0001 35.490 <0.0001 M. wogura All populations All populations Mean min. temp. -().388 -().580 0.0037 Mean max. temp. -0.446 -0.398 0.0598 Intercept SIE <0.0001 49.326 <0.0001 Abe, Geographic variation of Japanese moles 79 differ in the relationship between GSL and log-transformed habitat area from those from little or no snow areas (Figs. 3 and 4). A simple regression analysis revealed significant regressions for the two groups (heavy snow: R?=0.515, F=15.913, p=0.0012; littl or no snow: R?=0.550, F=9.791 p=0.0140). Furthermore, an ANCOVA test revealed a highly significant difference in Y-intercept between the two groups (/<0.001; regression coefficient: p= 0.485). In M. wogura, the same analysis was made comparing northern (Nara- Oki Island and northern ones) and southern populations (southern Honshu, Shikoku and Kyushu). In the northern populations, no significant regression was observed (R*?=0.406, F=4.776, )=0.0651), while in the southern population it was significant (R?=0.696, F=27.512, p=0.0002). An ANCOVA test showed a significant difference in the Y-intercept between the two groups (#<0.001 ; regression coefficient : =0.156). Simple regression analyses suggest that the size of /. imaizumii decreased as annual precipitation increased (regression coefficient=-0.001 ; R?=0.388, F=15.844, p=0.0005) and varied positively as annual mean temperature in- creased (regression coefficient =0.328 ; R*=0.268, F=8.776, p=0.0068) (Figs. 5 and 6). In M. wogura, the simple regression analysis between GSL and mean monthly maximum temperature showed an insignificant relationship (R?= 0.159, F=3.958, p=0.0598), whereas a significant relationship between GSL and mean monthly minimum temperature was indicated (R?=0.337 F=10.658, p= 0.0037 ; Fig. 7). Thus, the size of M. wogura increased as mean monthly minimum temperature decreased, with a regression coefficient of -0.388 (Table 3). Other factors were not significant for this species. There are only two major populations of VW. tokudae and these are isolated on Sado Island, and on the Echigo Plain, Honshu, both of which experience very similar climatic conditions (Table 2). Consequently, geographic variation in relation to meteorological factors could not be analyzed in detail. The rela- tionship between GSL and habitat area for the two populations of M. tokudae, however, resembled those in the former two species; M. tokudae from the larger Echigo Plain were significantly larger than those from Sado Island (Mann-Whitney U-test, p<0.0001). DISCUSSION In all three species of Japanese moles, geographic variation in size as indicated by GSL was significantly correlated with habitat area, such that size increased as habitat area increased. M. imaizumi and M. wogura differed somewhat, however, in their reaction to habitat factors with M. imaizumii responding differently to habitat area in regions of heavy snow, and in regions with little or no snow, a difference which could be attributed to a correlation with annual precipitation. Toyama, Tsubata, Tokamachi and Joetsu popula- tions, all in areas experiencing heavy snow falls close to the Japan Sea, were all relatively large in comparison with from inland localities with heavy snow but narrow areas of habitat, e. g. Takazato, Sannai, and Tadami (Fig.5). The 80 Mammal Study 21: 1996 Greatest skull length (mm) 0.01 0.1 1 10 100 10004 Habitat area (km2) Fig. 3. The relationship between greatest skull length and habitat area (log scale) in MM. imaizumi. Solid marks indicate samples from heavy snow areas; open ones, those from little or no snow areas. Localities connected with lines are those situated along a river basin. Numbers at each mark are those of localities in Table 1. Greatest skull length (mm) 0.1 1 10 100 10004 Habitat area (km2) Fig. 4. The relationship between greatest skull length and habitat area (log scale) in ™. wogura. Solid marks indicate samples from Nara-Oki and northern populations ; open ones, those from southern Honshu, Shikoku and Kyushu. Refer to Fig.3 and Table 2 for other legends. Abe, Geographic variation of Japanese moles 81 Greatest skull length (mm) 500 1000 1500 2000 2500 3000 3500 4000 Total annual precipitation (mm) Fig.5. The relationship between greatest skull length and total annual precipitation in /. imaizumi. Refer to Fig. 3 for legends. Greatest skull length (mm) 4 5 6 7 8 9 1 TM 12 18 “4 “As Annual mean temperature (°C) Fig.6. The relationship between greatest skull length and annual mean temperatures in M. imaizumiu. Refer to Fig. 3 for legends. 82 Mammal Study 21: 1996 Greatest skull length (mm) 22. GO. eaek2 | Sh 4. SWS 6) Bizae eS KODE OMMEIET Mean minimum temperature (°C) Fig. 7. The relationship between greatest skull length and mean monthly minimum tempera- tures in VM. wogura. Refer to Fig. 4 for legends. populations from Awashima and Kozagawa where continuous snow cover does not occur in winter were also relatively large (Fig. 5). Of these, the former may be explained by the high annual mean temperature affected by the Tsushima Warm Current, while the latter could not be well accounted for by this factor. The exceptional size of the Awashima population in Fig. 3 may also be attributable to the same factor. The size of M. tmaizumii varies positively with annual mean temperatures (Fig. 6), and the size variation indicates a reverse of Bergmann’s rule. In this case, the populations of Echigo, Joetsu, Tsubata, and Kozagawa are relatively small. The reasons for this are not known, but they may differ between the former three and the last, because of the great difference in habitat areas between them. Thus, some local M. imaizumii populations differed in body size from the general trend. One of the most remarkable variations from the general trend was found in the population of Echigo, followed by those of Tsubata and Joetsu (Figs. 3 and 6). The most remarkable aspect of the habitat in Echigo is that two species, VM. tmaizumi and M. tokudae occur there, and the former are very small while the latter are very large (Fig. 2); thus the biotic situation in this habitat is different from most of the others. Interspecific competition in moles appears to be so severe that in plains with simple topographies such as at Echigo, two species of moles never have overlapping ranges and are strictly parapatric (Abe 1974, 1985). In the Echigo Plain, VM. imaizumii and M. tokudae are clearly parapatric, consequently, the extremely small size of M. imaizumii there cannot be attributed to a change in size due to character displacement Abe, Geographic variation of Japanese moles 83 (Brown and Wilson 1956) which is a common biological mechanism serving to reduce competition between ecological equivalents. One further interesting aspect of this case, is that the larger species, M. tokudae, is actually retreating, and reducing its original distribution, while /. zmaizumii, despite its smaller body size, is invading the habitat of M. tokudae and expanding its range on the plain (Imaizumi and Imaizumi 1970, Abe unpubl.). From these facts, it is plausible to hypothesize that the extremely small M. zmaizumii of the Echigo are recent newcomers, in the geological or evolutionary sense, having immi- grated from the surrounding, small-bodied mountain populations. Probably they are moles that have not yet fully adapted to the high quality habitat, which typically results in larger-bodied moles. In the south of its main range of VM. zmaizumii in Honshu, there are three known populations which abut those of M. wogura, another large species, at Tsubata, Agematsu and Shiojiri (Kita-ono) (Fig. 1). In these areas, however, M. imaizumii is retreating as MW. wogura is expanding its range (Abe 1974, 1985). Agematsu and Shiojiri (Kita-ono) are located along the uppermost reaches of the Kiso and Tenryu rivers, respectively. At both these sites M. zmaizumiti remain reasonable sizes with respect to the size of the respective habitats (Figs. 3,5, 6). M. imaizumi at Tsubata, another population confronting M. wogura, are somewhat smaller than might be expected in proportion to habitat area and annual mean temperature. The reason for this, however, is not known. In M. wogura the relationship between body size and habitat area differs between the northern and southern populations (Fig. 4), but as a whole body size increases aS mean monthly minimum temperatures decline, a variation which coincides with Bergmann’s rule (Fig. 7). When examined on a smaller scale, however, size variation in each group of sites along a river basin showed the reverse tendency, with body size decreasing as temperatures decreased along the upper reaches of rivers (Fig. 7). This aspect of size decrease in MV. wogura, consequently, may be accounted for by the effect of reduced habitat area at such locations. When studying size variation in this species, therefore, sam- ples should only be compared with those from habitats of a similar size. The M. wogura populations of Tatsuno, Agematsu and Mikawa are para- patric with those of MW. imaizumi and are expanding northwards, replacing those of the latter (Abe 1974, 1985). In these three areas, only the moles of Tatsuno are relatively larger than the others, probably as a result of the compounded effect of the relatively wide habitat area in the Ina Valley, where Tatsuno is located, and the lower monthly minimum temperature (Figs. 4 and 7). Although the moles of Mikawa and Agematsu experience similar monthly minimum temperatures, the former are slightly larger than the latter, perhaps accounted for by the wider habitat at Mikawa. The moles of Chiyo and Agematsu are large relative to the restricted areas of habitats available. This may be explained taking the same perspective as that of M. imaizumii in the Echigo Plain, that is they are recent immigrants from populations of very large moles such as from the Iwata-Tatsuno popula- tions for the Chiyo moles, and from the Inazawa population for the Agematsu 84 Mammal Study 21: 1996 moles, both of which represent the expanding nothernmost frontier populations of M. wogura. The extraordinarily large size of the moles in these two popula- tions may be the main reason for the insignificant correlation between size and habitat area only in the northern populations mentioned above (Fig. 4). Thus, it is expected that the moles of these two populations will decrease in body size in the future to a level reasonable for the habitat area. It is interesting that the populations of the species showing extraordinary variation, irrespective of whether they are larger or smaller, at the contact point between areas occupied by two species are not original residents of the area but immigrants. Thus, whereas the original residents are reasonably proportioned in relation to their habitat as a result of evolutionary or historical adaptation, while the immigrant population has not yet attained the optional size for the habitat, and still retain, in their new habitat, their original size related to their original native habitats. This is the most plausible explana- tion for the extraordinary sizes of moles observed at the expanding edge of their ranges. Soil hardness has been considered to be an important limiting factor for the fossorial life of moles (Abe 1974) ; however, in this study it was not found to be significantly correlated with variation in body size. This might be a natural consequence of moles usually preferring habitats with deep soft soils within their range and because hardness was measured precisely in habitats preferred by the moles. At Kita-ono, Shiojiri City, Nagano Prefecture, for example, the range of M. wogura reaches its northernmost frontier along the uppermost tributary of the Tenryu River. The range expansion of this species has been blocked since at least 1959 when I first surveyed the area, by the shallow hard soil surrounding the present habitat, which is confined here only to narrow zones of soft soil along the banks of small streams (Abe 1985 and unpubl. data). This type of localized habitat preference may result in an apparent non-rela- tionship between soil hardness and mole body size as in the present analysis. Boyce (1979) presented a hypothesis in which the seasonality of habitat aspects was a very important factor in the evolution of large body size in homeothermic vertebrates. In the present study, the maximum annual range of monthly mean temperatures was one of the factors, but it was not significant in the variation of M. wogura and M. imaizumiz. Much work has been devoted to body size variation of mammals on islands, and several hypotheses have been presented (Foster 1964, Heaney 1978, Lawlor 1982, Angerbjorn 1985, Lomolino 1985, Abe and Ishii 1987). There are, how- ever, still no concrete hypotheses to explain all the size variations on islands. In the present study of moles from the Japanese islands, no definite tendency in size variation was observed. In M. wogura, for example, variation between islands was basically explained by habitat area or by mean minimum tempera- tures (Figs. 4 and 7); however, the Awashima population of M. tmaizumii, was considerably larger than all others, in relation to habitat area. This is con- sidered to be the effect of the warm climatic conditions on Awashima, on the general tendency of size variation in this species. Abe, Geographic variation of Japanese moles 85 Acknowledgments: | am grateful to Dr.$S. Shiraishi Dr. K. Maeda, Dr. T. Aoi, Dr. Y. Yokohata, Dr.S. Yamane, Miss M. Umemoto and Miss M. Nishijima for their kind assistance during the field work. I also wish to express my obliga- tion to Dr. S. Shiraishi and Mr. M. Okazaki, who kindly supplied meteorologi- cal data from Mt. Hikosan for my use. Thanks are also due to Mr. M. Takagi for assistance with statistical procedures, and to Dr. Y. Yokohata for comment- ing on an early draft This study was supported by a Grant-in-Aid for Sci- entific Research from the Ministry of Education, Science and Culture, Japan (no. 05454029). REFERENCES Abe, H. 1967. Classification and biology of Japanese Insectivora (Mammalia). I. Studies on variation and classification. J. Fac. Agr. Hokkaido Univ. 55: 191—265. Abe, H. 1974. Change of the boundary-line of two moles’ distributions in a period of 14 years. J. Mamm. Soc. Japan, 6: 13—23 (in Japanese with English Summary). Abe, H. 1985. Changing mole distribution in Japan. Jn Contemporary Mammalogy in China and Japan. (T. Kawamichi ed). pp. 108-112. Mammalogical Society of Japan. Abe, H. 1995. Revision of the Asian moles of the genus Mogera. J. Mamm. Soc. Japan 20: 51—58. Abe, H and N. Ishii. 1987. Mammals of Tsushima Island. Ju Biogeography of Tsushima Island. (Nagasaki Prefecture, ed.) pp. 79—109 (in Japanese with English Summary). Angerbjorn, A. 1985. The evolution of body size in mammals on islands: some comments. Amer. Nat. 125: 304—309. Boyce, M.S. 1979. Seasonality and patterns of natural selection for life histories. Amer. Nat. 114: 569 — 583. Brown, M.L. and E. O. Wilson. 1956. Character displacement. Syst. Zool. 5: 49—64. Foster, J. B. 1964. Evolution of mammals on islands. Nature 202: 234—235. Heaney, L. R. 1978. Island area and body size of insular mammals: evidence from the tricolored squirrel (Callosciurus prevosti) of Southeast Asia. Evolution 32: 29—44. Imaizumi, Y. 1966. Principles and Methods for Zoological Classification. Daiichihoki-shuppan, Tokyo 326pp (in Japanese). Imaizumi, Y. 1970. Land mammals of the Tsushima Islands, Japan. Mem. Natn. Sci. Mus., Tokyo 3: 159-176 (in Japanese with English summary). Imaizumi, Y-H, and T. Imaizumi. 1970. Interspecific relationship in two mole species in the plains of Niigata, Honshu. I. Geographic distribution. J. Mamm. Soc. Japan 5: 15—18 (in Japanese with English summary). Lawlor, T.E. 1982. The evolution of body size in mammals: evidence from insular populations in Mexico. Amer. Nat. 119: 54—72. Lomolino, M. V. 1985. Body size of mammals on islands: the island rule reexamined. Amer. Nat., Zee SO S16: Motokawa, M. and H. Abe. 1996. On the specific names of the Japanese moles of the genus Mogera (Insectivora, Talpidae). Mammal Study, 21: 114—122. Sagara, N., S. Kobayashi, H. Ota, T. Itsubo and H. Okabe. 1989. Finding Euvoscaptor mizura (Mam- malia: Insectivora) and its nest under Hebeloma radicosum (Fungi: Agaricales) in Ashiu, Kyoto, with data of possible contiguous occurrences of three talpine species in this region. Contr: Biol. Lab. Kyoto Univ. 27: 261—272. Takahashi, K. (ed.). 1983. Nihon-kisho-soran (A Comprehensive Meteorological Bibliography of Japan). Two volumes. Toyo-keizai-shinposha, I, 1060pp, II, 1064pp. (in Japanese). Yukawa, M. 1977. Mammals of Hiwa Town, Hiroshima Prefecture. Nature of Hiwa, pp. 157—180 (in Japanese). 86 Mammal Study 21: 1996 APPENDIX 1 Specimens examined All the speimens used in this work were collected by the author. Locality, with the third mesh (ca. 1 x 1 km’) code number (LC no.) of the Environment Agency, Japan, the month and year of collection, and the registration number (Hok- kaido University Abe’s collection number: A no.) of all specimens examined are listed below. M. imaizumiu 1) Noheji T., Aomori Prf. LC6141-21-10~20, October 1959, A3028~30, August 1993, A5811~12, Tenmarin V., LC6141-01-74, August 1993, A5813. 2) Morioka C., Iwate Pref.: Kuroishino LC5941-41-81, October 1959, A3031~35; Kamiyonai LC5941-41-96, October 1959, A3036~45; Asagishi LC5941-41-58, October 1959 A3046~50. 3) Hanaizumi T., Iwate Pref. LC5841-11-95, July 1960, A3394~3407. 4) Semine T., Miyagi Pref. LC5741-70-76, July 1960, A3374 ~93. 5) Sannai V., Akita Pref. LC5840-75-26, August 1993, A5883~85. Jumo- ji T., Akita Pref. LC5840-64-81, August 1993, A5876~82. 7) Tachikawa T., Yamagata Pref. LC5839-17-85, August 1993, A5867~69, 5875. 8) Mogami T., Yamagata Pref. LC5840-13-16, August 1993, A5870~74. 9) Awashima, Niigata Pref. LC5739-52-50, August 1991, A5780~83. 10) Koriyama C., Fukushima Pref. LC5640-12-38, August 1993, A5823~30. 11) Echigo Plain, Niigata Pref. : Gosen C. LC5639-41-82, August 1991, A5774~76; Niitsu C. LC5939-51-33, August 1991 A5777~79, 5792; Shibata C. LC5639-72-17, October 1960, A3430 ~38. 12) Bange T., Fukushima Pref. LC5639-26-66, November 1959, A2971 ~84. 13) Takazato V., Fukushima Pref. LC5639-26-91~92, November 1959, A2985~99. 14) Yanaizu T., Fukushima Pref. LC5639-25-27, November 1959, A3000~09; Mishima T.LC5639-15-84, November 1959, A3010~13. 15) Tadami T., Fukushima Pref. LC5639-02-15, November 1959, A3014-27. 16) Tokamachi C., Niigata Pref. LC 5538-56-40, August 1993, A5856~64. 17) Nozawaonsen T., Nagano Pref. LC5538-33-04, August 1993, A5854~55. 18) Nakano C., Nagano Pref. LC5538-02-66 and 76, August 1991, A5758~73. 19)_Jioetsu ‘©, Niigata Pref. 11€5538-32-52- and 83, August 1991) Ao(s0—— 55 20) Toyama C., ‘Toyama Pref. @5537-01-24, August “1993 aecale os. 21) Dsubata Ts Ishikawa Pref) U@5536-15-l6—17" August) 199i a5 26s: 22) Numata C., Gunma Pref. LC5439-70-83, August 1993, A5839-45. 23) Sano C., Tochigi Pref. LC5439-34-55, August 1993, A5846~49. 24) Shiojiri C., Nagano Pref.: Hiraide and Kanai LC5437-17-16 and 18, August 1959, A2518 ~23; Kitaono LC5437-07-58, Agust 1959, A2524~31, November 1959, A2969 —i0= Sosa. Vi LC5437-07-62;, August 1959, A253 172 +25)» Ateremiarcumee lie Nagano Pref. LC5337-55-24, August 1959, A2499~2508 ; Kiso V. LC5337-76-22, August 1959, A2509~12; Fukushima T.LC5337-65-16, July 1959, A2497~98. 26) Kozagawa T., Wakayama Pref. LC5035-35-65, October 1994, A5948~950. 27) Tsurugisan, Tokushima Pref. LC5437-07-58, August 1959, A2928~30, 3347. Abe, Geographic variation of Japanese moles 87 M. wogura De Wikaway Wi Ishikawa Pref. 1L@5436-53579; August 1991, A5742~45, 2) Tatsuno T., Nagano Pref. LC5437-07-17, November 1959, A2883, 2887~90 ; Kitaono, Shiojiri C. LC5437-07-57, August 1959, A2436~38, November 1959, A2881~82, 2884~86. 3) Chiyo V., Nagano Pref. LC5337-06-99, July 1959, Bia oo stase V~ E@5338soil-3l, July 1959; A2426; Ohdaira, lida ©. L@5337- 25-68, July 1959, A2422~25. 4) Iwata C., Shizuoka Pref. LC5237-07-21 and 40, Auouse 199 A5713~21. 5) Gotenba C., Shizuoka Pref. 1.C5238-67-73, July 1991, A5706~12. 6) Agematsu T., Nagano Pref. LC5337-45-87, August 1959, A2409 ; Midono, Yomikaki V. LC5337-34-29, August 1959, A2410~21; Ohkuwa V.LC5337-45-25 and 56, August 1959, A2396~2408. 7) Inazawa C., Aichi Pref. IC5736-06-52 and 63. July 1991, A5722~36. 8) Oki Islands, Shimane Pref. - Saigo LC5433-22-55, December 1959, A2891~2920. 9) Nara C., Nara Pref. LC5135-76-77, April 1991, A5685, LC5135-76-67, August 1993, A5893~96. 10) itocouchidh) Hiroshima, Pret. L@5132=71-l6, June 1959, A2439~53. 11) Hiro- shima C., Hiroshima Pref. LC5132-53-38, June 1959, A2454~69. 12) Hohoku T., Yamaguchi Pef. LC5130-37-46, August 1994, A5939. 13) Tokushima C., Tokushima Pref. LC5134-04-70, January 1960, A2925~27; Jingo, Kawashima T. LC5134-02-76, January 1958, A2076, January 1957, A2093~94, November 1958, A2221, January 1959, A2222, 3348, December 1959, A2923, January 1960, A2924; Nishioe, Kamojima T. LC5134-02-76, January 1959, A2223~25. 14) Tsushima Islands, Nagasaki Pref.: Izuhara T. LC5i29-21-59, December 1959, A2961~68. 15) Hikosan alt. 670m, Fukuoka Pref. LC5030-17-72, June 1959, A2493~94 ; alt. 350m LC5030-17-71, August 1994, A5913~14; Soeda T. LC5030-26-88, June 1959, A2495. 16) Ukiha T., Fukuoka Pref. LC5030-06-05, December 1959, A2931~42. 17) Zendoji, T., Kurume C., Fukuoka Pref. LC4930- 74-98, May~June 1959, A2470~78 ; Izumi, Chikugo C. LC4930-63-49, August 1959, A3339~42. 18) Yatsushiro C., Kumamoto Pref. LC4830-54-78, December 1959, A2952~60. 19) Ashikita T., Kumamoto Pref. LC4830-34-50, December 1959, A2943~51. 20) Hitoyoshi C., Kumamoto Pref. LC4830-25-78, August 1994, A5931~38. 21) Kagoshima C., Kagoshima Pref.: Kogashira LC4730-34- 71, April 1959, A2479~87 ; Kamifukumoto T. LC4730-24-31, April~May 1959, A2488, 3343. 22) Tanegashima Island, Kagoshima Pref: Nishinoomote C. LC4630-07-48, November 1958, A2205~20, May 1959, A2490; Noma, Nakatane T. LC4530-67-37, May 1959, A2489. 23) Yakushima Island, Kagoshima Pref. : Anbo LC4530-35-82, November 1958, A2190~94, 2196~2204; Funayuki LC4530-45-02, November 1958, A2195; Miyanoura LC4530-54-05, May 1959, A2491~92. M. tokudae DmevoztieC= Sado dsland: Niigata Pret; E@5738=l3=13 Juner 1958, AZN03.: LC5738-13-04, July 1960, A3358~73. 2) Echigo Plain, Niigata Pref.: Niitsu C. C5639, 50 os ulys L960 AS35538) WO5639-sile334 August 1991 A5784~91l- Kitayama, Kameta T.LC5639-60-59, July 1960, A3354-57; Suginokoshi, Shibata C. LC5639-72-17, October 1960, A3421~29. (Accepted 7 July 1996) For viel) aware 2 mide = ae r or eo! be at aay eee nea aaa! 4 % we ee sy * ) 4 eee 7 ; a fo! ER Te ite: ea '’ ‘Tagen ee * Leiber aut: Es ' y ' ; ; cle : : e “ E | om, x pak ‘ye Ne fea ae x inhi i rhe 2 : Mammal Study 21: 89-114(1996) © the Mammalogical Society of Japan Morphological variation, and latitudinal and altitudinal distribution of Kothenomys chinensis, E. wardi, E. custos, E. proditor, and E. olitor (Rodentia, Arvicolidae) in China Yukibumi KANEKO Biological Laboratory, Faculty of Education, Kagawa University, Takamatsu 760, Japan Fax. 0878-36-1652 Abstract. A total of 308 museum specimens of the genus Eothe- nomys from five separate areas in Sichuan (Szechwan) and Yun- nan Provinces, China, were categorized by the relationship between condylobasal length (CBL) and tail length (TL). These specimens were allocated to three larger species, FE. chinensis, E. wardi and E. proditor, and two smaller ones, F. custos and EL. olitor. E. chinensis and FE. wardi are allopatric, and their distribu- tions separated by about 240 km in northern high mountain areas (28-30° N). E. chinensis lives at altitudes above 1500 m, whereas E. wardi was found above 2300m. Lengths of bulla (BL), tail (TL) and hind foot (HFL) were slightly larger in E. chinensis than in £. wardi E. custos has a large latitudinal range between 26° and 29° N in Sichuan and Yunnan Provinces, whereas E. proditor occurs near the borders of Sichuan and Yunnan (27-28 N). The latitudinal range of E. custos overlaps with that of E. proditor in the areas of 26-28 N and 100-102° FE, but E. custos was found at slightly higher altitudes (2500-4800 m) than E. proditor (2500-4200 m). The distance between the anterior-most point on the upper incisor to the posterior-most edge of the third upper molar (I-M3) ANGE MOn a GUSIOS tended= tom increase thom South to- north, whereas those of EF. proditor tended to decrease. FE. custos had longer tails in localities around 29° N and 101.5° E than in other areas. E. olitor was recorded from two widely separated localities (Gae7 3m Neand 99a andeca2() Neandal04 5): Key words: distribution, Lothenomys, identification, southwest China, taxon- omy. The classification and identification of the genus Eothenomys (Rodentia, Arvicolidae) have remained confused, because no study on morphological variation has been carried out over the entire geographical range of the genus. Furthermore, a number of nominated species have all been identified as Clethrionomys rufocanus (Hinton 1926, Allen 1940, Tokuda 1941, Ellerman 1941, 90 Mammal Study 21: 1996 Ellerman and Morrison-Scott 1951, Jones and Johnson 1965, Gromov and Polyakov 1977). Kaneko (1990, 1992) has already documented the mor- phological variation, identification, and geographical distribution of E. vegulus, E. shanseius, E. inez, and FE. eva on the Korean Peninsula and in northern and central China, all of which proved to be distinct from C. rufocanus. The classification of, and keys for the identification of other species of Eothenomys living in central and southern China, Taiwan, Vietnam, Thailand, Burma, and India, have not been well established yet, and only crude distribu- tion maps have been provided (Allen 1940, Corbet 1978, Corbet and Hill 1992). In Sichuan and Yunnan Provinces, China, with the exception of the E. melanogaster group (which includes fidelis, eleusis, and muletus), some tax- onomists recognize four species of Eothenomys (chinensis, custos, proditor and olitor) (Allen 1940, Ellerman and Morrison-Scott 1951, Corbet 1978, Honacki et al. 1982, Corbet and Hill 1991, Musser and Carleton 1993), whereas others recognize five (chinensis, wardi, custos, proditor and olitor) (Hinton 1926, Ellerman 1941, Gromov and Polyakov 1977, Corbet and Hill 1992). The purpose of this paper is to describe identification methods and to establish the geographical distribution of EHothenomys spp. in Sichuan and Yunnan Provinces, China, based on the morphological variation in external and skull measurements, and in molar characteristics. MATERIALS AND METHODS A total of 308 specimens were examined in the following institutions: the Natural History Museum, London (BM); the United States National Museum of Natural History (USNM); the American Museum of Natural History (AMNH); the Museum of Comparative Zoology, Harvard University (MCZ) ; the Field Museum of Natural History (FMNH); the Zoological Institute, Academia Sinica (ASZI); and the Kunming Institute of Zoology, Academia Sinica (ASKZI). The localities from which specimens were collected, and their reference numbers, are shown in Fig.1, while the latitude, longitude, altitude, date collected, museum and registration number of all specimens examined can be found listed in the Appendix. The latitude and longitude of each locality were determined from gazetteers (Zhuang 1983, Su 1984) and from accounts of collecting expeditions (Kingdon Ward 1923, Roosevelt and Roosevelt 1929). Altitudes and distances were obtained from labels attached to specimens, and those recorded in feet and miles were converted to meters and kilometers. Some of these specimens had previously been described or identified by other researchers (Thomas 1891, 191la, b, 1912a, b, 1914, 1923, Miller 1896, Allen 1912, 1924, 1940, Hinton 1923, 1926, Howell 1929, Osgood 1932, Pen et al. 1962, Lu et al. 1965). It is difficult to appreciate the variation among these vole species at first glance, because of the great variation among the 42 localities from which they were collected. These localities were grouped into five geographical areas: Kaneko, Five species of Eothenomys in China erte et, eertey Sil N iY Sas, a ? o ‘ , \ v \ ¢ ‘ » o v : i ? t eee ‘ . , . ry sy 8 > « a s i AY ° Xi 3 lan Es N t i) ere eae uent ‘ N ~~ sf ea oor” a R. chang Jiang 200 to Fig.1. Sichuan and Yunnan Provinces, China, showing Localities 1-42 grouped into Areas I- V, as defined in this study. 9? Mammal Study 21: 1996 Area I, Localities 1-8 7 Area ll, Localities 9-14" b7-21 235245 27.28) ances oe 0k Area Ill, Localities 15-16, 22, 25-26) 29-32, and 34-37 Areal Localitvaser and Area V, Localities 33, and 41-42. Locality 38 (the Lichiang Range) was divided into ten different altitudinal zones. Measurements of head and body length (H & BL), tail length (TL), and hind foot length (HFL), were obtained from labels attached to specimens. The presence of mammae was checked for on the skins of females. Condylobasal length (CBL), incisor-third upper molar length (I-M3), condyle-first upper molar length (C-M1), the length of bulla (BL), and the interorbital width (IOW), were measured to the nearest 0.1 mm with a dial caliper by the author (the minimum accuracy — 0.05 mm). These measurements are defined as follows: the CBL is the distance between the occipital condyle and the anterior point of the premaxillae ; I-M3 is the distance from the anterior-most point on the upper incisor to the posterior-most edge of the third upper molar ; C-M1 is the distance between the occipital condyle and the anterior edge of the first upper molar; BL is the longest length of the auditory bulla, and IOW is the shortest measurement of the frontal bones between the orbits. Where specimens skulls had been damaged, CBL was estimated from regression lines between I-M3 and CBL or between C-M1 and CBL, using data from specimens with undamaged skulls. The regression lines were calculated separately for four geographical areas: Area I (~=49) CBL=1.492(I-M3)+ 2.644, CBL=1.482(C-M1)#1.171; Area II (n=45) CBL=1.551(I-M3)+1.514; Area [Il (w=31) CBL=1.5370-M3)--1.543, CBL=1.:693(C-M1)— 1955] and Area IV @=64) CBL=1.422(I-M3)=-3.193, CBE= lL67(CeMil) = 590s neanes- sion coefficients of these lines ranged from 0.906 to 0.982 (p<0.05). Specimens were identified as adult by the presence of mammae, or as young by the presence of minute skull perforations and the absence of full ossification. Enamel patterns on the occlusal surfaces of the upper molars, were drawn from pictures taken of the molar rows using a Nikon SMZ-10 stereo micro- scope at 6.6X magnification. Original close-up photographs were taken of the museum specimens using an accessory close-up lens (1.75 magnification) attached to an Olympus camera. The enamel patterns on the third upper molar were classified into five types (A-E; see Fig. 2). Type A has three salient and two re-entrant folds on the lingual side. It also has a posterior loop in which the inner enamel lamellae has either a straight or concave outline which does not protrude posteriorly beyond line “h” which crosses perpendi- cularly to the longitudinal axis of the tooth on the lingual side of the posterior loop (Fig. 2); Type B has four salient and three re-entrant folds on the lingual side, where the base line of the enamel lamellae of the third re-entrant fold protrudes beyond line “h”; Type C has four salient and four re-entrant folds with a posterior loop where the inner enamel lamellae has either a straight or concave outline but does not protrude line “h” (compared with Type A); Type D has five salient and four re-entrant folds on the lingual side where the outline Kaneko, Five species of Eothenomys in China 93 TypeC TypeE ini as Fig.2. Types A-E enamel patterns on the third upper molar. These patterns differ in the number of re-entrant angles and the shape of the posterior loop. The line (h), crossing at a right angle to the longitudinal line of the tooth at the antero-external margin of the last re-entrant angle, shows whether the concavity of the re-entrant angle exceeds the line posteriorly or not. Patterns of five rectangles below the molars of Types A-E are used in Figs. 4, 6, 8, 9 and 11. Fig. 3. Enamel patterns on the third upper molar of the EKothenomys holotypes examined in this study. A=MEo= Microtus (Eothenomys) olitor Thomas, 1911 (BM 11. 9. 8. 122), B=Mc= Microtus chinensis Thomas, 1891 (BM 91. 5. 11. 3), C=MAct= Microtus (Anteliomys) chinensis tarquinius Thomas, 1912 (BM 11. 2. 1. 207), D=MAw= Microtus (Anteliomys) wardi Thomas, 1912 (BM 12. 3. 18. 15), E=MAc= Microtus (Anteliomys) custos Thomas, 1912 (BM 12. 3. 18. 19), F=MAcr= Microtus (Anteliomys) custos rubellus Allen, 1924 (AMNH 44001), G=EAch= Eothenomys (Anteliomys) custos hintoni Osgood, 1932 (FMNH 33073), H=Ep= Eothenomys proditor Hinton, 1926 (BM 22. 12. 1. 10). 94 Mammal Study 21: 1996 of the enamel lamellae of the fourth re-entrant fold protrudes beyond line “h” (compared with Type B); and Type E has five salient and four re-entrant folds with a posterior loop where the inner enamel lamellae appear as in Type A. RESULTS 1. Variation among specimens from Sichuan and Yunnan Thomas (1911b, 1912a) described Eothenomys olitor having a prominent inner salient angle on the second upper molar, and lacking supplementary postero-internal salient projection on the first upper molar (Fig.3-A). Six specimens, collected from Area V (Localities 33, 41 and 42), were identified as FE. olitor, with a TL of 35 mm, a HFL of 14-18 mm, and a CBL ranging from 20.9 to 24.1mm (z=5; Fig. 4). The dominant enamel pattern on the third upper molar was of Type B (Table 1). Except for those of E. olitor, all specimens examined were provisionally identified as belonging to one of four groups, according to the relationship between CBL and TL, and according to the geographical areas where they were collected (see Fig.5). Specimens for which CBL was measured could be grouped into two clusters in each area. Some specimens for which CBL could be estimated were also included in, or were scattered close to their respective clusters (except for several young specimens). Adults were included in the respective clusters in each area except for one Area III cluster, in which no adults appeared. In Areas I and II, there were two clusters of specimens with longer CBL and longer TL (CI-L in Area I and CII-L in Area II) and with Bil | M3 5 6 7 omm 134 15.2 mm Soa She at Pe ER TT TY : Mar ° MEO: a ™ Mar & Dec dl - MEo ae ! ! —— ba feat 'Feb 42 CI ‘Feb ae pee “srtiasts Vi tee oo! Ss arpa se eee Mar & Dec Dec : Mar & Dec MEo MEo Dec 33 Apt io ep eur eo i Ape eter Feb | [ae ny eh Ee ee) ae Ye ae eee eee, ee ee 20 35 mm 14 18 Tee fallgtge le Fig. 4. Geographical variation in BL, I-M3, TL and HFL in Eothenomys olitor. One square refers to one specimen. Month indicates collecting month of specimens examined. For details of Localities #33, and #41-42, see the Appendix. For enamel patterns and abbreviation of the holotype, see Figs. 2 and 3. Kaneko, Five species of Eothenomys in China 95 Area II Fig.5. Relationships between CBL and TL in Areas I-IV. For abbreviation of the holotypes (EAch, Ep, MAc, MAcr, MAct, MAw and Mc), see Fig.3. In each area, young individuals were located to the left of a cluster of adults. Symbols: young=@; young with estimated CBL=y ; adult= @ ; adult with estimated CBL= 4 ; individual not clearly adults or young= O ; individual not clearly adult or young with estimated CBL=/ ; individual missing the tip of the tail= ?. It will be shown later that clusters CI-S, CII-S, CIII-S and CIV-S correspond to Eothenomys custos; CIII-L and CIV-L to E. proditor ; CI-L to E. chinensis ; and CII-L to E. ward. shorter CBL and shorter TL (CI-S in Area I and CII-S in Area II). In Areas III and IV, there were two clusters of individulas with longer CBL and shorter TL (CHI-L in Area III and CIV-L in Area IV) and with shorter CBL and longer TL (CIII-S in Area III and CIV-S in Area IV). In each area, young individuals were found to the left of a cluster of adults: 7. e. young in Area I=CI-L, young in Area II=CII-L, young with 20-22 mm in CBL in Area IV =CIV-S, and young Withee =2 4mm ime Cit im Area 1V—=ClV-L. Geographical and monthly variations in two external and two skull charac- ters (TL, HFL, BL and I-M3) along with the enamel patterns of the third upper molar, were examined for each of CI-L, CI-S, CII-L, CII-S, CIHU-L, CHI-S, CIV- L, and CIV-S clusters (see Figs. 6-12). A marked difference was observed between CI-L and CII-L in the sizes of BL, TL and HFL, with only slight overlap between the two clusters in the relationship between CBL and TL (Fig. a De ae Bil and ios were slightly longer in CIi-E than in /Cl-L and there was no clinal variation in these dimensions (see Figs. 6 and 7). Inclusters 96 Mammal Study 21: 1996 CI-L and CII-L, BL, I-M3, TL and HFL did not vary over the geographical range (Figs.6 and 7). Molar enamel patterns differed between clusters CI-L and CII-L (Table 1), with Type C more common in CI-L (87%) than in CII-L (68%), and Types D and E less common in CI-L (2.2%) than in CII-L (2494), The clusters CIHII-L and CIV-L overlapped (Fig. 5). The sizes of I-M3, BL, and HFL tended to increase from north to south (Fig. 8). Type A molar enamel was commonest in CIV-L than in CIII-L (Table 1). Clusters CII-S, CHI-S and CIV-S all overlapped one another, but were mostly segregated from cluster CI-S (Fig.5). TL differed discontinuously BL I-M3 q/ 8 134 152 170 Flatt leet a lean \ Mar & Apr: r ae EEE 2 1 Mc 2 fesearceemins fisae 27 vor GY ae 3 Aug : =a June O83 sa tito ecoltona ey beer =) Oct & others ‘ Nov. cm June} EINE unerup ; Oct & others June & July July ii 2 12 Sept : ! ey em Ren ee He eS RR July All ea) : TR ‘ . ip oS : Os, aut 3 = July Juty & Aug eee — a ee eye | foweAug ct ol ee Se MAw : ' 20°. Ra 1 7 8 mm 134 152 120mm BL 1-M3 [oe] adult [0] young Fig.6. Geographical variation in BL and I-M3 in Eothenomys chinensis (CI-L) and E. ward (CII-L). One square represents one specimen. Month indicates collecting month of speci- mens examined. For detailes of Localities 1-6, 10, 12-13, and 17-21, see the Appendix. For enamel patterns and abbreviations of the holotypes, see Figs. 2 and 3. Kaneko, Five species of Eothenomys im China O07 beeween clusters) CI-S; -Cll-S and CIll-S. In cluster CII-S, I-M3 and BL decreased in size clinally from north to south, while TL and HFL did not differ among localities (Figs. 9-10). Type C molar enamel predominated in all four clusters (Table 1). The length of I-M3 varied according to the elevation on the Lichiang Range (Locality 38), where R. C. Andrews and E. Heller (the Asiatic Expedition in 1916) and G. Forrest in 1921-22 collected specimens (Figs. 11 and 12). Both I-M3 and HFL increased in size from higher to lower elevations in cluster CIV- S, whereas they did not show aclinal change in CIV-L. Type A molar enamel + : June O June 7 : : MAct aL N ; 6 & June June May June & July June & aay : : 3 ! eee 12 = ) : 13 sal ee! © 18 19 20 21 Alie Fig. 7. Geographical variation in TL and HFL in Eothenomys chinensis (CI-L) and E. wardi (CII-L). Month indicates collecting month of specimens examined. 98 Mammal Study 21: 1996 Table 1. Variations in the enamel patterns on the third upper molar in Eothenomys chinensis (ECHI), E. wardi (EW), E. proditor (EP), E. custos (EC), and E. olitor (EO). Type A Type B Type C Type D Type E Total xa tte CLD SC 6.5%) 2( 4.8%) 0CT0%) «1 @.29%4) 0 46 Given Te CTL) 0 3IC 7-396)! 2868237) a 819575) Coe eT Three Ths CUT) CE.) MEG) CIB%), 1 B88) 0 30 thse Ts CONT) SECIS) IC 2.9%) 0 0 0 34 OP CES 0 15.9%) 13(76.5%) 317 6%) 0 17 eet. MES) 0 (B29) 1BGBI) 1D(EB.79%) 0 31 Cea Ts CUTS) 0 LC 823%) 6(G00%), 43:32) ana) ae Gon. 1 2 CRIS) 2236) 22125375) 55638276) 8 ESO) 0 87 (een 129596) | 5 (6259) = ASN) 0 0 8 BE y 8 = =omm GE ae | ee oe | ee es ma :Apr to = Apr : : Es co ‘Mar lh : : O Feb | = 4] ‘Jan a eee Se ee ee ee a ees 7 8 —_ i O 35 mm L 18 mute IL 22 mm Fig. 8. Geographical variation in BL, I-M3, TL and HFL in Eothenomys proditor in Area III (CHU): Month indicates collecting month of specimens examined. For detailes of Localities 15-16, 22, 25, 29, 32, and 36-37, see the Appendix. Kaneko, Five species of Eothenomys 7 China 99 was commonest in CIV-L, whereas Type C predominated in CIV-S (Table 1). Specimens from CIV-S were collected at rather higher elevations than those of CN EAs Adult females and young were collected in May, June, July, August and November in cluster CI-L; in August and September in CII-L; in February, April, and May in CIII-L; and in May, June, and July in CI-S, CII-S and CIII-S, respectively (Figs. 6, 8 and 9). On the Lichiang Range, adult females and young were collected in August (4200 and 3300 m), September (4200 and 3900 m) and October (4500-4800, 3900 and 3600 m) in CIV-S, whereas they were captured in May (4200-3900 and 3900 m) and September (4200 and 2700 m) in CIV-L. One pregnant female collected in October in CIV-S (Locality 38, Bese I-M3 on (op) ~ 3 3} Cl-s ——————+-— cl-S ——-— c-s 3 8 134 152 mm BL I- M3 Fig.9. Geographical variation in BL and I-M3 in Eothenomys custos in Areas I-III (CI-S, CIII-S, and CII-S). Month indicates collecting month of specimens examined. For detailes of Localities 7-9, 11, 14, 22-24, 26-28, 30-31, 34-36, and 39-40, see the Appendix. 100 Mammal Study 21: 1996 3600 m) contained two embryos (FMNH 33792). 2. Taxonomic conclusion All 308 specimens examined in this study were found to have: i) a palatal shelf construction as in the genus Clethrionomys ; ii) rootless molars even in old age, and 111) narrower re-entrant folds on the molars than in the genus Alticola (which has little cement in the folds). All three of these characteristics are diagnostic traits for Eothenomys, to which consequently they were allocated (Hinton 1926, Ellerman 1941, Corbet 1978). Some holotypes were re-presented in the respective clusters (L and S in CI- CIV) of Areas I, II and IV (Fig.5). In Area I, specimens within cluster CI- 35 50 65mm 14 18 22 mm Mar R | Nov S 34 Nov CI Fig. 10. Geographical variation in TL and HFL in Lothenomys custos in Areas I-III (CI-S, CIII-S, and CII-S). Month indicates collecting month of specimens examined. 101 Kaneko, Five species of Eothenomys in China L were identified as Kothenomys chinensis (Thomas, 1891) because the holotypes of Microtus (Anteliomys) chinensis Thomas, 1891 and Microtus (Anteliomys) chinensis tarquinius Thomas, 1912 were both included in CI-V. The latter name Microtus (Anteliomys) chinensis tarquinius is a junior synonym of FE. chinensis (Thomas, 1891). Specimens within cluster CII-L were identified as Eothenomys wardi (Thomas, 1912) in Area II, because the holotype of Microtus (Anteliomys) wardi Thomas, 1912 occurred within the cluster. Fig.11. Altitudinal variation in BL and I-M3 in Eothenomys custos (CIV-S) and E. proditor (CIV-L) in the Lichiang Range (locality 38). Month indicates collecting month of specimens examined. a=4500—4800m; b=4200—4500 m; c=4200 m; d=3900—4200 m; e=3900 m; f=3600—3900 m; g=3600 m; h=3300m; i=2700m. Underlined records from October indi- cate specimens collected by R. C. Andrews and E. Heller. All other specimens were collected by G. Forrest. 102 Mammal Study 21: 1996 : AUG Aug & Sept . Oct | Ca aT LAS EY ce Yeas ae VE 20 3 30mm Hil: Fig. 12. Altitudinal variation in TL and HFL in Eothenomys custos (CIV-S) and E. proditor (CIV-L). Month indicates collecting month of specimens examined. Kaneko, Five species of Eothenomys in China 103 Specimens within cluster CIV-L were identified as Eothenomys proditor Hinton, 1923, because the holotype of E&. proditor Hinton, 1923 was also in the cluster. In Area III, although there was no holotype, cluster CIII-L overlapped with, and was consequently regarded as conspecific with cluster CIV-L, that is E. proditor (Fig. 5). Specimens within cluster CII-S were identified as Eothenomys custos (Thomas, 1912), because the holotype of Microtus (Anteliomys) custos Thomas, 1912 was included in the cluster. Clusters CIII-S and CIV-S overlapped cluster CII-S (Fig. 5); and all the specimens were identified as Eothenomys custos (Thomas, 1912). Microtus (Anteliomys) custos rubellus Allen, 1924 is a junior synonym of FE. custos (Thomas, 1912). It was noticeable that cluster CI-S did not overlap clusters CII-S, CIII-S or CIV-S (Fig. 5), and TL in CI-S was clearly different from those in CII-S and CIII-S (Fig. 7). However, I-M3, BL and HFL tended to either decrease or increase in size clinally, or varied continously from north to south among these clusters. Therefore, the taxonomic position of CI-S is considered to be the same as CII-S and CIII-S, which were identified as EF. custos. Consequently, Eothenomys (Anteliomys) custos hintont Osgood, 1932, included in cluster CI-S (Fig. 5), is a junior synonym of EF. custos (Thomas, 1912). The relationship between H & BL and TL (tail ratio=100TL/H & BL) varied from 55-85% in E. chinesis, from 40-65% in FE. wardi, from 50-65% in E. pres mol CII-S+CIV-S Fig. 13. The relationship between H & BL and TL in five species of Eothenomys. The ratio of TL to H & BL is shown with lines and percentages. @=E. chinensis (CI-S); O=E. Otome — Ea proation OW CIVel) A —-. wardr (CIEL): O— 2, custos invAreas n(@l-s) and II (CII-S); A=E. custos in Areas III and IV (CHI-S+CIV-S). For abbreviations of the holotypes, see Fig. 3. 104 Mammal Study 21: 1996 custos from Area I, and 30-50% in E. custos from Areas II-IV, from 30-45% in FE. olitor, and from 20-40% in E. proditor (see Fig. 13). Thus, on the basis of this character alone, it is difficult to segregate specimens of E. chinensis and E. custos hintoni from Area I, specimens of E. custos and E. wardi from Area II, or specimens of FE. custos and E. proditor from Areas III and IV. 3. Latitudinal and altitudinal distributions Eothenomys chinensis was found on both sides of the River Datu He near Omei Shan, Sichuan Province at 29-30° N. £. wardi was found to occur from the Jinsha Jiang River to the Salween River around 28° N and 99° E. E. chinensis and E. wardi have allopatric ranges separated by about 240 km. EE. custos was found from the Yalong Jiang River to the areas between the Jinsha Jiang and Lancan Jiang (=Mekong) Rivers from 26° N to 29°N. EE. proditor was found along the borders of Sichuan and Yunnan Provinces, from the Yalong Jiang River to the Jinsha Jiang River around 27-28 N. E. olitor was recorded from a fragmented range in Zhangton (Localities 41 and 42; 23° N) and Lincang (Locality 33; 27° N) districts in Yunnan Province. The latitudinal distribution of E. custos proved to be rather larger than those of either E. chinensis, E. wardi Or J2, wrocnor (kik, 14), With the exception of the fragmented range of E. olitor, the lower altitudinal limit of these four species of Eothenomys increased from north to south (see Fig. 15). The altitudinal range of E. chinensis, which extends down to 1500 m, was found to be slightly lower than that of &. wardi which occurs above 2300m. £&. custos was found at slightly higher altitudes (2500-4800 m) than FE. proditor (2500-4200 m), though the latitudinal range of EF. custos over- lapped that of E. proditor in the areas of 26-28° N and 100-102° E (Fig. 14). The lower limit of &. custos, range was approximately the same, at about 2500 m, in Areas I, HI and IV, but in Area II it decreased from 3500 m to 2700 m from north to south. Some information on the habitats of Kothenomys spp. was available from specimen labels. /. wardi was noted as occurring along the banks of streams (Locality 12), in narrow valleys in forest (Locality 18), in alpine meadows, open meadows and among rocks (Locality 13), and in alpine meadows and alpine rocks (Locality 21). E. custos was noted as occurring along forested banks, in holes under trees with runs under moss (Locality 11), under roots of large trees in very damp forests (Locality 11), in alpine meadows, rocky meadows, forests, and open coniferous forests (Locality 38 ; 3300 m), and under logs (Locality 38 ; 3150 m). E. proditor was found in open meadows and open rocky meadows (Locality 38), on mountain slopes (Locality 36), and under logs (Locality 37). Thus, the main habitat differences appear to be that E. chinensis lives in both forests and meadows, whereas FE. wardi and E. proditor inhabit meadows and rock areas. Kaneko, Five species of Eothenomys in China 105 30° ®@ E. chinensis _ 4 E.wardi Sree ©E.custos 7 E. prodi tor pe! 0 E. olitor Fig.14. Summary of the geographical distribution of Eothenomys chinensis, E. wardi, E. proditor, E. custos, and E. olitor. The broad dotted line indicates the demarcation line between the Palaearctic and Oriental regions based on mammals and birds (Zhang 1979), which passes from Zoige (33.5°N, 102.9°E), through Heishui, Barkam, Kangding and Litang, and to Batang in Sichuan Province. 106 Mammal Study 21: 1996 m e E. chinensis A E.wardi 9000 o E. custos 5 q E. proditor A o E. olitor : 4000 A 16 boa re tine ane 0 : ©3000 @o 4 % ee =) oy A 6 ie ar be . S A or oe -— L 2000 hee : Ss é 1000 =«—— Area I] ———>® =—Areas]1,0.&N——> EEE ——E—EEEEEee > fT 23 24 26 27 28 us) Lil 28 29 30°N LATITUDE Fig.15. Summary of the altitudinal distribution of the five species of Eothenomys examined in this study. Numbers with open circles indicates the localities of E. olitor listed in the Appendix. A dotted line shows the same locality. DISCUSSION Hinton (1926), Ellerman (1941), and Gromov and Polyakov (1977) all consid- ered Anteliomys to be a distinct genus, separate from Eothenomys, whereas Osgood (1932) and Allen (1940) designated Anteliomys as a subgenus of Eothe- nomys. In the present study, I have followed the opinions of Ellerman (1949), Ellerman and Morrison-Scott (1951), Corbet (1978), Honacki et al. (1982), Corbet and Hill (1992), Musser and Carleton (1993) in regarding Anteliomys as a synonym of Eothenomys. Two distinct groups of species belonging to the genus Eothenomys have been identified as occurring in the provinces of Sichuan and Yunnan. The first is the £. melanogaster group, which includes confinit, eleusis, fidelis, miletus and mucronatus, and is characterized by the fourth salient angle on the first upper molar and the third salient angle on the second upper molar on the lingual side. The second group consists either of the four species FE. custos, E. chinensis, E. olitor and E. proditor (Allen 1940, Ellerman and Morrison-Scott 1951, Corbet 1978, Honacki et al. 1982, Corbet and Hill 1991, Musser and Carleton 1993) or of the five species E. custos, E. chinensis, E. wardi, E. olitor, and E. proditor (Hinton 1926, Ellerman 1941, Gromov and Polyakov 1977, Corbet and Hill 1992), Kaneko, Five species of Eothenomys in China 107 all of which lack the inner salient angles on the first and second upper molars as found in the former group. However, Eothenomys identification has remained confused due to a lack of research into morphological variation, and because only crude distribution maps have been published (Hinton 1926, Allen 1940, Corbet 1978, Corbet and Hill 1992). During research for this paper it became apparent that Allen’s (1940) identification key for this species group was rather difficult to apply because of the discrepancies in the number of outer salient angles and in CBL between FE. proditor and E. olitor (Figs. 3 and 5) and in TL between E. chinensis and E. custos (Fig. 13). The ratio of TL to H & BL (Hinton 1926, Corbet 1978) was not sufficient for identification because of the great overlap between the two sympatric species of EF. custos and E. chinensis (or E. wardi) and between E. custos and E. proditor (Fig. 13). Furthermore, this study showed that the ranges of HFL and the ratio of TL to H&BL, and the number of inner re- entrant folds on the third upper molars given by Corbet and Hill (1992; Table 262) were erroneous for the five species. The first basic taxonomic debate is over whether wardi is a distinct species or just a subspecies of Kothenomys chinensis. Thomas (1891) originally des- cribed Microtus chinensis from a specimen collected from Kia-ting-fu (=Le- shan; Locality 3). Later, Thomas (19lla) identified 23 specimens collected from 23 miles (=36.8km) SE of Ta-tsien-lu (= Moxi; Locality 5) and Emei Shan (Locality 4) as the same species. Subsequently, Thomas (1912b) described Microtus (Anteliomys) wardi from a specimen from Chamutong (=Tra-mu- tang ; Kingdon Ward 1923; p.193; Locality 20), W. of Atuntsi, Yunnan, and differentiated it from chinensis on the basis of its much smaller bullae. Hinton (1926) followed this classification, but Allen (1940) changed the taxonomic status of wardi to that of a subspecies of chinensis, because the third upper molar was the same as that of chinensis. Ellerman and Morrison-Scott (1951), Corbet (1978), Honacki et al. (1982), and Musser and Carleton (1993) followed Allen (1940), whereas Corbet and Hill (1992) followed Thomas (1912b) and Hinton (1926). Corbet and Hill (1992) distinguished wardi from chinensis on the basis of wardi’s shorter tail and smaller auditory bulla, and remarked on the length of the bulla (BL=6.7 mm in wardi, and 9.1 mm in chinensis) as a distin- guishing character. From this study, however, it is clear that in wardi BL ranged from 6.2 to 7.4 mm, and from 6.6 to 8.4 mm in chinensis. The length of 9.1mm referred to by Corbet and Hill (1992) for chinensis may well be in error. I also regard wardi as a full species, but because not only does it have a smaller bulla but also a shorter tail and hind foot than chinensis (Fig. 7), and because its latitudinal distribution is isolated from that of chinensis (Fig. 14). The second basic taxonomic debate is over whether custos is best regarded as full species or as a subspecies of HKothenomys chinensis. Thomas (1912b) originally described FE. (Anteliomys) custos, based on two specimens from A-tun-tsi, Yunnan (Locality 11), which had a small bulla, and a shorter tail than either chinensis or wardi. Hinton (1926; p. 296 and p. 298-299 in the footnote), however, remarked that custos, was a small form very closely related mor- 108 Mammal Study 21: 1996 phologically and geographically to the larger forms chinensis and ward1, and is best regarded as a subspecies of Anteliomys (=now Eothenomys) chinensis, because neither the holotype of custos nor the other custos skulls examined were “old”, though Hinton (1926) retained the taxonomic position of custos as a full species as did Thomas (1912b) and Allen (1924). In Areas I and II, some adult females were included into clusters composed of both large (CI-L and CII-L) and small specimens (CI-S and CII-S), the last of which were clearly identified as E. custos (Figs.4 and 5). Therefore, the original specimens of custos are neither young chinensis nor wardi as suggested by Hinton (1926). Two subspecies of Hothenomys custos have been described, excluding the nominotypical subspecies. Allen (1924) described one as Microtus (Anteliomys) custos rubellus, collected from Ssu-shan (=Snow Mountain), in the Lichiang Range, Yunnan (Locality 38-e), on the basis that vubellus was a little larger on average than typical custos. Osgood (1932) described a second subspecies, Eothenomys (Anteliomys) custos hintont, from Wushi (Wu-chi on the holotype label; Locality 8), south-west of Tatsienlu, Sichuan, because it has a slightly longer hind foot and longer tail than custos. My examination showed that although the tail was longer in the specimens described by Osgood (1932), the hind foot length was not (see Fig. 10). Furthermore, Osgood (1932) stated that the interorbital width (IOW) was relatively greater in hintoni than in chinensis, and that the third inner angle of the third upper molar was usually confluent with the fourth outer one in hzntonz but not in chinensis. On further examina- tion, however, I was unable to confirm these differences: IOW (X + SD) of hintont (Localities 7-8) was 4.38+0.11mm (z=16), while that of chinensis (Localities 1-6) was 4.33220.21 mm (@W=44) G=097384, 05

’Numbered as in Fig. 1 “Total number of samples observed. Table 2. Sequence divergence among the ten mitochondrial DNA haplotypes of Apodemus agrarius from Korea (Upper right), on the basis of the number of common and different fragments (Lower left). Sequence divergence (%)* Haplotypes Aacl Aac2 Aac3 Aac4 Aacds Aac6 Aahl Aah2 Aah3 Aah4 Aacl = ial 1.38 aS 2 AS AG LG 2.4 2.8 ANaeZ 27/11 = OFZ 2.9 2.9 326 ea 2 1.9 7 of Aac3 DoS SOP? : 3383 323 340 Led ie 22 2.6 Aac4 22/21 20/26 19/28 + 0.4 7, Boll Bell 3.8 4.4 Aacd 20/25 20/26 19/28 31/4 = Te 2D Deo Bd 4.0 Aac6 16/330) 18730) 18/306 22/22 922)//22 = SA 3), 1 Bm 4.4 Aahl DAN 25) WA DAY NG SY 2 Gi Zale 22 sy 28 = 0.2 0.8 iL! Aah2 WY N5 DOA Myla ISV/25 BO/24. IGy25 30/2 = 0.6 2 Aah3 D2 PY) “D2 2QYD ABO IV 23 W/O ALIS 28/6 = 0.6 Aah4 20/25. 22/22, 2M 24 16/34 7/32 16/345 25) 14 26 eS = aSequence divergences calculated according to Gotoh et al. (1979). repeating units (repetype) of A. agvarius previously constructed by Suzuki et al. (1990). Among the 26-27 restriction sites examined, these were an EcoRI site in the spacer upstream of the 18S rRNA gene (Fig. 2a), an AaflI site in the internal spacers, three were polymorphic both within and between individuals, and a Dral site in the spacer downstream of the 28S rRNA gene. These kinds of polymorphism were observed in both subspecies and thus were presumed to have occured before subspecific differentiation. These polymorphic sites were likely to have been subjected to random and independent fixation processes, as observed in the natural populations of the Japanese field mouse, A. speciosus (Suzuki et al. 1994). In contrast, polymorphism in a SacI site on the internal spacers was consistently and specifically observed in the genomes of individ- uals of A. a. chejuensis (Fig. 2b). Since the apparent differences between the two subspecies are confined to this variation, it may be concluded that the A. a. coreae and A. a. chejuensis have similar genomic constitutions, but have Han et al., Molecular variation in Korean striped field mice 1S ~B

18SA INT 28S ERR EVIE MH) IDXGLG =A Ss SA EDDVS XA BHP G eines — Wp NZ See Va 2 Vem wo GS ss EDDVS XA BHP G chejuensis 1, \IZ \ gel 2 kb Fig. 3. Restriction maps of the major rDNA repetypes of Apodemus agrarius coreae and A. a. chejuensis. With respect to the restriction sites on the flanking spacers, only those nearest to the distal end of the genes for 18S and 28S RNA are shown. The top diagram shows the conserved restriction sites in the coding and the internal spacer regions of the gene for 18S and 28S RNA, which are not represented in the lower maps. Probe’s positions are shown with arrows. Asterisks indicate polymorphic sites within and between individuals. A= Agia — boii — Mal: b—Pcokl ~G— belll, Hi hndilP—Psil: S—Sael- Vi= Poull; and X= Xbal. differentiated substantially from each other as far as rDNA-RFLP is con- cerned. 2. Restriction-fragment patterns of mtDNA Ten different haplotypes (Aac 1-6 and Aah 1-4) were found in this study (Table 1), their banding patterns, from the Southern blot analysis, with the ten restriction enzymes may be seen in Fig.3c. There are distinct variations within this species. In particular, individuals from the two offshore islands of Jindo and Goeje, displayed different cleavage patterns from those from all other localities. To estimate the degree of sequence divergence between haplotypes, we compared site differences between different mtDNA haplotypes. The sequence divergence among mtDNA haplotypes can be estimated from the number of common and of different restriction fragments observed (Table 2). From estimates of the amount of sequence divergence, we constructed two phylogenetic trees for mtDNA haplotypes using both the UPGMA and NJ (Fig. 4a) methods. Additionally, by considering the presence or absence of each of 68 restriction fragments (Table 1), we were also able to construct a phylogenetic tree by the maximum parsimony method (Fig. 4b). The topology of the parsimony tree was identical to that of the UPGMA tree and almost identical to that of the NJ tree. The ten haplotypes were clustered into four groups; Aac 1-3 from the Korean mainland, Aah 1-4 from Cheju-do, Aac 4 and Aac 5 from Geoje Island, and Aac 6 from Jindo Island. In contrast with the rDNA data, the mtDNA haplotypes of A. a. coreae were remarkably differ- entiated, showing the greatest sequence divergence, of 4.3%, between Aacl and SZ Mammal Study 21: 1996 a Aah1 D 44 Aah1 Aah2 7 Aah2 Aah3 Sane Cheju Isl. Aah4 Aah4 Aact 97 Aact Aac2 99 Aac2 meee of Ko Aac3 Aac3 a Aac4 Aac4 Geoje Isl. Aac5 Aac5 Aac6 Aac6 ] Jindo Isl. 1% Fig. 4. NJ phylogenetic tree (a) and parsimony tree (b) for the ten haplotypes of mtDNA from A. agrarius collected from the Korean mainland, and from Cheju, Geoje, and Jindo islands. The bar below the NJ tree indicates 1% corrected sequence divergence. The bootstrap percentages are given for the maximum parsimony tree. Abbreviations for ha- plotypes are the same as in Table 1. Aacé6. DISCUSSION From a molecular phylogenetic perspective, two conclusions can be drawn from our analyses of RFLP of rDNA andmtDNA. Firstly, the results of RFLP of nuclear rDNA suggest that the degree of genetic divergence within and between the two Korean subspecies of striped field mice, A. agrarius coreae and A. a. chejuensis, is low. Secondly, the results of the mtDNA RFLP revealed the presence of several distinct mtDNA haplotypes among the various popula- tions, irrespective of their geographic distribution. These observations indi- cate that Korean striped field mice have similar genetic backgrounds but may have had a somewhat complex history. From our examination of the rDNA data, we concluded that the extant Korean populations of A. agrvarius share a similar genetic background. Two subspecies have become slightly differentiated from each other, but only one restriction site (among the 26-27 examined) was observed as a Cheju-specific variation. The new SacI site was observed in approximately half the rDNA repeating units within the genomes of individuals of A. a. chejyuensis. This level of difference is smaller than that between the two mouse subspecies, Mus musculus domesticus and M. m. musculus, in which four out of 20 sites examined have differentiated substantially (Suzuki et al. unpublished data). Our conclu- Han et al., Molecular variation in Korean striped field mice 133 sion, that the genetic backgrounds of the two Korean subspecies of A. agrarius are generally similar though slightly differentiated, is consistent with the conclusions of other authors. These two subspecies differ in body size (Jones and Johnson 1965) and in their electrophoretic patterns of transferrin (Tsuchiya 1984), but they are similar in karyotypes (Tsuchiya 1984). Our conclusion is also compatible with geographical evidence indicating that the final isolation of Cheju-do, from the mainland of the Korean Peninsula, occurred only 10,000- 20,000 years ago (Park 1988, Ohshima 1990). In contrast with the rDNA data, cleavage patterns of mtDNA by restriction endonuclease digestion, revealed unexpected patterns. It was found that the Korean populations of A. agrarius contain several distinct mtDNA haplotypes, as shown in Tables 1 and 2. Koh et al. (1993), working with populations from the Korean mainland, have also observed considerable differentiation in mtDNA haplotypes, ranging from 0.2% to 2.3% sequence divergence. Interest- ingly, our data revealed that the haplotypes of individual mice from the two offshore islands of Jindo and Geoje, were distinct from those of the mainland, even though these islands are geographically close to the mainland and thought only to have been finally isolated from the Korean Peninsula within the last 10,000 years (Park 1988). The divergence between the two different groups of mtDNA is very large, with sequence divergence of up to 4%, corresponding to divergence times of 1-2 million years, if the evolutionary rate of mtDNA is accepted to be 2-4% per million years (Wilson ef a@/. 1985). It is not clear why such highly differentiated mtDNA haplotypes exist, in particular, on the off- shore islands, however, there appear to be two possible explanations. Firstly, 1-2 million years ago may have already become differentiated ancestral Korean populations of A. agrvarius and their distinctive mtDNA has merely been maintained on the offshore islands which were periodically isolated during the last ice age. During each period when the islands were connected to the Korean mainland, mtDNA haplotypes may have been mixed among individuals from the whole area of the Korean Peninsula, and then during subsequent isolation, just one mtDNA haplotype may have become fixed on each of the offshore islands. Korea has many such offshore islands and thus there are many opportunities to maintain many haplotypes of mtDNA. Secondly, it is possible that some of the distinct haplotypes may have migrated from other regions of the world. A. agrarius is so widely distributed that individuals from other areas may have been able to contribute to the accumulation of such extensive heterogeneity of mtDNA in Korea. Although we do not have suffi- cient data on mtDNA haplotypes from other pairs of the world, our preliminary investigations show, however, that these Korean haplotypes are not related to any mtDNA from individuals collected from China, Taiwan, Russia, or Ger- many (Suzuki et al. unpublished data). Thus, it seems most likely that the distinct haplotypes observed in Korea were generated there during the last ice age. Another interesting issue is the amount of heterogeneity of mtDNA from Cheju-do. The mtDNA haplotypes from Cheju-do were related to one another, 134 Mammal Study 21: 1996 but showed relatively high sequence divergences of up to 1.4% (Aahl and Aahé4 ; Table 2). The results indicate that mtDNA started diverging at least 0.4-0.7 million years ago. Because these forms of mtDNA are absent from the other Korean localities examined so far, it is strongly suggested that A. agrarius was already distributed on Cheju-do, and probably also on the Korean Peninsula, at least by the middle of the Pleistocene. It remains uncertain, however, how such divergent mtDNA haplotypes have survived on this small island of just 1819 km’. Distinct haplotypes were even found at the same collection points, and a particular haplotype was found at several different localities. For examples, haplotype Aah 2 was collected at localty 6 (980 m above sea level) and at locality 8 (1700 m above sea level) on Mt. Halla (see Fig. 1). Thus, it may be concluded, that there are no significant biogeographic barriers on Cheju-do, and that no significant “bottle-neck event” has occurred in popula- tions of A. a. chejuensis during the last half million years. In general, mtDNA phylogeny does not always reflect the true phylogeny of either populations or species. As found in this study, mtDNA from Korean A. agrarius also showed such intrinsic patterns without consistency, either in the time of divergence or in geographic distribution. Our data may, however, provide some clues as to the reasons for the high degree of intra-specific mtDNA differentiation. In the case of Korean A. agvarius, the intrinsic geo- graphic distribution of the mtDNA haplotypes may be due to the random dispersion of mtDNA which diverged many millenial ago, furthermore, the existence of numerous offshore islands around South Korea may have helped maintain such differentiated mtDNA. In order to clarify this issue, further examinations of samples collected from Korea, as well as samples collected from other countries are necessary. Acknowledgments : We thank Dr. S. Sakurai of the Jikei University School of Medicine, and Dr. K. Moriwaki of the Graduate University for Advanced Studies, for motivating us to undertake this research. We also thank Dr. H. Abe of Hokkaido University, and Dr. M. Sakaizumi of Niigata University, for their valuable comments. This study was supported in part by Grants-in-Aid for Scientific Research from the Ministry of Education, Science, Sports and Culture, Japan. REFERENCES Allard, M. W. and R. L. Honeycutt. 1991. Ribosomal DNA variation within and between species of rodents, with emphasis on the genus Onychomys. Mol. Biol. Evol. 8:71—84. Arnheim, N. 1983. Concerted evolution of multigene families. 2 Evolution of Genes and Proteins (M. Nei and R. K. Koehn, eds.) pp. 38—61. Sinauer, Sunderland Mass. Arnheim, N., M. Krystal, R. Schmickel, G. Wilson, O. Ryder and E. Zimmer. 1980. Molecular evi- dence for genetic exchanges among ribosomal genes on nonhomologous chromosomes in man and apes. Proc Natl Acad) Sci-sUSAY 772 1323 — (32 Felsenstein, J. 1993. PHYLIP: Phylogenetic inference package, version 3.5c. Department of Genetics, University of Washington, Seattle. Han et al., Molecular variation in Korean striped field mice BS Ferris, S. D., R. D. Sage, C. M. Huang, J. T. Nielsen, U. Ritte and A.C. Wilson. 1983. Flow of mito- chondrial DNA across a species boundary. Proc. Natl. Acad. Sci. USA 80 : 2290—2294. Gotoh, O., J. Hayashi, H. Yonekawa and Y. Tagashira. 1979. An improved method for estimating sequence divergence between related DNAs from changes in restriction endonuclease cleavage sites. J. Mol. Evol. 14: 301—310. Hillis, D. M. and S. K. Davis. 1986. Evolution of ribosomal DNA: Fifty million years of recorded history in the frog genus Rana. Evolution 40: 1275—1288. Hillis, D. M. and S. K. Davis. 1988. Ribosomal DNA: Intraspecific polymorphism, concerted evolu- tion, and phylogeny reconstruction. Syst. Zool. 37 :63—66. Jones, J. K. and D. H. Johnson. 1965. Synopsis of the lagomorphs and rodents of Korea. Univ. Kansas Publ. Mus. Nat. Hist. 16 : 357—407. Jukes, T.H. and C.R.Cantor. 1969. Evolution of protein molecules. /z Mammalian Protein Metabolism. (M. H. Munro ed.) pp. 21—132. Academic Press, New York. Koh, H.-S., S.-K. Yoo, S.-B. Kim and B. -S. Yoo. 1993. Variation of mtDNA in striped field mice, Apodemus agrarius coreae Thomas, from the Korean Peninsula. Kor. J. Syst. Zool. 9: 171—179. Kominami, R., Y. Urano, Y. Mishima and M. Muramatsu. 1981. Organization of ribosomal RNA gene repeats of the mouse. Nucleic Acids Res. 9 : 3219—3233. Kominami, R., Y. Mishima, Y. Urano, M. Sasaki and M. Muramatsu. 1982. Cloning and determina- tion of the transcription termination site of ribosomal RNA gene of the mouse. Nucleic Acids Res. 10 : 1963—1979. Maniatis, T., E. F. Fritsch and J. Sambrook. 1982. Molecular Cloning. Cold Spring Harbor Labora- tory, Cold Spring Harbor, New York. Ohshima, K. 1990. The History of Straits around the Japanese Islands in the Late-Quarternary. The Quarternary Research 29 : 193—208 (in Japanese with English abstract). Park, Y.-A. 1988. Continental shelf sedimentation. In Geology of Korea. (D. -S. Lee, ed.) pp. 406— 426. Kyohak-sa, Seoul. Saitou, N. and M. Nei 1987. The neighbor-joining method: a new method for reconstructing phylogenetic trees. Mol. Biol. Evol. 4: 406—425. Sokal, R. R. and C. D. Michener. 1958. A statistical method for evaluating systematic relationships. Univ. Kansas Sci. Bull. 28 : 1409—1438. Suzuki, H., N. Miyashita, K. Moriwaki, R. Kominami, M. Muramatsu, T. Kanehisa, F. Bonhomme, M. L. Petras, Z.-C. Yu and D.-Y. Lu. 1986. Evolutionary implication of heterogeneity of the nontranscribed spacer region of ribosomal DNA repeating units in various subspecies of Mus musculus. Mol. Bio. Evol. 3: 126—137. Suzuki, H., K. Moriwaki and E. Nevo. 1987. Ribosomal DNA (rDNA) spacer polymorphism in mole rats. Mol. Biol. Evol. 4:602—607. Suzuki, H., K. Tsuchiya, M. Sakaizumi, S. Wakana, O. Gotoh, N. Saitou, K. Moriwaki and S. Sakurai. 1990. Differentiation of Restriction Sites in Ribosomal DNA in the Genus Apodemus. Biochem. Genet. 28 : 137—149. Suzuki, H., K. Tsuchiya, M. Sakaizumi, S. Wakana and S. Sakurai. 1994. Evolution of restriction sites of ribosomal DNA in natural populations of the field mouse, Apodemus speciosus. J. Mol. DVO, Sts} § OIDs Tsuchiya, K. 1984. Development and utilization of characteristics of field mice. In Report by the Grant-in Aid for Scientific Research from the Ministry of Education, Science and Culturof Japan (1981 —1983). (T. H. Yoshida ed.) pp.17—25 (in Japanese). Wakana, S., T. Watanabe, Y. Hayashi and T. Tomita. 1986. A variant in the restriction endonu- clease cleavage pattern of mitochondrial DNA in the domestic fowls (Gallus gallus domesticus). Anim. Genet. 17 : 159—168. Wilson, A.C., R.L.Cann, S.M.Carr, M. George, U.B.Gyllensten, K. M. Helm-Bychowski, R. G. Higuchi, S. R. Palumbi, E. M. Prager, R. D. Sage and M. Stoneking. 1985. Mitochondrial DNA and two perspectives on evolutionary genetics. Biol. J. Linn. Soc. 26 : 375—400. Wilson, G. N., M. Knoller, L. L. Szura and R. D. Schmickel. 1984. Individual and evolutionary varia- tion of primate ribosomal DNA transcription initiation regions. Mol. Biol. Evol. 1 : 221—237. Yonekawa, H., K. Moriwaki, O. Gotoh, J. I. Hayashi, J. Watanabe, N. Miyashita, M. L. Petras and Y. 136 Mammal Study 21: 1996 Tagashira. 1981. Evolutionary relationships among five subspecies of Mus musculus based on restriction enzyme cleavage patterns of mitochondrial DNA. Genetics 98 : 801—816. Yonekawa, H., K. Moriwaki, O. Gotoh, N. Miyashita, N. Matsushima, L. Shi, X.-L. Zhen and Y. Tagashira. 1988. Hybrid origin of Japanese mice “Mus musculus molossinus” : evidence from restriction analysis of mitochondrial DNA. Mol. Biol. Evol. 5:63—78. (Accepted 10 January 1997) Mammal Study 21: 137-151(1996) © the Mammalogical Society of Japan Foraging behavior of red foxes Vulpes vulpes schrencki utilizing human food in the Shiretoko National Park, Hokkaido Hideharu TSUKADA* and Nariaki NONAKA! Regional Sciences, Faculty of Letters, Hokkaido University, N1IO W7 Kita-ku, Sapporo O60, Japan, ‘Laboratory of Parasitology, Graduate School of Veterinary Medicine, Hokkaido University, NI8 W9 Kita-ku, Sapporo O60, Japan Abstract. The utilization of human food (provisions) by red foxes, Vulpes vulpes schrenckt, in the Shiretoko National Park was investigated to clarify the significance of begging behavior in a natural habitat. An analysis of 736 scats showed that foxes ate prey, such as rodents, insects, fruits, birds and deer, mainly in relation to their seasonal availability. The tendency to depend on a single dietary component increased in the latter half of the tourist season, when many tourists fed foxes, and was lower during the non-tourist season and the first half of the tourist season. The monthly variation in the utilization of provisions did not correlate with availability, and was negatively correlated with the increase in other single dietary components during the tourist season. During the non-tourist season, when relatively little natural food was available, foxes expended great energy to obtain provisions. It is concluded that red foxes in the Shiretoko NP, utilize provisions as a secondary food supply. Such food could be critical for them, however, in order to compensate for the lack of their major natural food resources at certain times of the year. Key words: begging behavior, food habits, foraging behavior, provisions, Vulpes vulpes schrenckt. Red foxes, Vulpes vulpes, have a wide ranging diet, enabling them to survive in various environments. They are also flexible in their foraging behavior, changing to cope with the variation in the availability of each food item, as determined by their distribution, and abundance. One example of their flex- ibility is the development of begging, appearing in front of humans and waiting for them to provide food. In heavily human-influenced habitats, scavenging enables foxes to access the abundant food source in the form of human waste, begging allows access to additional supplies actually given by people. In England, for example, it is well known that some urban residents actually feed foxes (Macdonald 1987), *Present address: Laboratory of Parasitology, Graduate School of Veterinary Medicine, Hokkaido University, N18 W9 Kita-ku, Sapporo 060, Japan Fax. 011-717-7569, e-mail. tsuka @ vetmed. hokudai. ac. jp 138 Mammal Study 21: 1996 and in some cities in Hokkaido, Japan, foxes beg for food (Watanabe 1996). Hence, begging for food is a profitable strategy in areas inhabited by people. Of particular interest, however, is that foxes in more natural habitats also develop this strategy. In the Shiretoko National Park (Shiretoko NP), one of the most famous natural ecosystems protected in Japan, red foxes have been observed begging for food since 1970 (Tsukada 1994, Watanabe and Tsukada 1996). Tsukada (1994) indicated that begging was acquired by foxes through interactions with humans during their early lives, however, neither the factors which lead foxes to beg, nor the influence of the development of begging behavior on the utilization of natural food, have been clearly understood. In this study, seasonal changes in the frequency of begging, and its relation- ship to human and natural food availability, were analyzed in order to clarify the importance of begging by foxes living in natural habitat. MATERIALS AND METHODS 1. Study Area The study was conducted in the Shiretoko NP, eastern Hokkaido (Fig. 1), where the mean annual temperature is about 6°C and precipitation is 1100 mm, with winter snow depths reaching 1-2 min lowland areas. The park is visited by 15 million tourists every year. This intensive study was conducted along the main tourist road in the park, the Shiretoko Park Road. This road has two Va Gate for vehicles Sea of Okhotsk 0 ikm 2km BOS. a Utoro Town ,e° : "=~. Shiretoko Park Road National Park — Study Road ~~ Coastline —___ Road Town River eeee National Park : Boundary @ Gate for vehicles Fig.1 Map of the study area. Tsukada and Nonaka, Human food utilization by red fox 139 gates, which are closed during winter. Gate A is open from May to November, enabling tourists to visit the south-west section of the road, and Gate B is open from June to October, enabling tourists to reach Point “E” (Fig.1). The vegetation of the area is comprised of mixed broad-leaved and coniferous forests, with an admixture of the wild cherries, Prunus ssiori and Prunus sargentii, and lianes, such as the Tore vine, Actinidia arguta, and the wild grape, Vitis coignetiae, which occur at the edge of the forest. 2. Capturing and Identification of Foxes From 1992 to 1994, forty three red foxes (18, #25) seen begging for food were captured in the study area, and fitted with individually identifiable colored ear tags (Allflex 25, Allflex New Zealand Ltd.). Foxes were classified into two age groups: juveniles ( 0.05) 142 Mammal Study 21: 1996 ==@=—= begging =@= provisions Frequency of fbegging Abundance of provisions Jun Jul Aug Sep Oct Jun Jul Aug Sep Oct 1993 1994 Fig.2 Monthly variation in the frequency of begging by adult foxes (solid line with circles), and in the abundance of provisions (broken line with squores) in the study area. 0.45 3.5 0.4 3 o m 0.35 © = 25 © a) 0.3 = 2 (= = 0.25 2 @ fe) > =} oS 0.2 = Q : lf 3 = he s 0.15 & be 5 UL. 0.1 S 0.5 0.05 0 0 Jun Jul Aug Sep Oct Jun Jul Aug Sep Oct 1993 1994 Fig.3 Monthly variation in the frequency of begging by eight juvenile foxes in 1993 (solid line and circles) and in the average number of juvenile foxes begging per km in 1993 and 1994 (histogram). Tsukada and Nonaka, Human food utilization by red fox 143 0.35 0.30 0.25 0.20 Frequency of begging Jun Jul Aug Sep Oct Jun Jul Aug Sep Oct 1993 1994 Fig.4 Monthly variation in the frequency of begging by three foxes born in 1993. The frequency of begging by adult foxes varied both between and within years. Among the 12 adults which were observed begging in both 1993 and 1994, the mean frequency of begging was significantly higher in 1993 (0.27+0.03 SE penanwimel994) (0:15s20,02 SE 2 Wilcoxon sign rank test, p<0.01). In both years, however, adults were found to beg most in June and least in autumn (Fig. 2). This pattern of seasonal change was consistent in both years (r°=0.96, p< 0.06, m=). The availability of provisions also varied between and within years. The mean abundance of provisions was significantly lower in 1993 (1.12+0.32 SE), than in 1994 (1.55+0.55 SE : Wilcoxon sign rank test, $<0.05). It increased in summer, peaked in August, and decreased in autumn in both years. Surprising- ly, the frequency of begging did not correlate with the availability of provi- sions. As with adults, the mean frequency of begging by juvenile foxes also varied within the year, however, monthly fluctuations were not in phase with adults ; it was, for example, lower in summer and higher in autumn, while the reverse occurred in adults in 1993 (Figs. 2 and 3). In 1994, however, juveniles showed little begging behavior in autumn, and the number of juveniles begging per km was significantly lower than in 1993 (Wilcoxon sign rank test, p<0.05; Fig. 3). Three young foxes born in 1993, also remained in their natal range throughout the 1994 study period. Their seasonal frequency of begging differed noticeably from that in 1993, and was highly correlated with that of other adult foxes (r= OUI, DKWAS 2 Wie 4S Cit, ies 2), 144 Mammal Study 21: 1996 2. Food habits and food availability Fecal analysis revealed that in terms of perctage occurrence, six food items ranked highest : roughage, rodents, insects, fruits, birds, and deer. Although roughage (consisting of dry twigs, dry leaves and grasses) occurred most frequently in feces, it was assumed to have been accidentally included in samples when collecting them, or that it had been swallowed with other food by the foxes, because it had not been listed as a staple food in previous fox studies (Abe 1975, Misawa 1979, Yoneda 1982, Kondo ef al. 1986). Therefore, roughage was excluded in the following analysis. Five of the highest ranking dietary components by weight were: fruits, rodents, insects, deer and birds, which together accounted for 71.0% of the total weight of feces. Hence, the five major foods of Shiretoko foxes, both by percentage occurrence and by percent- age weight, were rodents, insects, fruits, birds and deer. Provisions appeared in 11.8% of all fecal samples and accounted for 4.3% of total fecal weight (Table 2). Table 2. Annual diet composition of fox feces in the Shiretoko National Park (n=736). Food categories Occurrence (%) Weight (%) Rodents 40.1 W,.2 Insects 40.1 JUL o Fruits 2625 29.5 Birds “fh AD Cell Deer GEG 9.9 Fishes 9.5 6.2 Other mammals evi Zod Unidentified ALD 1.6 Soil AM Hall Earthworms 3.4 4.3 Other animals D8 0.8 Reptiles el 0.6 Shellfishes 05 eZ Crustcea (a3 0.1 Fungi 0.3 <0), Jl Roughage 44.6 Daw Human foods RS ALS} The composition of the diet was found to vary with the seasons. The greatest range of food categories found in feces occurred in April, May and June. The range then decreased until September, increased again in October and November, and decreased once more in January and February (Fig. 5). From May to November, just one food category occurred in more than 50% of scats each month. The percentage occurrence of the most frequently occur- ring category, each month, increased from May to November (with the excep- tion of September, when the sample size was very small; Fig.5). Thus, the tendency to depend on a single dietary component increased from spring to Tsukada and Nonaka, Human food utilization by red fox 145 % Percent Occurrence Number of food categories Apr May Jun Jul Aug Sep Oct Nov Jan-Feb Tourist Season Fig.5 Seasonal variation in the number of food categories occurring in feces (broken line with squares) and the percent occurrence of a food category showing the highest value each month (solid line with circles). autumn, and decreased in winter. The utilization of main food categories also changed seasonally. Fruits, such as A. arguta, V. coignetiae and Prunus spp., occurred most in autumn, with A. arguta in particular, accounting for 87.9% of the total weight of fruits taken. The seasonal variation in both percentage occurrence and percentage weight of fruit in fox feces was correlated with the change in their relative abundance (occurrence: Kendall’s r=0.68, p<0.05; weight: Kendall’s r=0.58, p<0.05; Fig. 6A). Rodents included the northern red-backed vole, Clethrionomys rufocanus, and the grey red-backed vole, C. rutilus, and two endemic species of field mice Apodemus speciosus and A. argenteus. Voles occurred in 91.8% of scat samples containing rodents, and accounted for 90.2% of their total weight. Rodents occurred mostly in May, although the highest percentage by weight was in April (Fig.6B). The abundance of rodents increased sharply from June to August, reaching a peak in October, yet there was no correlation with percent- age occurrence in feces (Kendall’s r=-0.36, p>0.05), although there was a negative correlation with percentage weight (Kendall’s r=-0.71, p<0.05; Fig. 6B). Insects available to foxes included Hymenoptera, Coleoptera, Orthoptera, and various larvae. Coleoptera in particular occurred in 91.8% of scats containing insects, and accounted for 96.4% of their total weight. Most insects occurred in samples collected during summer (Fig. 6C), with their percentage occurrence (Kendall’s 7=0.81, p<0.05; Fig. 6C) in scats correlated with their 146 Mammal Study 21: 1996 ¢ _ A:Fruits = C:Insects = 1 2 * 100 8 =. 3 3 5 80 0.8 5 5 3 : > : On 60 06 2 o ro) or LEG g = 40 04 § se) ow ce} wo no) ~—_ © = xe 20 ; j 0.2 g x Fi = io ra D Rao ro Co) Apr May Jun Jul Aug Sep Oct Nov Jan- e a = Feo Ss g _ B:Rodents RY e s = 100 1400 Q ae 1200 ¥ 5 3 3 80 g 5 FS S 1000 2 ro} 8 60 : g 8 a Cc Cc ig 40 © s eS 3 400 © J oO = Fr OS 200 & = _— i ® Apr May J Jul Aug S Oct Nov J ® lg a in = g rah g p y Jun Jul Aug Sep Oct Nov ca z = F:Provisions a) 3 ra ¢ 2 5 2 ® 80 7] 5 = 3 8 § 60 3 : 2 ; Q Z 20 oS = = a 2 3 0 2 s Feb S Feb --@-- percent occurrence of each food item —A— percent weight of each food item [——) abandance of each food item Fig.6 Seasonal variation in the weight and occurrence of six dietary components and their abundance in the study area. availability. The percentage weight, however, did not correlated with their availability (Kendall’s r=0.52, p > 0.05). Birds were most abundant in May and September, however, neither their percentage occurrence nor their percentage weight in scats correlated with their abundance (occurrence: Kendall’s r=0.42, p>0.05; weight: Kendall’s t=—-0.99, p>0.05) (Fig. 6D). A few pieces of egg shell were present in samples from May to July. Tsukada and Nonaka, Human food utilization by red fox 147 Sika Deer, Cervus nippon, occurred more frequently during April, May and June than in other months (Fig. 6E). In June, a few calf hooves were present in samples. Provisions occurred most frequently during the tourist season, in spring and summer, peaking in June (Fig. 6F), and less frequently during the non- tourist season. During the tourist season, provisions included plastic mater- ials, paper, aluminum foil, and corn. ‘The frequency of begging by adult foxes during this season, correlated with the percentage weight (Kendall’s r=1.0, p< 0.05, n=5), but did not correlated with the percentage occurence of provisions (Kendall’s r=0.6, p>0.05, n=5). This is probably due to the small sample size in September when begging was unexpectedly scarce. During the tourist season, provisions identified in fox scats were mostly composed of food given by people to begging foxes. The availability of provisions during the tourist season peaked in August, but did not correlate with either the percentage occurrence or the percentage weight of provisions in scat samples (occurrence : Kendall’s r=-0.14, p>0.05; weight: Kendall’s r=-0.24, p>0.05; Fig. 6F). The percentage occurrence of provisions in scats each month was found to be negatively correlated with the percentage occurrence of the most frequently occurring food during the tourist season (r=0.96, 6 < 0.01), and showed a similar tendency in relation to the number of food categories, although the correlation was not significant in this instance, perhaps because of a potential bias in September due to the small sample size (Fig. 5, Fig. 6F). During the non-tourist season, provisions occurred most in April and May, and household scraps were observed in 64% of feces counting all provisions. DISCUSSION Begging by red foxes did not differ between the sexes, or between adults in differing reproductive conditions, thus indicating a general similarity in feeding strategies. This is in agreement with data on the food habits of hunted foxes from other countries, which also indicated that males and females had similar diets (Englund 1965, Sequiera 1980). The difference in the frequency of begging, between juvenile and adult foxes changed seasonally. The frequency of adults begging decreased in autumn in 1993 and 1994, but the frequency of juveniles begging increased only in autumn 1993. Juvenile foxes were probably fed by their parents until they were 13 weeks old, or until July or August, and they gradually began to feed themselves (Nakazono 1994). In general, juveniles have inferior hunting skills during their first autumn, therefore, they tend to depend on more easily acces- sible food than adult foxes (Englund 1969, Sargeant et al. 1984). This would explain the increase in the frequency of begging among juveniles from spring to autumn in 1993, and furthermore, by the following year, 1994 (by when they had become more skillful hunters), three of those same juveniles from 1993 showed the same seasonal change in begging frequency as other older adults. What was unexpected, however, was a reduction in the frequency of 148 Mammal Study 21: 1996 begging by juvenile foxes from summer to autumn 1994. In October and November 1994 the fruit biomass of A. arguta was higher than in an average year (Matsuda pers. comm.), not surprisingly the readily available fruits dominated the diet of the foxes, occurring in 86.6% of scats (n=149). This was significantly higher than 1993 (33.8%, n=157; 7?=88.5, Fisher’s exact p< 0.001; Tsukada unpubl.). Thus, unlike in autumn 1993, in autumn 1994 juve- nile foxes were easily able to depend on these fruits, their abundance probably explaining the decrease in begging in autumn 1994. The seasonal change in the frequency of begging by adult foxes was similar in both 1993 and 1994. If this change was dependent on food abundance, it should have been positively correlated with changes in the abundance of provisions in each year. Such a correlation, however, was not observed. Furthermore, adults begged less frequently in 1994 than in 1993, whereas conversely provisions were more abundant in 1994 than in 1993, suggesting that there was no relationship between frequency of begging by adults and the availability of provisions. Why didn’t begging frequency correlate with either seasonal or annual variation in the abundance of provisions? According to Calisti et al. (1990), and Doncaster et al. (1990), the diet of red foxes varies in relation to food availability. The foxes in the Shiretoko NP study area tended to prefer one food category in each season. Such seasonal switching of preferred foods and main food categories is likely to be dependent on their availability. Food availability, however, can be broken down into two important aspects: abundance and ease of acquisition. Food items such as fruits and terrestrial insects are easily obtainable, thus their availability is directly correlated with abundance. In fact, foxes in the study area chose these foods in relation to their abundance. On the other hand, the availability of active prey, such as live rodents and birds, is dependent on both their abundance and on their ease of acquisition. Rodents and birds were consumed by foxes but not in direct relation to their abundance. During springs when ground cover, such as snow and grasses, were scarce, and hence rodent vulnerability was high, rodents were eaten frequently (Yoneda 1983, Jedrzejewski and Jedrzejewski 1992). Birds were eaten most during the migration seasons (April and September ; Matsuda pers. comm.), and during the nesting season (May to July), indicating that they were most intensively predated when most vulnerable. The utilization of deer by foxes increased from April to May (the period of highest mortality ; Kaji pers. comm.) ; it was also common in June, the peak birth period for deer on Shireto- ko (Yabe 1995). Thus, rodents, birds and deer, major items in the diet of foxes on Shiretoko, were utilized depending on their vulnerability. Adult foxes were easily able to obtain provisions during the tourist season. Even juvenile foxes, with inferior foraging skills and still mostly dependent on their parents for food, were able to obtain food from people. Therefore, the availability of provisions is considered to be directly correlated with its abun- dance. The utilization of provisions by foxes in the tourist season, however, did not depend on their availability. In fact, fecal and behavioral analyses Tsukada and Nonaka, Human food utilization by red fox 149 indicated that utilization of provisions was strongly dependent on the utiliza- tion of other food items, probably based on their availability. Indeed, the utilization of provisions was negatively correlated with the frequency of the primary dietary component during the tourist season. A low contribution of a principle dietary component indicates the low availability of any particularly palatable prey. Such deficiencies tended to occur during April, May and June, and also during January and February. During these periods, foxes broaden their diet to include less preferred prey, such as shrews, insectivorous small mammals (Macdonald 1977) which occur in feces only during April (weight: 1.8% ; occurrence: 5.3%) and May (weight : 0.3% ; occurrence: 1.0%). Of particular interest is that provisions were found more frequently in feces during April, when the park road was closed, than in October, indicating that foxes made lengthy excursions to human residential areas up to 13 km from the locations where feces were collected. Admittedly, such excursions were made by some foxes which begged for food even during the non-tourist season (Tsukada 1994). These particular individuals expended a great deal of energy to obtain provisions when major natural foods were scarce. Given that foxes in the Shiretoko NP showed no notable inclination towards provisions, even during the tourist season, when the availability of provisions was highest, it appears that provisions were utilized mainly as a secondary food source, when more palatable and preferred natural foods were absent or less abundant. This observation is not unique, as Englund (1965), and Lucherini and Crema (1994) also observed that some human waste were used as a secondary food source in other natural habitats. The major, previously reported, fox prey items are small rodents, hares and rabbits, wild fruits and berries, insects, and birds (Ables 1975, Lloyd 1980, Sequiera 1980), all of which fluctuate in their abundance, and thus in their availability to foxes. It must be vitally important for foxes to meet the temporal shortages in their major prey. Provisions are generally available year round wherever human activity occurs. Furthermore, in Shiretoko NP, many outdoor recreationists visit natural areas inhabited by foxes and make provisions available to foxes. Provisions seem, therefore, less preferable than natural foods, but provide an alternative when natural foods are in short supply. It is likely that foxes inhabiting a natural area such as Shiretoko NP may begin to beg for provisions simply because they are offered them by the numerous visitors. Provisions may also be a critical food in terms of increas- ing the carrying capacity of the area normally regulated by natural food availability. Acknowledgments : We are very grateful to: M. Yamanaka for supporting our work from start to finish and for encouraging us ; M. Matsuda for providing his data on birds, and for helping to trap insects; H. Okada, K. Watanabe and M. Ohnuma for helping to capture foxes ; the staff and students of the Laboratory of Parasitology, Hokkaido University, for collecting scats; and M. Asakawa, 150 Mammal Study 21: 1996 H. Abe, and T. Shida for advice on capturing rodents and for permission to use their traps. We also thank Y. Ueno, K. Uraguchi, T. Ikeda, and anonymous referees for reading our draft manuscript and for their many useful comments. S. Kaneko, and M. Brazil kindly improved the English of the final manuscript. This study was partly funded by the Sasakawa Scientific Research Grant from The Japan Science Society, and by Shari Town, Hokkaido. REFERENCES Abe, H. 1975. Winter food of the red fox, Vulpes vulpes schrencki Kishida (Carnivora: Canidae), in Hokkaido, with special reference to vole populations. Appl. Ent. Zool. 20:40—51. Ables, E. D. 1975. Ecology of the red fox in North America. Jn (M. W. Fox ed.) The Wild Canids: Their Systematics, Behavioral Ecology and Evolution. pp. 216—236. Calisti, M., B. Ciampalini, S. Lovari and M. Lucherini. 1990. Food habits and trophic niche variation of the red fox Vulpes vulpes (L., 1758) in a Mediterranean coastal area. Rev. Ecol. 45: 309— 320. Doncaster, C. P., C. R. Dickman and D. W. Macdonald. 1990. Feeding ecology of red foxes ( Vulpes vulpes) in the city of Oxford, England. J. Mamm. 71: 188—194. Englund, J. 1965. Studies on food ecology of the red fox (Vulpes vulpes) in Sweden. Viltrevy 3: SO — ABs Englund, J. 1969. The diet of fox cubs (Vulpes vulpes) in Sweden. Viltrevy 6:1—39. Goszczynki, J. 1974. Studies on the food of foxes. Acta Theriol. 19:1—18. Goszczyniki, J. 1986. Diet of foxes and martens in Central Poland. Acta Theriol. 31: 491—506. Harris, H. 1978. Age determination in the red fox (Vulpes vulpes) - an evaluation of technique efficiency as applied to a sample of suburban foxes. J. Zool., Lond. 184 :91—117. Jedrzejewski, W. and B. Jedrzejewski. 1992. Foraging and diet of the red fox Vulpes vulpes in relation to variable food resources in Bialowieza National Park, Poland. Ecography 15: DA D— LA. Kondo, N., K. Takahashi and K. Yagi. 1986. Winter food of the red fox, Vulpes vulpes schrencki Kishida, in the endemic area of multilocular echinococcosis. The memoirs of the Preparative Office of Nemuro Municipal Museum 1: 23—31 (in Japanese with English abstract). Kruuk, H. 1989. The Social Badger: Ecology and Behaviour of a Group-Living Carnivore (Meles meles). Oxford University Press, Oxford, 155 pp. Lloyd, H.G. 1980. The Red Fox. B. T. Batsford Ltd, 320 pp. Lucherini, M. and G. Crema. 1994. Seasonal variation in diet and trophic niche of the red fox in an Alpine habitat. Z. Sdeugetierkunde 59:1—8. Macdonald, D. W. 1977. On food preference in the red fox. Mammal. Rev. 7:7—23. Macdonald, D. W. 1987. Running with the Fox. Unwin Hyman, London and Sydney, 224 pp. Misawa, E. 1979. Change in the food habits of the red fox, Vulpes vulpes schrencki Kishida, according to habitat conditions. J. Mammal. Soc. Jap. 7: 311—320 (in Japanese with English abstract). Nakagawa, H. 1985. Birds of Shiretoko. Shiretoko Museum, Shari, 24 pp. (in Japanese). Nakazono, T. 1994. A study on the social system and habitat utilization of the Japanese red fox, Vulpes vulpes japonica. Ph. D. thesis, Kyushu Univ., 73 pp. Sargeant, A.B., S.H. Allen and R. T. Eberhardt. 1984. Red fox predation on breeding ducks in mid-continent North America. Wildl. Monog. 89:1—41. Sequiera, D. M. 1980. Comparison of the diet of the red fox (Vulpes vulpes L., 1758) in Gelderland (Holland), Denmark and Finnish Lapland. Biogeographica 18: 35—51. Tsukada, H. 1994. A study of the ecology of foxes in Shiretoko National Park and their utilization for nature education programs. Bull. Shiretoko. Mus. 15:63—82 (in Japanese with English abstract). Watanabe, K. 1996. A study on the coexistence of the red fox in Hokkaido with humans. Ms thesis, Tsukada and Nonaka, Human food utilization by red fox 51 Faculty of Letters, Hokkaido Univ., 128 pp. (in Japanese). Watanabe, K. and H. Tsukada. 1996. A survey on the history of provisioned foxes and on attitudes of travel agents to the provisioned foxes in Shiretoko National Park. Bull. Shiretoko Mus. 16: 11—24 (in Japanese). Yabe, T. 1995. A fundamental study on habitat management for wildlife : habitat use of Sika deer and a change in the vegetation on Shiretoko Peninsula, Hokkaido. Research Bulletin of the Hokkaido University forests 52:115—175 (in Japanese with English abstract). Yoneda, M. 1982. Influence of red fox predation upon a local population of small rodents II. food habit of the red fox. Appl. Ent. Zool. 17: 308—318. Yoneda, M. 1983. Influence of red fox predation upon a local population of small rodents III. Seasonal changes in predation pressure, prey preference and predation effect. Appl. Ent. Zool. 1} 2 LL=I0, (accepted 22 January 1997) =: iss “pee 2S. ee 1 4 5 z i i i (ee ret ‘ ae Se x f ‘7 > a) he vk 3 "A Mammal Study 21: 153-159(1996) © the Mammalogical Society of Japan Short Communication Conception dates of Sika deer on the Boso Peninsula, central Japan Masahiko ASADA and Keiji OCHIAI’ Laboratory of Forest Zoology, Faculty of Agriculture, University of Tokyo, Yayoi 1-1-1, Bunkyo-ku, Tokyo 113, Japan ‘Natural History Museum and Institute, Chiba, Aoba-cho, Chuou-ku, Chiba 260, Japan Fax. 03-5800-6895, e-mail. QZE16660 @ niftyserve. or. jp The seasonal characteristics of mammalian reproduction are partly related to the seasonal dietary conditions of the species concerned (Lincoln 1985, Sadleir 1987, Bronson 1989). Birth and lactation of herbivores typically occur in spring in conjunction with the peak in available vegetation (Bronson 1989). Since this seasonal pattern of food availability varies with latitude, breeding seasons also vary with latitude in, for example, mountain sheep (Bunnell 1982), reindeer (Leader-Williams 1988) and deer of the genus Odocoileus (Bronson 1989). The range of the Sika deer (Cervus nippon Temminck) extends along the Asian coastline of the Pacific Ocean from virtually the sub-tropical (14°N) to the sub-arctic regions (50°N) (Ohtaishi 1986, Whitehead 1993). As a conse- quence, the breeding season of this species is expected to differ at the different latitudes of the great length of its range. So far, however, details of the breeding season of Sika deer have only been reported from Hokkaido (43.5°N, Suzuki et al. 1996), Hyogo Prefecture (35°N, Koizumi 1991), and Nara Park (34.4°N, Miura 1984), and more wide-ranging researches are required to eluci- date the situation more fully. Here we report an examination of the concep- tion dates of Sika deer on the Boso Peninsula in central Japan (35°N). STUDY AREAS The study area, of 124 km’, ranges in elevation from sea-level to 300m above sea level, consists of steep slopes, and is located in Chiba Prefecture, central Japan (35'N, 140°E, Fig.1). The annual precipitation in the area is 2,000-2,400 mm, and the mean monthly temperature is about 4°C in mid-winter and 25°C in mid-summer (University of Tokyo 1988). The predominant vegeta- tion of the area consists of evergreen broad-leaved forest, primarily Machilus thunbergit and Castanopsis sieboldii, natural coniferous forest consisting of Abies firma and Tsuga sieboldii, and plantations of two species of conifers, Cryptomeria japonica and Chamaecyparis obtusa. In order to detect intra-population differences, the study area was divided 154 Mammal Study 21: 1996 The Boso peninsula The distribution of sika deer The Pacific on the Boso peninsula O Fig.1 Study area. into five sub-areas according to deer density (Fig. 1): the high density AT area where there were 22.4-37.9 deer/km?, and the lower density KG, KU, OT and KT areas where there were: 14.7, 0.9, 1.1-5.7, and 6.7-8.4 deer/km?, respectively (Chiba Prefecture and Deer Research Group on Boso 1993). MATERIALS AND METHODS Female Sika deer on the Boso Peninsula are regularly culled, as a means of pest control. From such specimens we collected 180 fetuses in January and February 1993, February and March 1994, and February and March 1995. The ages of pregnant deer were determined by tooth replacement and by counting the cementum layers of the first incisors (Ohtaishi 1980). The crown-rump length (CRL) of each fetus was measured to the nearest millimeter and the gestational age was estimated from the linear regression formula proposed by Koizumi (1991): Y =50.23+0.42X where X equals CRL (mm) and Y equals gestational age (days). This equation is based on a mean gestation period of 234 days and a body length at parturition of 440 mm as found for the deer population of the Tanzawa Mountains, central Japan (limura 1980). On the Boso Peninsula, the mean gestation period was found by Nakajima (1929) to be 235 days. The mean shoulder height + SD of Asada and Ochiai, Conception dates of Sika deer on Boso 155 adult females in the Tanzawa Mountains was 77.8 = 6.7cm (limura 1980) whereas on the Boso Peninsula it was 74.0 = 3.8cm (Ochiai and Asada 1995). Since the differences between these two populations were not large, we adopted Koizumi’s (1991) model for the Boso Peninsula. The date of conception was estimated from the collection date and the gestational age. RESULTS AND DISCUSSION Sika deer conceived between 8 September and 11 December, with a median date of 23-24 September, in all sub-areas of our Boso Peninsula study area. The crown-rump lengths of fetuses collected from the area ranged from 28 to 318mm. In comparing the conception period on the Boso Peninsula with that of other populations (Fig. 2), it was found to be one month earlier than in Hokkaido, which is 10 degrees of latitude north of the Boso Peninsula (Suzuki et al. 1996), and was about 10 days earlier than in Hyogo Prefecture (35°N, Koizumi 1991). The breeding season is later at more northerly latitudes in mountain sheep (Bunnell 1982) and in reindeer (Leader-Williams 1988), because it is related to phenological differences in dietary vegetation (Bunnell 1982). In reindeer populations, calving occurs one month earlier per 10 degrees higher latitude (Leader-Williams 1988), a relationship which is supported by our own study of Sika deer. The leaves of deciduous trees on the Boso Peninsula, common 50 45 Hokkaido aN (gy ee 40 Hyogo [TUS 35 SS Degree of northern latitude 1S€9, WOeo Now Waxed dein. 21 Jem Conception periods Fig.2 Conception periods of Sika deer in Hokkaido, Hyogo and Boso. Bars show periods, and open circle, rectangle and solid circle indicates peaks of conceptions in Hokkaido, Hyogo and Boso, respectively. Data for Hokkaido and Hyogo are from Suzuki ef al. (1996) and Koizumi (1991), respectively. 156 Mammal Study 21: 1996 browse of the deer, begin to develop from early April to early May whereas in Hokkaido they develop from early May to mid May (Watanabe 1978, Sasaki 1983). On the Boso Peninsula, local differences in the frequency distribution of conception were recognized from late October onwards (Fig. 3). During this period, pregnancy ratios were 16.7% in the KG, 19.2% in the KU, and 26.5% in the OT sub-areas, though only two deer (3.2%) were pregnant in sub-area AT, where deer density was high, and in sub-area KT, this tendency was not clear because of the small sample size. In Nara Park, tame Sika deer at a high population density (276 / km?) 30 AT area N=62 20 MH 1995 1994 10 LJ] 1993 KG area N=48 10 No. of conception 10 OT area KT area N=10 Early Mid. Late Early Mid. Late Early Mid. Late Early Mid. Sep. Oct. Nov. Dec. Conception date Fig.3 Estimated distribution of conception date of Sika deer on the Boso Peninsula, central Japan. Samples were collected in January and February 1993, and February and March 1994 and 1995. Asada and Ochiai, Conception dates of Sika deer on Boso 7 conceived synchronously (Miura 1984). Koizumi (1991) thought that such synchrony of conception was a consequence of gregariousness, a factor which also appears to be born out by our own observations from the Boso Peninsula. Among Cervid deer, it is known that the conception rate, in any particular age class, is related to body weight during the rutting season. Thus, only deer above a specific body weight threshold can conceive (Mueller and Sadleir 1979, Hamilton and Blaxter 1980, Verme and Ullrey 1984, Sadleir 1987, Langbein and Putman 1992). Young deer conceive later than older deer, because they achieve this weight threshold later (Smith 1974, Hamilton and Blaxter 1980, Suzuki et al. 1996). To examine the relationship between the age of pregnant females and conception date, maternal age classes and conception periods were compared (see Table 1). Although four-year-old and older deer tended to conceive earlier than did younger deer, no significant difference was detected (y?-test ; >0.05), 2. e. the conception period appeared to be independent of maternal age on the Boso Peninsula. In Hokkaido, during the second half of the conception period, only 4% of two-years-old or older females were pregnant (Suzuki et al. 1996), whereas on the Boso Peninsula 13% of such young females from all five sub-areas, and 18% from four sub-areas, excluding the high density AT sub-area, were pregnant. Thus, it appears that conception among the two-year-old and older females is less synchronized on the Boso Peninsula than it is in Hokkaido. Since deer densities on the Boso Peninsula (with the exception of sub-area AT) and in Hokkaido were similar, at 5.0 + 4.9 (mean SD/km? n=10, Chiba Prefecture and Deer Research Group on Boso 1993) and 4.6 + 4.9 (n=21, Hokkaido Institute of Environmental Sciences 1995), respec- tively, it is considered that this regional difference in conception synchrony was not due to differences of density. We believe that this difference results from variation in the phenology of food plants used by the deer in different regions. It has been considered that the optimum periods for conception and parturition are affected by the periods of peak growth of the available vegetation (Bronson 1989). Bunnell (1982) showed that mountain sheep at more northerly latitudes began lambing later and lambed over a shorter duration than did sheep at more southerly latitudes, and that the timing of lambing was determined primarily by forage quality and quantity. As mentioned above, spring leaf growth occurs approximately one month earlier on the Boso Peninsula than in Hokkaido. In Hokkaido, deciduous trees change color in autumn from late September onwards (Sasaki 1983), whereas they do so from mid-October onwards on the Boso Peninsula (Watanabe 1978). Furthermore, the first snows of winter occur from November onwards in Hokkaido, whereas little snow falls at all on the Boso Peninsula. Sika deer on the Boso Peninsula can continue to eat evergreen leaves from fall to winter (Asada and Ochiai 1996). Therefore, the duration of the optimum period for parturition seems to be longer, and synchrony seems to be weaker on the Boso Peninsula than in Hokkaido. 158 Mammal Study 21: 1996 REFERENCES Asada, M. and K. Ochiai. 1996. Food habits of sika deer on the Boso Peninsula, central Japan. Ecol. Res. 11 : 89—95. Bronson, F. H. 1989. Mammalian Reproductive Biology. Univ. of Chicago Press, Chicago, 325 pp. Bunnell, F. L. 1982. The lambing period of mountain sheep: synthesis, hypotheses and tests. Can. le Zoolno0 alae Chiba Prefecture and Deer Research Group on Boso. 1993. Science Report on the Management of Sika Deer on Boso Peninsula, Chiba Prefecture, 1., Chiba, 48 pp. (in Japanese) Hamilton, W.J. and K.L. Blaxter. 1980. Reproduction in farmed red deer. 1. Hinds and stag anlar, Ie Acne, Sen, Cara), $5 2 ZOl—= F733. Hokkaido Institute of Environmental Sciences. 1995. Reports on the Status of Brown Bear and Sika Deer in Hokkaido. Hokkaido Government, Sapporo, pp. 164 (in Japanese) limura, T. 1980. An ecological study on the Japanese deer, Cervus nippon cetralis, in the Tanzawa mountains from the view point of forest protection. Dainippon-sanrinkai, Tokyo, 154 pp. (in Japanese with English summary) Koizumi, T. 1991. Reproductive characteristics of female Sika deer, Cervus nippon, in Hyogo Prefecture, Japan. Ongules/Ungulates 91 : 561—563. Langbein, J. and R. Putman. 1992. Reproductive success of female fallow deer in relation to age and condition. Jv (R.D. Brown, ed.) The Biology of Deer. pp. 293—299. Springer-Verlag, New Wonks Leader-Williams, N. 1988. Reindeer on South Georgia. Cambridge Univ. Press, New York, 319 pp. Lincoln, G. A. 1985. Seasonal breeding in deer. Jn (P. F. Fennessy and K. R. Drew ,eds.) Biology of Deer Production. Roy. Soc. New Zeal., Bull. 22: 165—179. Miura, S. 1984. Annual cycles of coat changes, antler regrowth, and reproductive behavior of sika deer in Nara Park, Japan. J. Mamm. Soc. Japan 10:1—7. Mueller, C.C. and R.M.F.S. Sadleir. 1979. Age at first conception in black-tailed deer, Biol. Reprod.21 : 1099-1104. Nakajima, M. 1929. Experimental report of penned sika deer at the University Forest, Chiba. Misc. Inform. Tokyo Univ. For. 8: 95—114. (in Japanese) Ochiai, K. and M. Asada. 1995. Growth in the body size of sika deer (Cervus nippon) on the Boso peninsula, central Japan. J. Nat. Hist. Mus. Inst., Chiba 3 : 223—232. (in Japanese with English summary) Ohtaishi, N. 1980. Determination of sex, age and death-season of recovered remains of Sika deer by jaw and tooth-cement. Koukogaku To Sizenkagaku 13:51—74. (in Japanese) Ohtaishi, N. 1986. Preliminary memorandum of classification, distribution and geographic variation on Sika deer. Honyurui Kagaku [Mammalian Science] , 53:13—17. (in Japanese) Sasaki, C. 1983. Phenology of woody plants and temperatures in central Hokkaido. Review of Forest Culture 4:77—86. (in Japanese) Sadleir, R. M.F.S. 1987. Reproduction of female cervids. Jn (C.M.Wemmer, ed.) Biology and Management of the Cervidae. pp. 123—144. Smithsonian Inst. Press, Washington, D. C. Smith, M.C. T. 1974. Biology and management of the Wapiti (Cervus elaphus nel/sont) of Fiordland, New Zealand. Wellington, New Zealand: New Zealand Deer Stalkers Association. Suzuki, M., K. Kaji, M. Yamanaka and N. Ohtaishi 1996. Gestational age determination, variation of conception date, and external fetal development of sika deer (Cervus nippon yesoensis Heude, 1884) in Eastern Hokkaido. J. Vet. Med. Sci. 58: 505—509. University of Tokyo. 1988. An Outline of the University Forest in Chiba 1988 , Chiba, 44 pp. (in Japanese) Verme, L. J. and D.E. Ullrey. 1984. Physiology and nutrition. Jn (L.K. Halls, ed.) White-tailed Deer Ecology and Management. pp. 91—118. Stackpole Books. Watanabe, R. 1978. Seasonal division based on the phenological records in two different climatical Asada and Ochiai, Conception dates of Sika deer on Boso 159 regions of Japan. Bull. Inst. Nature Educ. Shiga Heights, Shinshu Univ. 17 : 19—32. Whitehead, G. K. 1993. Encyclopedia of Deer. Swan Hill Press, Shrewsbury, 597 pp. (accepted 7 January 1997) a ie a a] #2 ' ‘i ; ‘ A ee i , = 4 - A i j 4 oY = 7 * = ; E : j Sign = ; 3 an Fe 4 * r t J ‘irs spe oS “ ; 4! = Y = v > i 2 z Sn BBY LS Magli 7 + = Tso ‘ Law ‘ = e < = ies a 4 “yet 7 >i 3 = js t re = We oe) on ae _ : as reesei 5 Ltn ; : 5 z Tes ¥ 4 (ae ae af : i ee = - : rer ; t q i pe 1 La 7 q a q = >, . Sir ok oe ~ 1 3 E 4 aes ; Ss o , t i } i ( J sof : { F ; ee as : ; : s = f € hoe iy a a4 = Som ne = a es = m3 - Nie Z = es ¥ = i “a ey - : le z 2 DP sna z - ice ‘ A a =) y = i) ~ oj i S \ & { + - F ‘ 2 om 8 5 ~ ‘ 2 ) 2 ee = yi ; : or aoe : - a? : ‘ =. ces a ee oa = Z —_ y - 1 —) = ‘ < Fi ! Peo y - } ‘ fe ‘ * ¢ othe ‘ a. 4 Ya ”) tz Fi aay 2 \ 2 ~ ' Z c p) = = a 2 ai 5 Ae = Bi ~ t 7 = y ~ < Ps ? a—)\ Z Jt - 3 S es + ; }. —— ~ 5 } / > A yi ¥ he Ho = + 3 - = n 1 - = ; rae , oa a ee i 4 = * pone ; ; = { os “ a) hes . = = = E Fis) 1 - Need) x > ~ 5 ~ we Sot x o ae J he y a = 3 ol ‘ i y : 4 ig és , ? ai a / = 5 ‘ Dive < 7 Mammal Study”. We hope and trust that Dr Abe and Dr Shiraishi, though retiring from their university positions, will, however, continue in encouraging and guiding the work of younger generations of scientists for many more years to come. REFERENCES Abe, H. 1967. Classification and biology of Japanese Insectivora (Mammalia) I. Studies on variaion and classification. J. Fac. Agr. Hokkaido Univ. 55: 191—265. Abe, H. 1968. Classification and biology of Japanese Insectivora (Mammalia) II. Biological aspects. J. Fac. Agr. Hokkaido Univ. 55 : 429—458. Abe, H. 1982. Ecological distribution and faunal structure of small mammals in central Nepal. Mammalia 46 : 477—503. Abe, H. 1996. Habitat factors affecting the geographic size variation in Japanese moles. Mammal Swuchy Zils V1=87. 4 Abe, H.N. Ishii, Y. Kaneko, K. Maeda, S. Miura, M. Yoneda. 1994. A Pictorial Guide to the Mam- mals of Japan. Tokai Univ. Press. (in Japanese) Abe, H., S. Shiraishi and S. Arai. 1991. A new mole from Uotsuri-jima, the Ryukyu Islands. J. Mammal. Soc. Japan 15: 47—50. Ando, M., S. Shiraishi and T. A. Uchida. 1985. Feeding behaviour of three species of squirrels. Behaviour 95: 76—86. Ando, A., S. Shiraishi and T. A. Uchida. 1990. Reexamination on the taxonomic position of two intra-specific taxa in Japanese EKothenomys : Evidence from cross breeding experiments (Mam- ooubiey S Inoelemtine), “Zool, Sen, 72 14145; Hasegawa, H., S. Shiraishi and Rochman. 1992. Tikusnema javaense n, gen., n. sp. (Nematoda: Acuarioidea) and other nematodes from Rattus argentiventer collected in West Java, Indonesia. J. Parasit. 78 : 800—804. Kakuda, H., T. Mori and S. Shiraishi. 1992. Functional morphology of Gene’s organ in Haema- physalis longicornis (Acari: Ixodidae). Exp. Appl. Acar. 16 :63—275. Koga, K.and S. Shiraishi. 1994. Parent-offspring relations during the post-fledging dependency period in the Black Kite (Milvus migrans) in Japan. J. Raptor Res. 28: 171—177. Lin, L. -K., T. Nishino and S. Shiraishi. 1993. Postnatal growth and development of the Formosan wood mouse Apodemus semotus. J. Mammal. Soc. Japan 18:1—18. Min, B. Y., K. Honda, R. Tatsukawa and S. Shiraishi. 1984. Biometry of growth and food habits of young of the Eastern great white egret, Egretta alba modesta, in Korea. J. Fac. Agr. Kyushu Universo) 235-33. Ohdachi, S., R. Masuda, H. Abe, J. Adachi, N.E.Dokuchaev, V. Hasegawa, H., S. Shiraishi and Rochman. 1992. Tikusnema javaense n, gen., n. sp. (Nematoda: Acuarioidea) and other nematodes from Rattus argentiventer collected in West Java, Indonesia. J. Parasit. 78 : 800— 804. Okura, N., S. Shiraishi and T. A. Uchida. 1984. Karyotypes of the Japanese harvest mouse (M- cromys minutus japonicus) from Fukuoka and Tsushima Islands. J. Fac. Agr. Kyushu Univ. U2 MW Moss Yamada, F., S. Shiraishi, A., Taniguchi and T. A. Uchida. 1990. Growth, development and age determination of the Japanese hare, Lepus brachyurus brachyurus. J. Mammal. Soc. Japan 14: = Ws Yoshinaga, Y.and S. Shiraishi. 1997. Growth, development, and reproductive patterns in the Japanese field vole, Microtus montebelli. J. Mammal. 78 : 830—838. Seiki TAKATSUKI (Editor-in-chief), Takashi SAITOH and Takanori MORI Mammal Study 22: 5-10 (1997) © the Mammalogical Society of Japan Cross-species amplification of microsatellite DNA in Old World microtine rodents with PCR primers for the gray-sided vole, Clethrionomys rufocanus Yasuyuki ISHIBASHI’, Takashi SAITOH’, Syuiti ABE?’, and Michihiro C. YOSHIDA’ 1 Chromosome Research Unit, Faculty of Science, Hokkaido University, North 10, West 8, Kita-ku, Sapporo O60, Japan Fax. +81-11-736-6304, e-mail. stone @ees. hokudai. ac. jp 2 Wildlife Management Laboratory, Hokkaido Research Center, Forestry and Forest Products Research Institute, Hitsujigaoka 7, Toyohira-ku, Sapporo O62, Japan 3 Laboratory of Cytogenetics, Graduate School of Environmental Earth Science, Hokkaido University, North 10, West 5, Kita-ku, Sapporo O60, Japan Abstract. Applicability of seven primer sets, originally designed for polymerase-chain-reaction (PCR) amplification of microsatel- lite DNA in the gray-sided vole, Clethrionomys rufocanus, was examined in other 12 microtine species from three genera (Cleth- rionomys, Eothenomys and Microtus). Of the primer sets used, one distinctly amplified PCR products in all the species examined. Three sets gave PCR products in all but one species. The remain- ing three sets failed to amplify any products in several species. Non-amplification occurred mostly in Microtus species, although two primer sets were not available for two Clethrionomys species. Since most amplified loci showed allelic variations, the present primers are useful for molecular ecological studies of related microtines, especially Clethrionomys and Eothenomys species. Key words. Clethrionomys, Eothenomys, microsatellites, Microtus, PCR primer. Microsatellite loci, which consist of tandem repeats of short DNA sequence motif ($5 base-pairs), are highly variable in repeat number, thereby providing an excellent molecular marker for both ecological and population genetic studies (Burke et al. 1992, Queller et al. 1993). Genotyping at microsatellite loci facilitates assessment of paternity (Morin et al. 1994b, Sillero-Zubiri et al. 1996) or relatedness (McDonald and Potts 1994, Blouin ef al. 1996, Ishibashi et al. 1997), and also allows to summarize the genetic structure within or among populations (Morin ef al. 1994a, Paetkau et al. 1995, Lade et al. 1996). Microsatellites can be amplified from a minute amount of DNA using the polymerase chain reaction (PCR) technique (Litt and Luty 1989, Tautz 1989, Weber and May 1989). Hair roots (Washio 1992, Morin et al. 1994a), bones (Taberlet and Fumagalli 1996) or feces (Tikel et al. 1996) can all be used as sources of DNA, if necessary. PCR-based analysis has a great advantage over conventional allozyme analysis, because of the high resolution and because 6 Mammal Study 22: 1997 sample collection is none, or less, invasive. Microsatelites are thought to be localized in rapidly evolving non-coding regions, and hence cross amplification is generally restricted to closely related species (Schlétterer et al. 1991, Coltman et al. 1996, Kayser et al. 1996, Valsec- chi and Amos 1996). In this study, a cross-species microsatellite amplification was conducted in 12 species of Old World microtine rodents. Seven primer sets originally designed for the gray-sided vole, Clethrionomys rufocanus, in Hok- kaido, Japan, were used. So far microsatellite loci have not been cloned in other microtines, thus cross amplification could justify the applicability of these microsatellite primers in the species examined. MATERIALS AND METHODS Seven microsatellite primer sets, designed for Clethrionomys rufocanus in Japan, were used in this study (Table 1). They consisted of primer sets for five loci previously cloned, MSCRBs-1 to -5 (Ishibashi et al. 1995), and two further loci, MSCRBs-6 and 7, newly cloned from the C. rufocanus genomic library and sequenced as described by Ishibashi et al. (1995). One of the paired primers was newly designed for two loci, MSCRBs-2 and -5, so as to shorten the size of PCR product. For MSCRB-3, one of the paired primers was also redesigned so as to avoid non-amplification which is caused by base substitutions near the CA- and GA-repeats (Ishibashi ef al. 1996). Cross-species amplification was performed using one to six individuals from each of 12 species from the three genera, Clethrionomys, Eothenomys and Microtus (Table 2). Three Cleth- rionomys species captured in three widely different localities, Japan, Finland Table 1. Microsatellite primer sets used in this study, including those for the previously described loci, MSCRBs-1 to 5 (Ishibashi et a/. 1995) and newly cloned loci, MSCRBs-6 and -7. Locus Repeat structure? Primers (5’-3’) TA° Product size‘ MSCRB-1 (AC)po4 AGTGTTTGGAAGCCATGCGGTA 58 150-270 CAGGAGCTTCATGGCTGGAATA MSCRB-2 (AC),; with several AAGGGTGAGTATGCCAATCA 48 100-200 short AC-repeats TCTCAGATTCTGTGATATGCTGTC! MSCRB-3 (CA),9(GA)o, CATGACCTTCTATTTCTGTCAG 48 250-350 CTCTAGCATGATGTTACTGT? MSCRB-4 (CA)ao GTGCTGCTTACTGGCTTCTTGT 60 70-130 CCTGAGTTGTATAAGAAAGCAGGC MSCRB-5 a mixture of CA-, ATAC- GGTTGGTGTTTGCATTTAGG 54 130-230 and ATGT-repeats CGTCTGGGTTTTACATCTGA? MSCRB-6 = (AC),.(AG),5 TATAATAGATTTGAGTATCTGC 52 150-220 GATGTCCATCAAGTTAATCGT MSCRB-7 (AC)ao GTTTTATGTTAGTCTCATCTG 52 80-150 AGGCAATCCTGGTGAGTAACA 4Nucleotide sequence of the clones obtained from the Japanese C. rufocanus genomic DNA library, "Annealing temperature in PCR (°C), “Estimated PCR product size for all the species examined in this study (in base-pairs), “The primer sequence differed from that previously described by Ishibashi et al. (1995). Ishibashi et al. Cross-species amplification of microsatellite DNA in microtines -A10}e10qe'T, ‘([feJap 1OFJ 1X9} JIS) S[TENPIAIPUI BUIOS UI UOT} eoTfI[duIe-uON, ‘orydsourAjod : + ‘orydsowououl ‘speumlue poiq >— ‘0I—-V | ‘e1nj}e10dule} Suljyeouue JOMO] 7 poljijdwue : 7 (7 s[qe L 9es) VL “einjzesoduie} suljeouue 1sysiy je porjijdure : Fy ‘(4vowis 10 jOnpo.id ou) poryijdure jou :(¢ ‘ suoNelAsiqgy, ‘pozA[eue STENPIAIpUl JO JaequUINN, ‘S19y}0 [[B 1OJ (T1661) [[}H Pue Joqiog pue soloeds ssouedef 10J (PG6I) “7M 72 VQY MOT[OJ soureuU sordeds, a / Jl +/H 0 = fle +/H = / i ar / JE +/H sig dl ae//Je +/H 0 0 0 0 0 +/H sey Jal az / lal LAYMOSIN 9AYXOSIN SAYOSIN FAYNOSIN € ANOS @AYNOSW T-aeOSIN ar (Jel = (Tel s/s +/H +/H = (Jal axial +/H +/H +/H +/H ae ul +/H al Jel / Jl = Jab 4-/ Jal a/ 18 aP/ Jel atoy/alell e/a ae //15l +/H +/H +/H = Tel yall sora p—/H p= IE st e/a = 4 “//18 a" Jel 0 +/H =) al apy tel +/H a / Fel ay / tel sip el +/H = / Jel ai / Tel +/H ate / sted aig? Jel +/H 0 0 cial 17/4 Pf Jel —// 18 8 sig bel se// 1 a // tel a Jel +/H ary lel shoo] +/H 0 af 1 +/H “P// lal +/H ap / 18 +/H +/H +/H e/a a/b gor Ale a ala sl sP/ Jal +/H gael aA 0 = sl = +/H =A = 1 0 an a 0 sF/ ate tal ay tal J BSD EO oe Mes) Mee) se) Mis SNe SMO) SO) Ne) 6 Me) Oo ool) Seal GN ral sn Ke) aN sAPMION SSIMS URAL | UeMIE TL SPUPR[IOUION IL wedEif ealoy uede( (Us Iry) uedef (nyoyo ,,) uedef uede[ sAP MIO N Pue ier ,uede[ sAPM1O NI Por eel sAPMION PU er uedef uol}e007T SNULOU0IAO “WV Sypaiu AAJSDGOUDIAUL “J CUGIIES SLIM SYDAAD “JW YJaqaquou “py SUINGOA “FT MORES. Gi 1UOSAAPUD “A XOL “D) SNUYNA “Dd SNJOOAD]S “DI SNUDIOJNA “DJ psd100dS SNJOLIU SAMOUaYIOT SKULOUOILYIA]) snudsy ‘SIOUILId 9}I[[O}BSOIDIUL SNUDIO{NA “J JO SATed UBAVS YIM UOTVeOTFI[duIe SaIdedS-SssO1D °Z VIGe 8 Mammal Study 22: 1997 and Norway, were also examined for a possible variation in the applicability of these microsatellite primers (Table 2). DNA was isolated from each animal using the conventional phenol/chloroform method (Sambrook ef al. 1989). The PCR amplification was carried out in 10 wl of reaction mixture containing 50 mM of KCl, 1.5mM of MgCl,, 10 mM of Tris-HCl (pH 8.3), 0.2 mM of dNTP, 0.25 uM of each primer, and 0.25 unit of Tag DNA polymerase (TaKaRa). About 30 ng of genomic DNA was used for each reaction. After denaturation at 93°C for two minutes, the reaction was carried out for 30 cycles under the following conditions using a DNA Thermal Cycler PJ2000 (Perkin Elmer Cetus) ; 93°C for 30 sec, TA°C (see Table 1) for 20 sec, and 72°C for 20 sec. TA of each primer was optimized to amplify apparent PCR products in Japanese C. rufocanus after calculating with the formula: 69.3+0.41 x (% of GC content) —650/(primer length) (Mazars eft al. 1991). When amplification failed in species other than Japanese C. rufocanus, lower annealing temperature by 10°C, z.e., TA—10, was adopted so as to allow for mismatches in the primer sequence in the subsequent trials. The PCR products were electrophoresed in a 3% agarose gel and an 8% non-denatured polyacrylamide gel in order to examine the results of amplifica- tion and allelic variation. When amplification in a species did not result in any products, or showed only a smearing pattern, under the above PCR conditions, the result was categorized as “not amplified”. If all individuals examined showed a single band only, such a species was categorized as “monomorphic”. If two bands of similar size and amount were apparent in one or more individ- uals, then the species was categorized as “polymorphic”. RESULTS AND DISCUSSION Of seven microsatellite primer sets used, one provided apparent PCR products in all twelve species examined (MSCRB-5, Table 2). Three sets (MSCRBs-2, -4 and -6) gave products in all but one species. The remaining sets (MSCRBs-1, 3 and 7) failed to amplify any products in several species (See Table 2). When amplification was performed with the primer set for MSCRB- 3 under the lower annealing temperature, ladder-like band patterns were observed from low to high molecular weight regions. Despite the many spuri- ous bands, we categorized them as “amplified” if the ladder included an apparent band(s) of the molecular size similar to other microtines’ products. Non-amplification occurred mostly in Microtus, although no apparent product was amplified with the MSCRBs-1 and -7 primers in either C. rutilus or C. glareolus. In all Eothenomys species, products were obtained from all seven primer sets under higher or lower annealing temperature (Table 2). Non-amplification of microsatellite loci may occur as a result of nucleotide sequence variation (e.g., base substitution, deletion and/or addition) within the priming site for PCR amplification. Therefore, the observed non- amplifications could be due to variation within the priming sequences. Furthermore, in the present study, no PCR products were observed in five of ten Ishibashi et al. Cross-species amplification of microsatellite DNA in microtines 9 Scandinavian C. rufocanus at MSCRB-5 (Table 2). Since allelic variation at the locus is very small in Japanese C. vufocanus (Ishibashi et al. 1995), these five individuals may be homozygous for a non-amplifying (null) allele with sequence variations in the priming site. Although such null alleles were not detected in microtines oher than the Scandinavian C. vufocanus, it is clearly important to pay attention to the possible presence of null alleles especially when using heterologous microsatellite primers (Paetkau and Strobeck 1995, Pemberton et al. 1995). Despite the allelic variation in most amplified loci in each species, interpre- tation must be made with some caution. In the present study, “polymorphic” and “monomorphic” species are arbitrarily defined on the basis of the number of alleles (bands) in the limited number of DNA samples examined (Table 2). For C. rufocanus, C. glareolus, C. rutilus and M. oeconomus from Norway, and C. rutilus from Japan, the DNA samples used were extracted from laboratory- bred individuals (Table 2). These animals might have lost heterozygosities at some loci by chance during laboratory breeding. “The observed monomorphic band patterns at several loci may not, therefore, indicate the real situation in natural populations. The present study, though preliminary in nature, demonstrates that most PCR primer sets for C. vufocanus microsatellites are useful for detecting allelic variations in related microtines, especially in Clethrionomys and Eothenomys species. Given the small sample size and the non-systematic collection, further examinations are required to clarify the presence of null alleles and of allelic variation in each population or species of interest. Acknowledgments : We are grateful to Dr. H. Suzuki for generously providing DNA and Drs. N.C. Stenseth, H. Henntonen and K. Takahashi for kindly pro- viding tissue samples. Particular thanks go to Professor Hisashi Abe for critically reviewing the manuscript. REFERENCES Abe, H., N. Ishii, Y. Kaneko, K. Maeda, S. Miura and M. Yoneda. 1994. A Pictorial Guide to the Mammals of Japan. Tokai University Press, Tokyo, pp. 195 (in Japanese). Blouin, M.S., M. Parsons, V. Lacaille and S. Lotz. 1996. Use of microsatellite loci to classify individ- uals by relatedness. Mol. Ecol. 5: 393—401. Burke, T., W. E. Rainey and T. J. White. 1992. Molecular variation and ecological problems. Jn (R. J. Berry, T. J. Crawford and G.M. Hewitt, eds.) Genes in Ecology. pp. 229—254. Blackwell Scientific Publications, Oxford. Coltman, D. W., W. D. Bowen and J. M. Wright. 1996. PCR primers for harbour seal (Phoca vitulina concolour) microsatellites amplify polymorphic loci in other pinniped species. Mol. Ecol. 5: GIL WMOS Corbet, G. B. and J. E. Hill. 1991. A World List of Mammalian Species. 3rd ed. Oxford University Press, Oxford, 243 pp. Ishibashi, Y.,T. Saitoh, S. Abe and M. C. Yoshida. 1995. Polymorphic microsatellite DNA markers in the grey red-backed vole Clethrionomys rufocanus bedfordiae. Mol. Ecol. 4:127—128. Ishibashi, Y., T. Saitoh, S. Abe and M. C. Yoshida. 1996. Null microsatellite alleles due to nucleotide 10 Mammal Study 22: 1997 sequence variation in the grey-sided vole Clethrionomys rufocanus. Mol. Ecol. 5:589—590. Ishibashi, Y., T. Saitoh, S. Abe and M. C. Yoshida. 1997. Sex-related spatial kin structure in a spring population of grey-sided voles Clethrionomys rufocanus as revealed by mitochondrial and microsatellite DNA analyses. Mol. Ecol. 6:63—71. Kayser, M., H. Ritter, F. Bercovitch, M. Mrug, L. Roewer and P. Niirnberg. 1996. Identification of highly polymorphic microsatellites in the rhesus macaque Macaca mulatta by cross-species amplification. Mol. Ecol. 5: 157—159. Lade, J. A., N.D. Murray, C.A.Marks and N.A. Robinson. 1996. Microsatellite differentiation between Phillip Island and mainland Australian populations of the red fox Vulpes vulpes. MOE IeOlo Se Gil. Litt, M. and J. A. Luty. 1989. A hypervariable microsatellite revealed in vitro amplification of a dinucleotide repeat within the cardiac muscle actin gene. Am. J. Hum. Genet. 44 : 397—401. Mazars, G. -R., C. Moyret, P. Jeanteur and C. -G. Theillet. 1991. Direct sequencing by thermal asym- metric PCR. Nuc. Acids Res. 19 : 4783. McDonald, D. B. and W.K. Potts. 1994. Cooperative display and relatedness among males in a lek-making bird. Science 266 : 1030—1032. Morin, P. A., J. J. Moore, R. Chakraborty, L. Jin, J. Goodall and D. S. Woodruff. 1994a. Kin selection, social structure, gene flow, and the evolution of chimpanzees. Science 265: 1193—1201. Morin, P. A., J. Wallis, J. J. Moore and D. S. Woodruff. 1994b. Paternity exclusion in a community of wild chimpanzees using hypervariable simple sequence repeats. Mol. Ecol. 3 : 469—478. Paetkau, D., W. Calvert, I. Stirling and C. Strobeck. 1995. Microsatellite analysis of population structure in Canadian polar bears. Mol. Ecol. 4:347—354. Paetkau, D. and C. Strobeck. 1995. The molecular basis and evolutionary history of a microsatellite null allele in bears. Mol. Ecol. 4:519—520. Pemberton, J. M., J. Slate, D. R. Bancroft and J. A. Barrett. 1995. Nonamplifying alleles at micro- satellite loci: a caution for parentage and population studies. Mol. Ecol. 4:249—252. Queller, D.C., J. E. Strassmann and C. R. Hughes. 1993. Microsatellites and kinship. Trends Ecol. Evol. 8: 285—288. Sambrook, J., E. F. Fritsch and T. Maniatis. 1989. Molecular cloning: a Laboratory Manual. 2nd ed. 9.16—9.17. Cold Spring Harbor Laboratory Press, New York. Schlotterer, C., B. Amos and D. Tautz. 1991. Conservation of polymorphic simple sequence loci in cetacean species. Nature 354 :63—65. Sillero-Zubiri, C., D. Gottelli and D. W. Macdonald. 1996. Male philopatry, extra-pack copulations and inbreeding avoidance in Ethiopian wolves (Canis simensis). Behav. Ecol. Sociobiol. 38: SL = SA), Taberlet, P. and L. Fumagalli. 1996. Owl pellets as a source of DNA for genetic studies of small mammals. Mol. Ecol. 5:301—305. Tautz, D. 1989. Hypervariability of simple sequences as a general source for polymorphic DNA markers. Nuc. Acids Res. 17 : 6463—6471. Tikel, D., D. Blair and H. D. Marsh. 1996. Marine mammal faeces as a source of DNA. Mol. Ecol. 5 244.57, Valsecchi, E. and W. Amos. 1996. Microsatellite markers for the study of cetacean populations. Mol cole srslinliaa 50: Washio, K. 1992. Genetic identification of nonhuman primates using tandem-repetitive DNA sequences. Jn (R.D. Martin, A. F. Dixson and E. J. Wickings, eds.) Paternity in Primates: Genetic Tests and Theories. Implications of Human DNA Fingerprinting. pp. 53—62. Kar- ger, Basel. Weber, J. L. and P. E. May. 1989. Abundant class of human DNA polymorphisms which can be typed using the polymerase chain reaction. Am. J. Hum. Genet. 44 : 388—396. (accepted 10 March 1997) Mammal Study 22: 11-26 (1997) © the Mammalogical Society of Japan Laboratory experiments on spatial use and aggression in three sympatric species of shrew in Hokkaido, Japan Satoshi OHDACHI Institute of Low Temperature Science, Hokkaido University, Sapporo O60, Japan Fax. +81-11-706-7142, e-mail. ohdachi@bio. hokudai. ac. jp Abstract. Aggression and the use of vertical and horizontal space in the presence of con- or hetero-specific individuals were investigated in laboratory for Sovex unguiculatus, S. caecutiens, and S. gracillimus in Hokkaido, Japan. S. unguiculatus frequently used the below floor strata of experimental cages or subterranean burrows as their main area of activity, whereas S. caecutiens and S. gracillimus mainly used the cage floor or the ground surface. The presence of con- or hetero-specific individuals led to no changes in any of the three species in the use of space, or in behavioral patterns (active/inactive ; underground/resting/ mov- ing on the ground surface). When two individual shrews were introduced into two interconnected cages, they tended to remain in separate cages, with the exception of S. gracillimus with a con- specific. Dominance rank was highest in S. unguzculatus, interme- diate in S. caecutiens, and lowest in S. gracillimus. S. caecutiens attacked S. gracillimus most frequently and S. gracillimus received attacks from S. caecutiens most frequently. The implication of this research is that severe interference competition may occur in the field between S. caecutiens and S. gracillimus. Key words: coexistence, interference competition, niche shift, surface activity, underground activity. Sorex unguiculatus, S. caecutiens, and S. gracillimus are three common species of shrew occurring throughout Hokkaido. When S. caecutiens and S. gracil- limus occur together, they are never the two most abundant species (Ohdachi and Maekawa 1990a, Ohdachi 1995a). Ohdachi (1995b) confirmed that S. caecutiens-and S. gracillimus share a greater similarity in their diets than do either of these species and S. unguiculatus. These findings indicate that inter- specific competition is likely to be more severe between S. caecutiens and S. gracillimus. Further, S. unguiculatus is a much stronger burrower than either of the other two species (Ohdachi 1995c). It is suspected, therefore, that severe interference for space exists between S. caecutiens and S. gracillimus. There is the potential for a niche shift by one species, when in the presence of the other, that could influence the outcome of competition. If both species exhibit interference competition, but neither of them changes any of its niche 12 Mammal Study 22: 1997 dimensions, then the physically superior individual or species may exclude the inferior individual or species from good habitat or a good position (e.g., Hardin 1960, Schoener 1975, Werner and Hall 1976, Holbrook 1979, Parker and Suther- land 1986, Alatalo and Moreno 1987, Arthur 1987). In such cases, aggressive behavior and physical superiority are essential keys for guild formation, and thus make it interesting to investigate whether individuals change their use of space (or niche) in the presence of other individuals. For cryptic species whose life histories are poorly known, such as the shrews of Hokkaido, it is difficult to carry out extensive field studies of space use and interactions. Ohdachi (1992) described the home ranges of sympatric shrews in Hokkaido, but was only able to present limited information about interspecific interactions because of the difficulties in observing them directly. Therefore, the alternative means of investigating direct interactions in the laboratory was chosen for this study. Although the reality of simulated situations, particularly in the scaling of time and space, is questionable (Bennett 1990), the results obtained from laboratory experiments can, nevertheless, complement those from field studies (Diamond 1986, Hairston 1989, Keddy 1989). This paper serves to describe: (1) interspecific differences in the use of space, (2) interspecific interactions such as aggressive behavior, and (3) the impact of the presence of another individual on the use of activity space and on behavioral patterns, in S. unguiculatus, S. caecutiens, and S. gracillimus in Hokkaido. For these purposes, two different laboratory experiments were conducted. MATERIALS AND METHODS 1. Experiment 1 The first experiment was designed mainly to examine the effects of the presence of con- or hetero-specific individuals on vertical space use. Animals used in this experiment were nine S. unguiculatus (5 young males, 4 young females), eight S. caecutiens (1 adult male, 4 young males, 3 young females), and five S. gracillimus (3 young males, 2 young females), which were captured in Yufutsu Moor (Tomakomai-shi) during 14-18 June 1992 and in a wind-shelter belt near the Teshio Experimental Forest of Hokkaido University (Horonobe- cho) during 25 June to 27 August 1992. Basically, sexually immature individ- uals were used in experiments in order to lessen the potential effect of sexual behavior on space use. Shrews were kept under a 16-hr light and 8-hr dark photoperiodic cycle at 20+2°C. The light intensity was maintained at 1420 lux during the light period and at 12 lux during the dark period (as measured at the center of laboratory floor ; See Ohdachi 1994, 1995c for details). Each experi- ment was conducted throughout the 8-hr dark period, from 11 October 1992 to 6 January 1993. Each observation cage contained 20 levels and the floor surface, and was fitted with two staircases (Fig. 1). Each of the boards separating the levels Ohdachi, Spatial use and aggression of shrews is Tae = Water Black ccryic board iim a. @ Food Transparent acrylic board Artificial turf Fig. 1. The experimental device for Experiment 1. Black boards were removed just before an experimental session. was covered on both sides with artificial turf so that shrews were always in physical contact with this surface while moving about between levels. Pieces of tissue paper, which simulated ground litter, were located on the cage floor. Trays of the mixed paste diet and water were located as shown in Fig. 1. Black acrylic boards were attached in front of transparent cage walls, so as to exclude light before observation periods. Either one or two animals were released simultaneously onto the cage floor thirty minutes before the onset of the dark period. The black masking boards were gently removed immediately after the light was turned off. The location and behavior of each shrew were then recorded every fifteen minutes using a weak red spot-light. After finishing an experimental session, the animals were removed and the cages were washed with ethanol and kitchen detergent and then dried out. The vertical location of a shrew was assigned to one of five categories : surface level (0), levels 1-5, 6-10, 11-15, and 16-20. Utilization of each level by an individual was obtained by averaging the percent frequencies for the level among several experimental sessions under the same experimental treatment. Seventy experimental sessions were used for analysis. The dominance relationship between two individuals was defined as fol- lows: the “loser” was the individual which avoided, escaped, or fled from its “opponent” when two animals encountered or fought, while the opponent under these circumstances was a “winner”. If the number of wins and losses obser- ved were the same, the two animals were judged to be “even”. When no direct contact was observed, this was defined as “no match”. 2. Experiment 2 The second experiment was designed to investigate aggressive behavior 14 Mammal Study 22: 1997 and the effect of the presence of con- or hetero-specific individuals on the use of space use (especially horizontal use) and behavioral patterns. Animals used in this experiment included ten S. unguiculatus (1 adult female, 5 young males, 4 young females), three S. caecutiens (2 young male and 1 young female), and five S. gracillimus (2 adult females, 1 young male, and 2 young females), which were captured in wind-shelter belts near the Teshio Experimental Forest of Hokkaido University during 6-22 August 1993, and one adult female S. caecutiens that was captured in Yufutsu Moor in July 1992. Laboratory condi- tions were the same as in Experiment 1. Each experiment was conducted throughout the dark period, from 30 August to 24 November 1993. Two animais were released separately into experimental cages (Fig. 2) one day before an experiment, with both sides of the connecting tube being closed by rubber plugs. The rubber plugs were removed five minutes before the onset of the dark period. Asa control experiment, an empty cage was connected to a cage where a single shrew was introduced. The first cage into which a shrew was introduced, prior to the cages being connected for the experiment, is hereafter referred to as the “home” cage, while the other is referred to as the “away cage. Shrew behavior was recorded using a video camera recorder (in the twi- light vision mode) throughout the dark period, and sampled every 5 minutes while replaying the video tapes. Behavior was ascribed to one of three cate- gories: “underground activity” (shrews were underground or digging), “in Video camera Fig. 2. The experimental device for Experiment 2. A connecting tube is plugged until an experimental session is started. Note that the bottom of a nest box was open to the ground surface. Ohdachi, Spatial use and aggression of shrews 15 action on the ground” (shrews were in nest boxes or resting on the ground surface), and “moving on the ground” (shrews were walking or running on the ground surface, or whirling exercise wheels). Other behaviors, such as eating, drinking, or self-grooming, were usually too brief to be recorded by the 5- minute-interval sampling method. Behavior below ground and in nest boxes could not be observed in this experiment. Because S. unguiculatus usually constructed burrows in its “home” cage and some entrances of the burrows opened under its nest box, it was impossible to distinguish “underground activity” and “inaction on the ground” when it was in its nest box. According to preliminary observations, however, S. unguiculatus usually entered burrows under its nest box instead of staying on the ground surface when in its nest box. Therefore, unless it was possible to verify that the shrew did not enter a burrow, the case in which S. unguiculatus was in a nest box was classified as “underground activity”. Preliminary observations revealed that S. caecutiens and S. gracillimus usually stayed on the ground surface under the nest box of S. unguiculatus, and that they were usually inactive there. Thus, when S. caecutiens or S. gracillimus was in the “away” nest box of S. unguzculatus, this was classified as “inaction on the ground”, except when they obviously entered burrows under the nest box. The frequency of each behavioral category for an individual was obtained by averaging the observation frequencies of the category across several experi- mental sessions under the same experimental treatment. Sixty-two experimen- tal sessions (496-hour observation in total) were used for the analysis. The number of attacks and the dominance relationship between individuals were determined by continuous scanning of the video tape throughout the 8-hr experimental session (complete observation). Attacking behavior includes chasing, biting body or tail, and wrestling. Attacks interrupted for more than 10 seconds was counted separately. The criteria for “win”, “lose’, and “no match” were the same as in Experiment 1. In this experiment, however, “even” was defined as follows: frequent counterattacks were observed or an individ- ual did not escape from the opponent even when it was attacked often. RESULTS 1. Experiment 1 Sorex unguiculatus was more subterrestrial than either S. caecutiens or S. gracillimus. S. caecutiens used the surface level significantly more frequently than S. unguiculatus during its active phase (ANOVA with arcsine transforma- tion by Scheffe’s method, w=0.05), but utilization of the other levels did not differ significantly between these two species (Fig. 3). S. gracillimus appeared to frequently use the surface level as did S. caecutiens, although its surface activity was not statistically different from that of either S. unguzculatus or S. caecutiens (Fig. 3). Vertical space use did not differ significantly between the experimental treatments in each of the three species (Fig. 3). The dominance relation also 16 Mammal Study 22: 1997 A. S. unguiculatus Alone With S. u. Active With S. c. 1-5} Active 6, 0 Bact 1-5 es & 6-10 Sleep 11-15 Mean percent frequency (%) Fig. 3. Vertical spatial use of shrews when they were alone and with con- or hetero-specific individuals (mean percent frequency). The same bold letters (a, b) indicate non-significant difference in mean percent frequency for the floor surface (0) between species when shrews were “alone” (a=0.05, ANOVA, arcsine transformation, Scheffe’s method; the sequential Bonferroni correction among levels, Rice 1989). There was significant difference neither among species for the other levels when alone nor among experimental treatments for each level within species. Ohdachi, Spatial use and aggression of shrews IL, Table 1. The ratios of “active” and “rest & sleep” phases in three shrew species observed in Experiment 1 (mean percent frequency+SD). Mean percentages in the “alone” column differed significantly between any two of the three species (a =0.05, ANOVA, arcsine trans- formation, Scheffe’s method). The different letters indicate significant differences. The mean percentages did not differ significantly among the experimntal treatments within species. With Experimental Alone San Se S. g. treatment S. unguiculatus a Active 30.22 10.9 300 / 225, 5 89) 2aEW 38 ai alse If 5 Al Rest and Sleep 67 .0 OS 60.8 58.6 (n) (8) (8) (8) (9) S. caecutiens b Active (0.2212. I (3.22 7,,9 65.522 25.0 68.6+8.2 Rest and Sleep 29.4 Om StS) 31,4! (7) (7) (8) (8) (8) S. gracillimus © Active i), Oaet0) 4 (0) Hae l2, 2! NaSaeOy 7 HS O22 2 Rest and Sleep 50.0 3925 49.2 44.2 (7) (4) (4) (4) (5) had no apparent effect on vertical space use; there were no significant differ- ences for almost all comparisons. The percentages of active and non-active phases did not differ significantly between the exrimental treatments (alone and with con- or hetero-specific individuals) in any of the three species (ANOVA with arcsine transformation by Scheffe’s method, a=0.05, Table 1). Interspecific differences in activity when animals were “alone” were, however, significant. S. caecutiens was most active, S. unguiculatus was least active, and S. gracillimus was intermediate between them. Dominance relationships between two individuals (win, even, lose, or no match) also had no effect on activities of shrews. 2. Experiment 2 The use of “home” or “away” cage did not differ significantly among species when shrews were “alone” (ANOVA, @=0.05). S. unguiculatus, how- ever, tended to stay in its “home” cage more than either of the other two species (Table 2). The experimental treatments (alone and with con- or hetero-specific individuals) also had no effect on the use of “home” and “away” cages for any of the three species (Table 2). The dominance relationships tended not to influence the use of either the “home” or “away” cage in the three species ; there were no significant differences for almost all comparisons. When two individuals were introduced into two interconnected cages, they tended to stay in separate cages (Table 3). The mean percentage of time spent in a single cage or separate cages did not differ significantly among the experimental treatments. 18 Mammal Study 22: 1997 Table 2. The utilization of “home” and “away” cages by three shrew species observed in Experiment 2 (mean percent frequency+ SD). The mean percentages differed significantly neither between the experimental treatments within species nor between species when shrews were “alone” (a#=0.05, ANOVA, arcsine transformation, Scheffe’s method). With Experimental Alone SOUL SG Sais treatment S. unguiculatus Home Orie 728) <3 TOE 9E= 2045 6447 = 36e5 F229 1 Away DE) 8 Baye Jt Rios AS) (7) (10) (10) (10) (10) S. caecutiens Home 503 (esi 9 52). Osta O6 30:3 sel 6 AD Gate 232 Away 49.3 48.0 Oe 1 50.4 (7) (4) (4) (4) (4) S. gracillimus Home HO oaeZ9).(/ 68.0+7.9 48.2+29.4 AS 2 == Ono Away a5}. 5) 8 ll) RS Sls (n) (4) (4) (5) (4) S. unguiculatus remained underground or dug soil significantly more fre quently (@=0.05) than did either S. caecutiens or S. gracillimus when they were in their “home” cages (Fig. 4). The mean frequencies of the three behavioral categories, however, did not differ significantly among the three species when they were in “away” cages (Fig. 4). S. unguiculatus was “active underground” significantly more frequently in its “home” cage than it was in the “away” cage under each of the experimental Table 3. Occupation of cages by two shrews in Experiment 2 (mean percent frequency + SD of staying in the same cage and separate cages). The means did not differ significantly between any comparisons (a=0.05, ANOVA, arcsine transformation, Scheffe’s method). 7: number of experimental sessions examined. With S. caecutiens S. unguiculatus S. gracillimus S. unguiculatus Same 35), ae IIS) 9) 35) ocd bff) 24225-1438 Different 64.1 64.4 (Date (n) (5) (10) (10) S. caecutiens Same = 33.9+19.6 382420 Different = 66.1 66.3 (n) (5) (9) S. gracillimus Same = = HA aoe Oat Different = = AD LZ (n) (4) Ohdachi, Spatial use and aggression of shrews 9 A. S. unguiculatus B. S. caecutiens 60 < ° 3 o p> Oo pe) oO oOo With S.u. With S.c. With S.u. With S.c. With S.g. a 3 (o>) Oo Mean frequency (%) Mean frequency [o) Away ho oO 20 40 40 C. S. gracillimus 60 Home Underground activity ie) [o) Inaction on the ground (2) (2) Mean frequency 20 Moving on the ground Away 40 Fig.4. The effects of con-or hetero-specific individuals on the behavior of shrews (mean percent frequency). The same letters indicate non-significant difference in mean frequency of each behavior category among the experimental treatments and between “home” and “away” cages within experimental treatment (@a#=0.05, ANOVA, Scheffe’s method). In S. caecutiens and S. gracillimus, any significant difference in behavioral category was not found among the experimental treatments nor between “home” and “away” cages. treatments (Fig. 4-A). In contrast, the mean frequency of each behavior in S. caecutiens and S. gracillimus did not differ significantly between the “home” and “away” cage situations (Fig. 4-B, C). The experimental treatments (alone and with con- or hetero-specific individuals) also had no effect on the behavi- oral patterns for any of the three species (Fig. 4). The relationship between the mean frequencies of the behavioral categ- ories and the dominance relation was not fully analyzed because of small sample size. However, behavioral patterns appeared not to be affected by the dominance relationship. 3. Dominance relationships and attacks Among the three species, S. unguiculatus was most dominant and S. gvacil- limus was most submissive in terms of physical superiority. S. unguiculatus was seldom defeated by S. caecutiens and never defeated by S. gracillimus (Table 4). Furthermore, “no match” was the major result between conspecific individuals of S. unguiculatus in Experiment 2, but this result might be an artifact of the observation method that underground behaviors could not be observed. S. caecutiens beat S. gracillimus in most combats. S. unguiculatus showed no significant difference in the number of attacks Mammal Study 22: 1997 Table 4. Dominance relations between two con- or hetero-specific individuals in Experiments 1 and 2 (numbers of individuals of four kinds of the relation). Results of different experimental sessions for an individual were treated as diffrent counts. Opponent Spd See SY Experiment 1 S. unguiculatus win 4 6 6 even 4 4 1 lose 4 0) 0 no match 0 2 3 S. caecutiens win 0 5 4 even 4 4 2 lose 6 5 1 no match 2 ) 2 S. gracillimus win 0 1 2 even il 2 4 lose 6 4 2 no match 3 2 0 Experiment 2 S. unguiculatus win il 6 8 even 0 IL 0 lose 1 1 0 no match 8 2 2, S. caecutiens win 1 5 i even i 0) 0 lose 6 5 0) no match 2 0) Z S. gracillimus win ) 0 4 even 0 0 0 lose 8 tt 4 no match 2 2 0) Table 5. Mean numbers of attacks (+SD) between two individuals in Experiment 2. The same letters indicate non-significant difference (a= 0.05, Mann-Whitney’s U-test, the sequential Bonnferroni correction, Rice 1989). The first letters before comma indicate the results of between- columm comparisons and the second letters are those of between-rows. Numbers parentheses are those of observations examined. Against See Sie 5.423 S. unguiculatus Oe Sac), 7 ee Qari 5 62 98 (2)a, a (8)a,a (8)a, a S. caecutiens heQael 4 6.4+8.9 214 = 6.6 (8)a, a (10)a, a (7)b, b S. gracillimus 0.0+0.0 OM6== 085 0.9+1.4 (8)a, a bya (8) ab, a Ohdachi, Spatial use and aggression of shrews 21 against other individuals (Table 5). S. caecutiens attacked S. gracillimus sig- nificantly more frequently than it did S. unguiculatus or other S. caecutiens. S. gracillimus attacked other individuals less frequently than did either of the other two species. S. gvacillimus was attacked more often by S. caecutiens than by S. unguiculatus or by conspecifics (Table 5) DISCUSSION S. unguiculatus was frequently active underground, whereas S. caecutiens mainly used the ground surface (Figs.3 and 4). S. gracillimus showed an intermediate vertical use of space in Experiment 1, but it was primarily a ground-surface dweller (Fig. 4) in Experiment 2, which was deemed to simulate natural conditions more realistically than Experiment 1. The interspecific differences in use of space were consistent with those in burrowing habits (Ohdachi 1995c) and in dietary constituents (Abe 1968, Inoue and Maekawa 1990, Ohdachi 1995b): S. caecutiens and S. gracillimus, which are poor burrowers and mainly eat small epigeal arthropods, showed more surface activity than did S. unguiculatus, which was a superior burrower and a heavy consumer of earthworms. The presence of a con- or hetero-specific individual or their dominance relationships affected neither the space utilization nor the mean frequencies of behaviors (active/inactive and underground/resting/ground surface activity) in each of the three shrew species. S. unguiculatus was intrinsically different in its use of space (especially vertically) from S. caecutiens and S. gracillimus. It is, therefore, likely that direct interaction or interference over space is less frequent between S. unguiculatus and either of S. caecutiens or S. gracillimus than between the latter two species. A dominance order among the three species was evident (Table 4) and seemed to correspond with the shrews’ body size. The strongest S. un- guiculatus weighs on average approximately twice as much as the second- ranked S. caecutiens, and S. caecutiens is 1.5 times as heavy as the weakest S. gracillimus (Ohdachi and Maekawa 1990b). The correlation between fighting ability and body size has also been reported from some other insectivorous or carnivorous vertebrates (e.g., Persson 1985, Alatalo and Moreno 1987, Dickman 1988, Erlinge and Sandell 1988, Ducey et al.1994, Nakano and Furukawa- Tanaka 1994). Each of the three shrew species exhibited antagonistic behavior whenever two con- or hetero-specific individuals encountered, although S. gvacillimus were least likely to attack. It may have been this tendency that led them to remain in whichever cage was not occupied by its opponent (Table 3). Many other soricine species also show antagonism against con- or hetero-specific individuals (Crowcroft 1957, Olsen 1969, Hawes 1977, Martin 1981, Barnard and Brown 1982, Churchfield 1990, Ellenbroek 1990, Dickman 1991, Ellenbroek and Hamburger 1991, Krushinska and Rychlik 1993). However, some species, such as Neomys anomalus and Cryptotis parva, are tolerant towards conspecifics UD Mammal Study 22: 1997 (Broadbooks 1952, Conaway 1958, Mock 1982, Krushinska and Pucek 1989, Krushinska and Rychlik 1993). Krushinska and Pucek (1989) reported that acquaintance reactions, such as warning and nasal contact, were observed in WN. anomalus when two individuals met. In their study, shrews gradually avoided direct conflict by learning their place of the dominance rank. In the present study, such acquaintance behaviors were not observed; shrews suddenly attacked other individuals (or were attacked) throughout experiments. The lack of acquaintance behavior in the present study might have resulted from the brevity of experiments which might have led to their intolerance of other individuals. Although S. unguiculatus was strongest of the three species (Table 4), it attacked other two species less frequently (Table 5). In the present study, attacks could only be observed among animals on the ground surface, which might thus underestimate the attacking frequency of S. unguiculatus. Under natural conditions, however, attacks by S. unguiculatus against S. caecutiens and S. gvacillimus are also probably rare, because the latter two species use subterranean space less frequently and presumably rarely encounter S. un- guiculatus. Soricids usually establish intraspecific territories or exclusive home ranges, especially among individuals of the same sex (Ingles 1961, Shillito 1963, Buckner 1966, 1969, Croin-Michielsen 1966, Platt 1976, Hawes 1977, Pernetta 1977, Inoue 1988, 1991, Ohdachi 1992, Ivanter et a/. 1994, Moraleva and Telitzina 1994, Stockley et al.1994). Such territoriality seems to be maintained by aggressive behavior and odor marking (Crowcroft 1957, Hawes 1976). Two types of interspecific spatial relationships are known among soricine shrews. In the first type, territories overlap between species, as between S. avaneus and S. minutus (Croin-Michielsen 1966, Pernetta 1977, Ellenbroek 1980). In the second type, there is interspecific territoriality as between S. czmeveus and S. vagrans (Spencer and Pettus 1966) and between S. vagrans and S. obscurus (Hawes 1977). In Hokkaido, S. unguiculatus and either of S. gracillimus or S. caecutiens appear to have overlapped territories (Ohdachi 1992). The occur- rence of overlapped territories might be explained by the interspecific differ- ence in vertical space use: S. unguiculatus appears only rarely to encounter either S. gracillimus or S. caecutiens in the field. In contrast, inferring from the results of the present study (Figs. 3 and 4), it is plausible that S. caecutiens and S. gracillimus maintain interspecific territories when in symtopy, because both species are ground-surface dwellers and they do not shift their space of activity even when they co-habituate. S. caecutiens tenaciously attacks S. gracillimus, and the latter seldom beats S. caecutiens. The similarity in space use and the physical inferiority of S. gracillimus could lead to its exclusion from habitats where S. caecutiens occurs. Moreover, recipients of aggressive behavior may experience reduced fitness in general (King 1973). This could partly explain the relative abundances of the two species in a given habitat (Ohdachi and Maekawa 1990a): S. caecutiens and S. gracillimus do not occur together as the first and second most abundant Ohdachi, Spatial use and aggression of shrews 23 species. However, if S. caecutiens were to always exclude S. gracillimus, then S. gracillimus would be unable to occur in Hokkaido. In reality, S. gvacillimus outnumbers S. caecutiens and S. unguiculatus in some habitats (Ohdachi and Maekawa 1990a). This might be attributed to interspecific differences in habitat preference. S. gvacillimus is the most abundant species in moor and uplands, especially, in northern Hokkaido, whereas S. caecutiens tends to outnumber other species in habitats with sandy- or volcanic ash-soils (Ohdachi and Maekawa 1990a), which implies that each species prefers particular envi- ronments. Furthermore, competitive (interference) capabilities may vary in relation to such environmental variables as temperature, humidity, or soil type, and the result of competition depends on environmental conditions. Such phenomena are known in fish (Dunson and Travis 1991, De Staso and Rahel 1994), planktons (Hessen et al. 1995), and beetles (Park 1954). Also, the distri- bution pattern of soricids in Hokkaido is probably determined by a combina- tion of both competitive ability and environmental conditions. In order to understand community organization or distribution pattern of the shrews in Hokkaido, further investigations of the effect of environmental conditions on competitive ability are recommended. Acknowledgments : I would like to express my deep gratitude to: H. Abe, M. J. Toda, S. F. Mawatari, T. Ohgushi, and T. P. Craig for reviewing earlier drafts of this paper, K. Ishigaki, K. Sasa, and other staff members of the Experimental Forests of Hokkaido University for supporting the field work, T. Segawa, S. Nakatsubo, and H. Ishii for making the equipment for the experiments, students of the Institute of Low Temperature Science and the Laboratory of Applied Zoology, Hokkaido University, who provided assistance with laboratory exper- iments, and also S. Nakano, who referred me to some important research papers. REFERENCES Abe, H. 1968. Classification and biology of Japanese Insectivora (Mammalia) II. Biological aspects. J. Fac. Agr., Hokkaido Univ. 55 : 429—458. Alatalo, R. V.and J. Moreno. 1987. Body size, interspecific interactions, and use of foraging sites in tits (Paridae). Ecology 65:1773—1777. Arthur, W. 1987. The Niche in Competition and Evolution. John Wiely and Sons, Chichester, 175 pp. Barnard, C. J.and C. A. J. Brown. 1982. The effects of prior residence, competitive ability and food availability on the outcome of interactions between shrews (Sovex avaneus L.). Behav. Ecol. and Sociobiol. 10 : 307—312. Bennett, W. A. 1990. Scale of investigation and the detection of competition: an example from the house sparrow and house finch introductions in North America. Am. Nat. 135 : 725—747. Broadbooks, H. E. 1952. Nest and behavior of a short-tailed shrew, Cvyptotis parva. J. Mammal. 33: Dl 7}. Buckner, C. H. 1966. Populations and ecological relations of shrews in tamarack bogs of southeast- ern Manitoba. J. Mammal. 47 : 181—194. Buckner, C. H. 1969. Some aspects of the population ecology of the common shrew, Sorex araneus, 24 Mammal Study 22: 1997 near Oxford, England. J. Mammal. 50 : 326—332. Churchfield, S. 1990. The Natural History of Shrews. A & C Black., London, 178 pp. Conaway, C. H. 1958. Maintenance, reproduction and growth of the least shrew in captivity. J. Mammal. 39 : 507-512. Croin-Michielsen, N. 1966. Intraspecific and interspecific competition in the shrews Sovex araneus L. and S. minutus L. Arch. Néerland. Zool. 18 :73—174. Crowcroft, P. 1957. The Life of the Shrew. Max Reinhardt, London, 166 pp. De Staso, J., III, and F. J. Rahel. 1994. Influence of water temperature on competitive interactions between juvenile brook trout and Colorado river cutthroat trout in a laboratory stream. Trans. Am. Fish. Soc. 123 : 289—297. Diamond, J. M. 1986. Overview: laboratory experiments, field experiments, and natural experi- ments. Jn (J. M. Diamond and T. J. Case, eds.) Community Ecology. pp.3—22. Harper & Row, New York. Dickman, C. R. 1988. Body size, prey size, and community structure in insectivorous mammals. Ecology 69 : 569—580. Dickman, C. R. 1991. Mechanisms of competition among insectivorous mammals. Oecologia 85: AG4— 471. Ducey, P.K., K.Schramm and N.Cambry. 1994. Interspecific aggression between the sympatric salamanders, Ambystoma maculatum and Plethodon cinereus. Amer. Midl. Natur. 131 :320— 329. Dunson, W. A. and J. Travis. 1991. The role of abiotic factors in community organization. Am. Nat. 138 : 1067—1091. Ellenbroek, F. J. M. 1980. Interspecific competition in the shrews Sovex avaneus and Sorex minutus (Soricidae, Insectivora) : a population study of the Irish pygmy shrew. J. Zool., London 192: 119 136: Ellenbroek, F. J. M. 1990. An Experimental Analysis of Interspecific Competition in the Shrews Sorex avaneus L.and S. minutus L. (Soricidae, Insectivora). H.Gianotten, Tilburg, 125 pp. Ellenbroek, F. J. M.and J. Hamburger. 1991. Interspecific interactions between the shrews Sorex araneus L.and S. minutus L.(Soricidae, Insectivora) and the use of habitat: a laboratory study. Netherl. J. Zool. 41 : 32—62. Erlinge, S.and M. Sandell. 1988. Coexistence of stoat, Mustela erminea, and weasel, M. nivalis : social dominance, scent communication, and reciprocal distribution. Oikos 53 : 242—246. Hardin, G. 1960. The competitive exclusion principle. Science 131 : 1292—1297. Hairston, N.G., Sr. 1989. Ecological Experiments. Purpose, Design, and Execution. Cambridge University Press, Cambridge, 370 pp. Hawes, M.L. 1976. Odor as a possible isolating mechanism in sympatric species of shrews (Sorex vagrans and Sorex obscurus). J. Mammal. 57 : 404—406. Hawes, M. L. 1977. Home range, territoriality, and ecological separation in sympatric shrews, Sorex vagrans and Sorex obscurus. J. Mammal. 58 : 354—367. Hessen, D.O., B. A. Faafeng and T. Anderson. 1995. Competition or niche segregation between Holopedium and Daphnia: empirical light on abiotic key parameters. Hydrobiol. 307 : 253— 261. Holbrook, S.J. 1979. Habitat utilization, competitive interactions, and coexistence of three species of cicetine rodents in east-central Arizona. Ecology 60: 758—769. Ingles, L.G. 1961. Home range and habitats of the wandering shrew. J. Mammal. 42: 455—462. Inoue, T. 1988. Territory establishment of young big-clawed shrew, Sorex unguiculatus (Dobson) (Insectivora, Soricidae). Res. Popul. Ecol. 30: 83—93. Inoue, T. 1991. Sex difference in spatial distribution of the big-clawed shrew Sovex unguiculatus. Acta Theriol. 36 : 229-237. Inoue, T. and K. Maekawa. 1990. Difference in diets between two species of soricine shrews, Sorex unguiculatus and S. caecutiens. Acta Theriol. 35 : 253—260. Ivanter, E. V., T. Ivanter and A. M. Makarow. 1994. The territorial and demographic structures of a common shrews population. Jn (J.F. Merritt, G.L.Kirkland Jr.and R.K. Rose, eds.) Advances in the Biology of Shrews. pp.89—96. Carnegie Museum of Natural History, Ohdachi, Spatial use and aggression of shrews a5) Pittsburgh. Keddy, P. A. 1989. Competition. Chapman and Hall, London, 202 pp. King, J. A. 1973. The ecology of aggressive behavior. Ann. Rev. Ecol. Syst. 4: 117—138. Krushinska, N. L. and Z. Pucek. 1989. Ethological study of sympatric species of European water shrews. Acta Theriol. 34 : 269—285. Krushinska, N.L.and L. Rychlik. 1993. Intra- and interspecific antagonistic behaviour in two sympatric species of water shrews: Neomys fodiens and N. anomalus. J. Ethol.11:11—21. Martin, I.G. 1981. Tolerance of conspecifics by short-tailed shrews (Blarina brevicauda) in simulated natural conditions. Am. Midl. Nat. 106 : 206—208. Mock, O. B. 1982. The least shrew (Cryptotis parva) as a laboratory animal. Lab. Anim. Sci. 32: lr 9! Moraleva, N. and A. Telitzina. 1994. Territoriality in juveniles of the common shrew (Sorex avaneus) in prepeak and peak years of population. Jn (J. F. Merritt, G. L. Kirkland Jr. and R. K. Rose, eds.) Advances in the Biology of Shrews. pp.67—76. Carnegie Museum of Natural History, Pittsburgh. Nakano, S.and T. Furukawa-Tanaka. 1994. Intra- and interspecific dominance hierarchies and variation in foraging tactics of two species of stream-dwelling chars. Ecol. Res. 9:9—20. Ohdachi, S. 1992. Home ranges of sympatric soricine shrews in Hokkaido, Japan. Acta Theriol. 3391 SOk Ohdachi, S. 1994. Total activity rhythms of three soricine species in Hokkaido. J. Mamm. Soc. Japan 19: 89—99. Ohdachi, S. 1995a. Comparative Ecology and Ethology of Sympatric Soricine Shrews in Hokkaido: A Special Reference to Their Interspecific Interactions. Ph. D. Dissertation at the Graduate School of Science, Hokkaido University, 116 pp. Ohdachi, S. 1995b. Diets and abundances of three sympatric shrew species in northern Hokkaido. J. Mammal. Soc. Japan 20 : 69—83. Ohdachi, S. 1995c. Burrowing habits and earthworm preference of three species of Sorex in Hokkaido. J. Mammal. Soc. Japan 20 : 85—88. Ohdachi, S. and K. Maekawa. 1990a. Geographic distribution and relative abundance of four species of soricine shrews in Hokkaido, Japan. Acta Theriol. 35 : 261 —267. Ohdachi, S. and K. Maekawa. 1990b. Relative age, body weight, and reproductive condition in three species of Sovex (Soricidae; Mammalia) in Hokkaido. Res. Bull. Coll. Exp. For., Fac. Agr., Hokkaido Univ. 47 : 535—546. Olsen, R. W. 1969. Agonistic behavior of the short-tailed shrew (Blarina brevicauda). J. Mammal. 502 494— 500: Park, T. 1954. Experimental studies of interspecies competition. II]. Temperature, humidity, and competition in two species of Tribolium. Physiol. Zool. 27 : 177—229. Parker, G. A. and W. J. Sutherland. 1986. Ideal free distributions when individuals differ in competi- tive ability : phenotype-limited ideal free models. Anim. Behav. 34 : 1222—1242. Pernetta, J.C. 1977. Population ecology of British shrews in grassland. Acta Theriol. 22 : 279—296. Persson, L. 1985. Asymmetrical competition: are larger animals competitively superior? Am. Nat. 126 : 261 —266. Platt, W.J. 1976. The social organization and territoriality of short-tailed shrew (Blarina brevicauda) population in old-field habitats. Anim. Behav. 24 : 305—318. Rice, W. R. 1989. Analyzing tables of statistical tests. Evolution 43 : 223—225. Schoener, T. W. 1975. Presence and absence of habitat shift in some widespread lizard species. Ecol. Monogr. 45 : 233—259. Shillito (Babington), J. F. 1963. Observations on the range and movements of a woodland population of the common shrew Sorex avaneus L. Proc. Zool. Soc., London 140 :533—546. Spencer, A. W.and D. Pettus. 1966. Habitat preference of five species of long-tailed shrews. Ecology 47 : 677—683. Stockley, P., J. B. Searle, D. W. Macdonald and C. S. Jones. 1994. Alternative reproductive tactics in male common shrews: relationships between mate-searching behaviour, sperm production, and reproductive success as revealed by DNA fingerprinting. Behav. Ecol. Sociobiol. 34: 26 Mammal Study 22: 1997 (leamion Werner, E. E. and D. J. Hall. 1976. Niche shifts in sunfishes : experimental evidence and significance. Science 191 : 404—406. (accepted 26 July 1997) Mammal Study 22: 27-38 (1997) © the Mammalogical Society of Japan The impact of forestry on the small rodent community of Hokkaido, Japan Takashi SAITOH! and Atsushi NAKATSU? Hokkaido Research Centre, Forestry and Forest Products Research Institute, Hitsujigaoka 7, Toyohira, Sapporo O62, Japan Fax. +81-11-851-4167, ‘e-mail. bedford @ffpri-hkd. affrc. go. jp ?e-mail. nakatsua @ffpri-hkd. affrc. go. jp Abstract. The structure of small rodent communities, in both natural forests and young plantations, in the Asahikawa region of Hokkaido, Japan, in relation to the effects of long-term and large- scaled forestry, was analyzed using census data spanning the 31 years from 1962 to 1992. Rodent communities in both natural forests and plantations consisted largely of four species: Cleth- rionomys rufocanus, C. rutilus, Apodemus argenteus, and A. speciosus. Clethrionomys rufocanus was found to be dominant in both habitats, however the relative abundance of species differed significantly between habitats. Although the dominancy of C. rufocanus was most obvious in forestry plantations, the proportion it contributed to the community decreased during the 1980s. Conversely, Apodemus species have increased in both habitats over the same period. Rodent species diversity has increased in the last decade. The decline in the proportion of C. rufocanus has occurred in parallel with the decrease in the area of land under forestry plantation, which is the preferred habitat for C. rufocanus. These findings indicate that monocultural habitats, such as for- estry plantations, may support super dominant species such as C. rufocanus, which results in an impoverished rodent community, in terms of species diversity. Key words: Apodemus, Clethrionomys, forest structure, species diversity. Intensive silvicultural practices including site preparation, removal of poten- tially competing species, replacement of naturally occurring diversity with single species, and extensive use of herbicides, fertilizer sand pesticides, trans- form natural ecosystems into a timber production system. Monotonous for- estry plantation is, in other words, an artificially transformed, and greatly simplified habitat for animals. The faunas of such artificial forests have been intensively investigated for comparison with those of natural forests, and the effects of the introduction of monoculture on faunas have been widely discus- sed. Most previous studies have, however, been of a short-term nature, and on a limited spatial scale. Bird densities and species diversity are, for example, generally lower in plantations, especially in young plantations, than in natural forests (Fujimaki 28 Mammal Study 22: 1997 1970, Ishigaki and Matsuoka 1972, Ishigaki et a/. 1973, Kobayashi and Fujimaki 1985, Yui and Suzuki 1987; see also Murai and Higuchi 1988 for a review). Small mammal faunas also differ between natural and planted forests. Even when the species composition remains similar, the dominancy of the predomi- nant species, for example, is enhanced in forestry plantations (Ota et al. 1977, see also Ota 1984 for a review). Increases in the abundance of specific verteb- rate species have also been observed on areas of forest clear-cuts (Hansson 1994). Thus, a forest managed for maximum timber yield may be best regard- ed as analogous, in ecosystem terms, to a monocultured wheat field (Meffe and Carrol 1994). If the scale of operation was extended, so that the landscape became thoroughly transformed over several decades, then the effects of the plantation would be likely to become profound. Little is known, however, about such effects, because study on them requires wide-ranging long-termed investigation. In the 1950s, the Japanese Forestry Agency investigated a policy to trans- form natural forests into more productive plantations. As a consequence of this policy, considerable areas of natural forests were clear-cut and transfor- med into single species, largely coniferous, plantations. In Hokkaido, Japan’s northernmost island, this policy was implemented faithfully and extensively. During the peak period, more than one percent of natural forests were cut and transformed into coniferous plantations each year. Because young plantations were frequently damaged by the grey-sided vole, Clethrionomys rufocanus Sundevall, the Forestry Agency has, since 1954, carried out censuses of small rodents, for management purposes, in forests all over Hokkaido. That census data have proven invaluable. It has enabled us to describe, in this paper, changes in the structure of small rodent communities, in both natural forests and young plantations in Hokkaido over three decades from 1962 to 1992, and to analyze the effects of long-term, large-scaled planta- tions on small rodent communities. MATERIALS AND METHODS 1. Study area and census methods Since 1954 the Forestry Agency has carried out censuses of rodent popula- tions at approximately 1,000 sampling locations all over the 78,073 km? island of Hokkaido (41°24’-45°31’N, 139°50’-145°49’E). The forests under Forestry Agency Management cover 28,300 km? (21,500 km? of natural forests, and 6,800 km? of plantations). In 1990, these forests were managed by 81 District Offices, which were subdivided into Ranger Offices. The censuses were carried out by each individual Ranger Office. The data analyzed for this paper come from 8,034 km’ of northern Hokkaido (corresponding to about 10% of the island’s total area) under the supervision of the Asahikawa Sub-regional Office. Our study areas included 22 District Offices, which consisted of 113 Ranger Offices in 1990. Most of the natural forests in this area are classified as “pan mixed forests” with needle and broad-leaved trees, in what is regarded as a transition Saitoh and Nakatsu, Impact of forestry on small rodent communities 29 zone between the temperate and boreal zones (Tatewaki 1958). The dominant tree genera here are: Abies, Acer, Betula, Picea and Quercus (Tatewaki 1958). Trapping was carried out three times a year, in spring (May or June), summer (July or August) and autumn (September or October). Ranger Offices set 50 snap traps, at 10 m intervals on 0.5 ha (50 x 100 m) grids, over either three or five consecutive nights. Since rodent abundance in Hokkaido usually reaches its peak in autumn, and because autumn populations are known to reflect accurately annual variation in populations (Saitoh 1987), we used autumn census data in our analyses. Four rodent species, C. vufocanus, C. rutilus (Pallas), Apodemus speciosus (Temminck), and A. avgenteus (Temminck) were recorded during the censuses. C. vex Imaizumi, A. peninsulae (Thomas), and several species of shrew, Sovex spp., also occur in the region and may have been caught occasionally. These less common species were, however, not reported officially. Each Ranger Office censused 2-6 separate sites. Census grids were usually located in selected habitats (young plantations, and natural forests neighbour- ing plantations) which together constituted a unit. Census sites were some- times relocated within the area of a given Ranger Office, and methods have changed over the period of study. From 1962 to 1976, for example, traps were set for five nights, whereas from 1977 to 1992 a three-night trapping scheme was employed. To make these two data sets compatible for time-series analyses, the data from the first 15 years were transformed to three-night equivalents (z.é., 150 trap nights), using the regression of the three-night (y) on the five-night (x) captures (vy =0.68066x + 0.18127, 7?=0.935). For the purposes of this study, rodent abundance is defined as the number of individuals caught per 150-trap-nights. Species diversity and species ratios were calculated based on the data from the four main rodent species. The Shannon-Wiener function (index of evenness, /’) was used as an index for species diversity (Krebs 1989). As data for 1970 and 1974 have been lost (except for on C. rufocanus), values have been calculated excluding the data from these two years. Moving averages, for each three year period, were used to smooth annual variation. For the calculation of moving averages, for periods including the years 1962, 1970, 1974, and 1992, values were obtained from the data for the associated two years. 2. Forest management Forest planting follows several silvicultural procedures. For this paper we focused on the most drastic method of transforming a natural system into an artificial one; that is young plantations grown on clear-cuts. After clear- ance of natural forest, weeds are removed from the clear-cut, then larch, Larix kaempferi (Lambert) or fir, Abzes sachalinensis Fr. Schmidt seedlings are plant- ed densely. Because weeds grow thickly in young plantations and may sup- press the growth of tree seedlings, the weeds are cut every summer until between five and nine years after tree planting. Censuses were carried out in such young plantations until ten years after planting. 30 Mammal Study 22: 1997 3. The voles and mice The grey-sided vole, Chlethrionomys. rufocanus, is common in both open fields and in natural forests and plantations in Hokkaido. This species is well known for exhibiting a wide spectrum of population dynamics ranging from stable to cyclic (Saitoh 1987, Bjérnstad et al. 1996, Stenseth et al. 1996, Saitoh et al. 1997). This small (30-40 g), short-tailed (around 40% of head and body) rodent is more folivorous than other Clethrionomys species (Hansson 1985). This feeding habit is particularly prevalent in Hokkaido, possibly due to the absence of Microtus spp. ‘This is consistent with its wider habitat preference from open fields to natural forests in Hokkaido. During winter, C. rufocanus eats mainly leaves and shoots of bamboo grass, and some shrub/tree bark. During summer it eats various forbs and grasses, and in autumn, acorns are eaten to some extent (Ota 1984). The red-backed vole, C. rutilus, is a short-tailed, forest-dwelling rodent. Its body shape is similar to that of C. vufocanus, though at 20-30 g, it is smaller. Although C. rutilus is essentially granivorous (Hansson 1985), it also eats, to some extent, insects year around (Ota 1984). Its abundance is usually low in Hokkaido, though it sometimes dominates in mature coniferous forests (Ota 1984). The Japanese wood mouse, A. avgenteus, is endemic to Japan (though ecologically equivalent to A. sylvaticus of Eurasia). It is small, weighing just 15-20 g, and has a relatively long tail which is longer than its body length. At a weight of 40-60g, A. speciosus, another Japanese endemic mouse, is the largest of the four species analyzed here. Its tail is relatively short (77-99% of body length) for a mouse-shaped rodent. These two Apodemus species are both largely granivorous, though they also eat a considerable amount of insects (Ota 1984). The larger species A. speciosus prefers larger seeds such as acorns, walnuts, or pine nuts, whereas A. arvgenteus eats smaller seeds and berries. The main habitats of these two species include various forest types. The two species are usually dominant in natural forests, though A. speciosus is also found in open fields. RESULTS 1. Species composition The total of 223,663 rodents were trapped during the 31 year study period ; 122,653 of these were from 6,438 census grids in natural forests, and 101,010 were from 5,222 grids in young plantations. The average number per trapping grid in the two types of forests were very similar: 19.1 for natural forests and 19.3 for plantations. The proportion of Clethrionomys rufocanus to the total number of rodents captured, exceeded 50% in both natural forests and plantations (Fig. 1). Although the order of dominance (C. rufocanus >A. argenteus > A. speciosus > C. rutilus) was the same in natural forests and in plantations, relative propor- tions of each species differed significantly between them (G-test, Gag;= 449.3, Saitoh and Nakatsu, Impact of forestry on small rodent communities 31 57.5% 0.7% 25.6% 16.2% Plantation C. rufocanus A. argenteus (101,010) C. rutilus A. speciosus Natural F. C. rufocanus (122,653) 0 20 40 60 80 100 Proportion of species (%) Fig. 1. The proportion of rodent species in natural forests and plantations in the Asahikawa region, Hokkaido, Japan. Figures in parentheses indicate the total number of rodents caught during the 31 year census. p<0.001, Sokal and Rolf 1995). The dominancy of C. rufocanus was parti- cularly obvious in plantations. Because C. vutilus was very uncommon, our main analyses are of the other three species. 2. Variation in species abundance Rodent abundance fluctuated greatly from year to year, particularly at two to four year intervals, both in natural forests and in plantations (Figs. 2a, 2b). This pattern may be led by the demographic features of the dominant species, Clethrionomys rufocanus. Basic statistics of population dynamics are given in Table 1. Note that values indicating variability (7.e., CV, s-value, and Max/ Min ratios) were moderated owing to averaging the abundance of rodents on more than 100 census grids. The relative proportion of C. rufocanus was correlated with its abundance, whereas this relationship was not found in other species, with the exception of A. speciosus in plantations (Table 2). These vague relationships among Apodemus species, attributed to the positive correlation in abundance with C. rufocanus, which was most influential on the proportions of the various species (Table 3). Even when the abundance of an Apodemus species increased, it still did not represent a large proportion of the community because C. rufocanus was always even more abundant. The abundances of the three main species were generally correlated with each other in both natural forests and plantations (Table 3). 37 Mammal Study 22: 1997 Table 1. Basic statistics for rodent abundance. Data on C. rutilus was eliminated because of its scarcity. Note that values indicating variability (z.e., CV, Max/Min ratio and s-value) were moderated owing to averaged figures. C. rufocanus A. argenteus A. speciosus Natural forests Average 64g SEG Br Oh) CV 2%) DIN 41.30 62.20 Max. 19.28 IQ Zl 10.40 Min. 1.49 Ley 0.67 Max./Min. 12.95 8.16 42 s-value 0.29 (0), Zul 0.28 Plantations Average 10.69 4.87 Selah CV (%) 53.30 44.10 62.40 Max. DRL, 10.92 9.80 Min. Theeul 1.14 0.63 Max./Min. ea 9.59 1555 s-value 0.31 0222 0.29 Table 2. Relationships between abundance and proportion in the three species are given using Kendall rank-order correlation coefficient t (7=29). Figures in parenth- eses are probabilities of a Type I error for Kendall’s r. C. rufocanus A. argenteus A. speciosus Natural forest ().468 0.094 SAY (0.000) (0.476) (0.099) Plantations 0.429 0.244 OEZT- (0.001) (0.063) (0.037) Species proportions were, however, negatively correlated between C. rufocanus and the two podemus species, whereas a positive relatonship was found between the two Apodemus species (Table 3). Positive correlations between the two Apodemus species, both in abundance and species proportion, indicate that competition between them is probably not severe. Species prop- ortions fluctuted from year to year with some clear patterns revealed by moving averages (Figs. 2a, 2b). C. rufocanus seemed to have gradually lost its dominancy in both natural forests and plantations since the 1980s (Fig. 3a, 3b). In contrant to the decline in C. rufocanus, Apodemus species contributed a steadily increasing proportion of the community in the later years of the study. 3. Species diversity Species diversity values in natural forests fluctuated around 0.7 during the 1960s and early 1970s, increased fro the late 1970s to the early 1980s, and thereafter attained relative stability at 0.8. The change in species diversity in plantations exhibited a very similar pattern to that in natural forests, although 33 Saitoh and Nakatsu, Impact of forestry on small rodent communities a. Natural forests Abundance 1962 1967 1972 1977 1982 1987 1992 Year b. Plantations Abundance Year Fig. 2. Fluctuation of rodent abundance in: a. natural forests and b. new plantations. Abundance is shown as the number of rodents caught per 150-trap night. Lozenge: the total number, solid circle: C. rufocanus, triangle: A. argenteus, square: A. speciosus, and open circle: C. rutilus. 34 Mammal Study 22: 1997 a. Natural forests C. rufocanus A. argenteus Species % | a. - Ca > -B- P . | a- a i | C. rutilus 1962 1967 1972 1977 1982 1987 1992 Year b - Plantations C. rufocanus es N 5 A. argenteus oO (a Va N é 5 Pew | ae K L a. Hi pt etae on, 4 C. rutilus 1962 1967 1972 1977 1982 1987 1992 Year Fig. 3. Changes in rodent species ratios in: a. natural forests, and b. new plantations. Species proportions are shown with moving averages for each three year period. Solid circle: C. rufocanus, triangle: A. argenteus, square: A. speciosus, open circle: C. rutilus. Saitoh and Nakatsu, Impact of forestry on small rodent communities 30 Table 3. Relationships of abundance and proportion between the three species of rodents (C. vufocanus [Cr], A. argenteus |Aa], and A. speciosus [As ]) in the two types of forests are given using Kendall rank-order correlation coefficient rt (z=29). Figures in parentheses are probabilities of a Type I error for Kendall’s rz. Upper matrix for natural forests, lower matrix for plantations. Abundance Proportion OP Aa As OF Aa As Cy = 0.301 0.281 = = Wey) — (0.668 (0.022) (0.032) (0.000) (0.000) Aa O22 = 0.655 —= ert == 0.387 (0.091) (0.000) (0.000) (0.003) As 0.266 0.640 a —(0.699 0.478 re (0.043) (0.000) (0.000) (0.000) the species diversity in plantations was almost always lower than that in natural forests (Fig. 4, Wilcoxon signed-ranks test, Z=—4.249, p<0.0001). Species diversity in natural forests during the latest ten years averaged 0.8, which was significantly higher than during the first ten years (0.7, Random permutation test, )=0.001). A similar significant pattern was also observed in plantations, where species diversity averaged 0.6 in the first decade, and 0.8 in the latest (Random permutation test, /=0.0012). 4. Species diversity and forestry Extensive forest planting took place during the 1960s and early 1970s in Hokkaido. More than one percent of natural forests (more than 7,000 ha) were felled, and coniferous seedlings were planted on the clear-cuts within a year. Since the 1970s, however, planting effort has decreased (Fig. 4). The pattern of planting has been closely followed by the proportion of the small rodent community contributed by C. rufocanus (Fig. 3). The proportion of C. rufocanus was highly correlated with the area of new plantations (Kendall’s r= 0.897, 6<0.001 for natural forests ; r=0.566, )<0.001 for plantations). DISCUSSION The gray-sided vole, C. rufocanus, was found to be the most abundant small rodent in both natural forests and plantations (Fig. 1). Its dominancy was most obvious in plantations. The young plantations, where the censuses were carried out, were open and herb-dense habitats and the preferred habitat of C. rufocanus in Hokkaido (Ota 1984). Thus, the dominancy of C. rufocanus in plantations is consistent with previous studies (Ota et al. 1977, Ota 1984). The present results, indicating that C. rufocanus contributed over 50% of small rodent communities even in natural forests, should, however, be noted. Previ- ous studies have indicated that either A. argenteus, or A. speciosus is usually 36 Mammal Study 22: 1997 100 Plantation area J' in natural forest 60 Species diversity (J' ) Plantation area (x 100 ha) 20 ” 1962 1967 1972 1977 1982 1987 1992 Year Fig. 4. Changes in rodent species diversity and in the area of new plantations. The Shannon- Wiener function (index of evenness, J’) was used as an index for species diversity. Species diversity is shown with moving averages for each three year period. Circle: species diversity in natural forests, triangle: species diversity in plantations, square: new plantation area. dominant in mature natural forests, even though C. rufocanus is also common there (Ota et al. 1977, Ota 1984). The extensive areas of plantation contiguous with the natural forests studied here may have led to the increased proportion of C. rufocanus in natural forests. The prominent dominancy of C. rufocanus caused species diversity to be low during the 1960s and early 1970s (Figs. 3, 4). Thereafter, as the proportion of C. rufocanus decreased, species diversity increased. These changes were consistent with changes in forestry planting effort. These findings suggest that monocultural habitats, such as forestry plantations, may support a super dominant species (in this case C. rufocanus), which suppresses species diversity in the rodent community. The censuses were carried out continuously on the same types of habitats (on young plantations and on natural forests neighbouring plantations) through- out the study period. Thus the decrease in the relative proportion of C. rufocanus was not caused by environmental changes on census grids. The present results should, therefore, reflect changes in rodent communities in more extensive areas than just on census grids; thereby indicating that long-term, extensive forestry practices may simplify the rodent community not merely in the plantations themselves but also in the natural forests surrounding large scale plantations. Nakatsu (1988, 1992) has also reported changes in species proportion based Saitoh and Nakatsu, Impact of forestry on small rodent communities Sit on the same census data that we analyzed; he did not analyze the data as a time-series, but his data set, however, covered all regions of Hokkaido. Although Nakatsu (1988, 1992) also found a significant reduction in the propor- tion of C. rufocanus in the Asahikawa region, he did not find such a reduction in either Kitami or Obihiro regions, where planting efforts were also decreasing during the 1980s. A clear relationship between rodent communities and forestry plantations was revealed in this study. We do not think that this relationship is super- ficial, and believe that extensive forestry planting may simplify the rodent community on a large scale. The present analyses are not robust enough, however, to prove this, because different types of rodent population fluctua- tions were pooled in this study (see Bjérnstad et al. 1996), and because this study tells nothing about the regional differences in species proportion that Nakatsu (1988, 1992) observed. To resolve these problems more detailed analyses are required. Dedication: We dedicate this paper with great appreciation to Professor Hisashi Abe, on his retirement from Hokkaido University in 1997. His work has been a great inspiration to us. Acknowledgements: We are indebted to: the Japanese Forestry Agency for providing the material analysed here, Shigeru Matsuoka and Noritomo Kawaji for their kind help in gathering related references, Hisashi Abe for his invalu- able comments on our manuscript, and Mark Brazil for improving the English. REFERENCES Bjgrnstad, O. N., S. Champely, N.C. Stenseth and T. Saitoh. 1996. Cyclicity and stability of grey- sided voles, Clethrionomys rufocanus, of Hokkaido: spectral and principal components ana- lyses. Phil. Trans. R. Soc. Lond. B 351 : 867—875. Fujimaki, Y. 1970. An avifaunal study in different types of forests in the central part of Hokkaido, Japan. Bull. Hokkaido For. Exp. Stn. 8: 42—51 (in Japanese with English abstract). Hansson, L. 1985. Clethrionomys food: genetic, specific and regional characteristics. Ann. Zool. Fenn. 22:315—318: Hansson, L. 1994. Vertebrate distributions relative to clearcut edges in a boreal forest landscape. Landsc. Ecol. 9: 105—111. Ishigaki, K. and S. Matsuoka. 1972. Birds in the Tomakomai experiment forest of Hokkaido University No.1. Species and diversity in a temperate broad-leaved forest and conifer plantations in summer. Res. Bull. Col. Exp. For. Col. Agr. Hokkaido Univ. 29:43—54 (in Japanese with English abstract). Ishigaki, K., S. Matsuoka and I. Ogawa. 1973. Birds in the Tomakomai experiment forest of Hokkaido University No.2. Species and relative abundance in a temperate broad-leaved forest and conifer plantations in winter. Res. Bull. Col. Exp. For. Col. Agr. Hokkaido Univ. 30 :55—68 (in Japanese with English abstract). Kobayashi, S. and Y. Fujimaki. 1985. Breeding bird communities in a deciduous broad-leaved wood and a larch plantation. Tori 34:57—63 (in Japanese with English abstract). Krebs, C. J. 1989. Ecological Methodology. Harper Collins, New York, 654 pp. Meffe, G. K. and C.R. Carrol. 1994. Principles of Conservation Biology. Sinauer Associates, Inc. Sunderland, 600 pp. 38 Mammal Study 22: 1997 Murai, H. and H. Higuchi. 1988. Factors affecting bird species diversity in Japanese forests. Strix 7:83—100 (in Japanese with English abstract). Nakatsu, A. 1988. Changes in the composition of wild murid rodents captured in Asahikawa Regional Forest Sub-Office area. Trans. Meeting. Hokkaido Branch. Jap. For. Soc. 36: 134— 136 (in Japanese). Nakatsu, A. 1992. The present status and issues of vole damage to forests accompanied with the changes in plantation condition, especially in the national forests of Hokkaido. Forest Pests 41:9—12 (in Japanese). Ota, K. (ed.) 1984. Study on Wild Murid Rodents in Hokkaido. Hokkaido University Press, Sapporo, 400 pp (in Japanese). Ota, K., H. Abe, T. Kobayashi, Y. Fujimaki, S. Higuchi, B. Igarashi, T. Kuwahata, M. Maeda, M. Ueda and T. Takayasu. 1977. A synecological study of murid rodents. Res. Bull. College Exp. For. College Agr. Hokkaido Univ. 34: 119—160 (in Japanese with English abstract). Saitoh, T. 1987. A time series and geographical analysis of population dynamics of the red-backed vole in Hokkaido, Japan. Oececologia. 73 : 382 —388. Saitoh T., N.C. Stenseth and O. N. Bjgrnstad. 1997. Density dependence in fluctuating grey-sided vole populations. J. Anim. Ecol. 66: 14—24. Sokal, R. R. and F. J. Rolf. 1995. Biometry, 3rd ed. W.H. Freeman and Company, New York, 887 pp. Stenseth, N.C, O. N. Bjgrnstad and T. Saitoh. 1996. A gradient from stable to cyclic populations of Clethrionomys rufocanus in Hokkaido, Japan. Proc. Roy. Soc. Lond. B 263: 1117-1126. Tatewaki, M. 1958. Forest ecology of the islands of the north pacific ocean. J. Fac. Agr. Hokkaido Univ. 50: 371—472. Yui, M. and Y. Suzuki. 1987. The analyses of structure of the woodland bird communities in Japan IV. Density, species diversity and diversity of breeding community in various forest types. J. Yamashina Inst. Ornith. 19:13—27 (in Japanese with English abstract). (accepted 29 January 1997) Mammal Study 22: 39-44 (1997) © the Mammalogical Society of Japan Short Communication Growth of eye lens weight and age estimation in the northern red-backed vole, Clethrionomys rutilus Kenichi TAKAHASHI and Kei SATOH Hokkaido Institute of Public Health, N19 W12 Kita-ku, Sapporo O60, Japan Fax. +81-11-736-9476, e-mail. takaken@iph. pref. hokkaido. jp Age determination is a basic requirement when analyzing the ecological events affecting wild animals. Several useful methods for age determination have been reported for small rodents (see Pucek and Lowe 1975). Tooth wear patterns and the molar root ratio have often been used to assess the ages of Japanese rodents (Abe 1976, Fujimaki et a@/. 1976, Fujimaki 1977, Hikida and Murakami 1980). Furthermore, since Lord (1959) proposed a method of age determination using the eye lens weight (ELW) in cottontail rabbits, Lepus americanus, it has become well-known that ELW can also be employed as an age criterion in various species of Rodentia (Ostbye and Semb-Johansson 1970, Gourley and Jannett 1975, Hagen et al. 1980, Thomas and Bellis 1980, Ando and Shiraishi 1997 for the subfamily Microtinae, and Berry and Truslove 1968, Adamczewska-Andrzejewska 1973, Yabe 1979, Okamoto 1980, Takada 1982, Hardy et al. 1983, Takada 1996 for the subfamily Murinae). It is considered that the ELW method of age estimation is more accurate than any other technique relying on body or skull measurements (Pucek and Lowe 1975). Moreover, this method has the advantage that it can be used for species which have rootless molars such as Eothenomys smithi (Ando and Shiraishi 1997). The growth of the molar roots of the northern red-backed vole, Cleth- rionomys rutilus was examined as an indicator of absolute age by Tupikova et al. (1968), and the relationship between lens weight and age was analyzed using Specimens captured in the field (Askaner and Hansson 1967), however, no previous data on the growth patterns of eye lens from known-age individuals have been reported for this species. An accurate method for age determination is of value not only for ecologi- cal studies of C. rutilus itself, but also for analysis of the transmission pattern of a zoonosis in a natural population. The latter is of particular significance because C. vutilus is one of the favorable intermediate hosts of Echinococcus multilocularis, a parasitic organism causing the serious disease alveolar echinococcosis in humans, which has been found in Hokkaido, Japan (Takaha- shi and Nakata 1995). The purpose of the study described here, therefore, was to establish an age estimation equation by analyzing the relationship between the growth in eye lens weight and age in a population of known-age laboratory-reared northern 40) Mammal Study 22: 1997 red-backed voles. MATERIALS AND METHODS A total of 197 voles (91 males and 106 females) from a laboratory colony originating from wild voles captured in Sapporo, Hokkaido were used in this study. The laboratory colony was maintained under regulated conditions at a temperature of 23-25°C a 12 hour light and 12 hour dark photoperiod and fed a commercial diet (CMF, Oriental Yeast Co. Ltd.). Voles were reared individ- ually in mouse cages except for during breeding. Male voles ranged in age from 15 to 596 days, and females from 15 to 581 days. Voles were killed with ethyl ether, their eyes were dissected out and fixed in 10% formalin at room temperature for at least four weeks, then the optic lenses were excised and washed with distilled water. Lenses were dried in an oven at 80°C for 24 hours and immediately weighed to the nearest 0.01 mg on a microbalance (Mettler, AT201). RESULTS AND DISCUSSION Lens weight was found to increase rapidly up to about day 50 and then the growth rate decreased gradually in both males and females (Fig. 1), as has also been noted for Lemmus lemmus (Ostbye and Semb-Johansson 1970). In this study, ages were selected non-randomly and measured without error. For this reason, in the regression analysis of this data, age is the independent variable and lens weight the dependent variable with lens weight regressed on age (Hagen et al.1980). Ages were logarithmically transformed, because the growth pattern of lens weight was found to be curvilinear in C. rutilus (Fig. 1). 8 3 8 — 7 £ . 3 e° © e $ ¢ e E 6] oc cides ad ®@ acs dey Ts ‘ °y, ee e a 5 we 3 2 ging 3 4 . = Female 2 re (ey) Oo S 0 100 200 300 400 500 600 700 0 100 200 300 400 500 600 700 Age in days Fig. 1 Growth of the eye lens weight in 91 male and 106 female northern red-backed voles, Clethrionomys rutilus. Age estimation in Clethrionomys rutilus 4] Female Y=-1.322+2.939X r2 =0.908 Weight s of paired eye lenses (mg) yb oO PP UW OD N @ yb © PB HT OD NI Oo 10 100 1000 days (log) Fig.2 Relationship between log-transformed ages and eye lens weight in the northern red-backed vole, Clethrionomys rutilus. Moreover, array variance must be of equal magnitude along the length of the line (homoscedasticity) in the regression analysis (Dapson 1980), and homo- scedasticity was confirmed with the graphs showing residuals plotted against Y; (the Y value on the line X;) for both sexes. The simple linear regression relationship (Y =a+ bX) between X (age in days after logarithmic transform- ation) and Y (lens weight) was applied (Fig. 2). Regression equations from our data from C. rutilus were: CD a— eds 3 000X. (72 —029355 p< 0e001) ton males Qe —— 1h 322--2 .939X 1(72=0. 908) p< 0.001) for females where Y =weight of paired lenses in mg, X =logiox, and x=age in days. There were no significant differences in regression slopes between males and females (F-test, Foa;=0.24, Fo.05(1,193) = 3.89, D> 0.05) (Table 1). Age was predicted inversely from either equation (1) or (2), and predicted age was given by the equation: K=10°¥ +1.433)/3.000 for males K=]10°Y +1322) /2.939 for females The equation of the 95% confidence limits (L) for the inverse prediction is given as follows: Table 1. Statistics on the regression lines between the age and eye lens weight in the northern red-backed vole, Clethrionomys rutilus. Sex n a b Y ax iY S yx SSx t Male 91 SASS OOO M ORI OVe= 25004 = a45760) OnS82a20 O38 BIE98 7 Female 106 32, 2839 0.953 Aol A.V Wee4o Aileos) ess nm: number of samples, a: Y intercept, 0: slope, 7: correlation coefficient, X : mean of X, Y : mean of Y, Syx: standard error of estimate, SSx : sum of squared deviations of X, t: Sitidentsses) (aj0— a2) P0105): 42 Mammal Study 22: 1997 PER yh Y) +t) s9) ee a)? +K(444)| mM nN where X =the mean of X, Y =the mean of Y, K =b?—#?S,?, t=Student’s ¢ (d. fi=n—2, p=0.05), S,=the standard error of the regression coefficient, S?yx= the residual mean square, SSx =the sum of squared deviations of X, m=sample size, and m=the number of individuals upon which predictions will be based. Here, when m=0°, L indicates the confidence limits of the mean prediction for the population. On the other hand, when m=1, L indicates the confidence limits of the individual prediction (Dapson 1980, Sokal and Rohlf 1981). When estimating the ages of individual animals, Dapson (1980) pointed out the importance of presenting the 95% confidence limits, as the confidence interval indicates the accuracy of an estimate of age for each specimen, and the confidence interval for the individual prediction is generally broader than that for the population. This certainly proved to be the case in C. rutilus (Tables 2 and 3). In this study, broader ranges in the 95% confidence interval were observed among older animals because of the wide variance of lens weight and the decrease in the growth rate in these older animals (Fig. 1). Askaner and Hansson (1967) examined the relation between ELW and molar root length of wild-caught C. rutilus, and pointed out the usefulness of the ELW method for aging individuals of this species. The present study provides, for the first time, an equation for age estimation based on ELWs of known-age voles. Tupikova ef al. (1968) developed an age determination Table 2. Predicted ages and confidence limits (95 %) for the mean and individual predictions at given lens weights in the male northern red-backed vole, Clethrionomys rutilus. Lens weight Predicted Mean predictions Individual predictions (mg) age in days Lower age limit Upper age limit Lower age limit Upper age limit 5 9 8 UL 5 Mi) De) 20 18 2 11 Si 315 44 40) 48 24 79 45 95 89 101 58 il 55 205 191 219 114 369 O.5 442 402 487 245 799 Table 3. Predicted ages and confidence limits (95 %) for the mean and individual predictions at given lens weights in the female northern red-backed vole, Clethrionomys rutilus. Lens weight Predicted Mean predictions Individual predictions (mg) age in days [Lower age limit Upper age limit Lower age limit Upper age limit 1,5 9 d 10 4 18 ee) 19 17 22, 10 38 345 43 39 47 22 83 4.5 94 88 100 48 182 55 205 191 221 105 400 6.5 451 406 002 230 883 Age estimation in Clethrionomys rutilus 43 method for C. rutilus using the length of the root and the height of the crown of M?, however, since the neck of M? in this species is not formed until three months old, the ages of young voles under two months old cannot be predicted by this method. The present results show that the ELW technique is capable of estimating age in this species, especially in younger voles. For application of this technique to field studies, however, we must pay attention to the wide confidence interval in older voles. Acknowledgments : We wish to express our cordial thanks to Professor Hisashi Abe of Hokkaido University for his valuable advice on this manuscript, and we dedicate this paper to him in celebration of his retirement from Hokkaido University. We are also extremely grateful to Dr. Takashi Saitoh of Hokkaido Research Center, Forestry and Forest Products Research Institute and Dr. Akiro Ando of Shimane Prefectural Shimane Women’s College for their kind comments and encouragement during this study. REFERENCES Abe, H. 1976. Age determination of Clethrionomys rufocanus bedfordiae (Thomas). Jap. J. Ecol. 26: 221—227 (in Japanese with English synopsis). Adamczewska-Andrzejewska, K. 1973. Growth, variations and age criteria in Apodemus agrarius (Pallas, 1771). Acta Theriol. 18,19 : 353—394. Ando, A. and S. Shiraishi. 1997. Age determination in the Smith’s red-backed vole Eothenomys smithiz, using optic lens weight. Mammal Study 22:xx—xx. Askaner, T. and L. Hansson. 1967. The eye lens as an age indicator in small rodents. Oikos 18: 151— 1533 Berry, R. J.and G. M. Truslove. 1980. Age and eye lens weight in the house mouse. J. Zool., Lond. ae ZAi— 252. Dapson, R. W. 1980. Guidelines for statistical usage in age-estimation technics. J. Wildl. Manage. 44: 541—548. Fujimaki, Y., S. Mizushima and H. Dewa. 1976. Age determination in two species of Apodemus. Jap. Je col. 26 : 19= 23: Fujimaki, Y. 1977. Age determination, growth and development in Apodemus argenteus. Mammal. SOino 4: 2029. Gourley, R.S. and F. J. Jannett. 1975. Pine and montane vole age estimates from eye lens weights. J. Wildl. Manage. 39 : 550—556. Hardy, A. R., R. J. Quy and L. W. Huson. 1983. Estimation of age in the Norway rat (Rattus norvegicus Berkenhout) from the weight of the eye lens. J. Appl. Ecol. 20:97—102. Hagen, A., N.C. Stenseth, E. Ostbye and H. J. Skar. 1980. The eye lens as an indicator in the root vole. Acta Theriol. 25 : 39—50. Hikida, T.and O. Murakami. 1980. Age determination of the Japanese wood mouse, Apodemus speciosus. Jap. J. Ecol. 30:109—116 (in Japanese with English synopsis). Lord, R.D. 1959. The lens as an indicator of age in cottontail rabbits. J. wildl. Manage. 23 : 350—360. Ostbye E. and A. Semb-Johansson. 1970. The eye lens as an age indicator in the Norwegian lemming (Lemmus lemmus (L.)). Nytt. Mag. Zool. 18 : 239—243. Okamoto, K. 1980. Age determination by eye lens weight in the Norway rat. Jap. J. Sanit. Zool. 31: 193—200 (in Japanese with English summary). Pucek, Z. and Lowe. V. P. W. 1975. Age criteria in small mammals. Jv (F. B. Golley, K. Petrusewicz and L. Ryskowski, eds.) Small Mammals: Their Productivity and Population Dynamics. pp. 59—72. Cambridge University Press, Cambridge. 44 Mammal Study 22: 1997 Sokal, R. R. and F. J. Rohlf. 1981. Biometry (2nd ed.). W. H. Freeman, New York. 859pp. Takada, Y. 1982. Life history of small mammals in fallow fields. 2. The eye lens weight as an age indicator in the feral house mouse, Mus musculs molossinus. Seichou (J. Growth) 21:1—7 (in Japanese with English summary). Takada, Y. 1996. Eye lens weight as an age indicator in the harvest mouse, Micromys minutus and age structure of wild populations. J. Mammal. Soc. Japan 36: 45—52. Takahashi, K. and K. Nakata. 1995. Note on the first occurrence of larval Echinococcus multilocularis in Clethrionomys vex in Hokkaido, Japan. J. Helminthol. 69 : 265—266. Thomas, R.E. and E. D. Bellis. 1980. An eye-lens weight curve for determining age in Microtus pennsylvanicus. J. Mammal. 61 : 561—563. Tupikova, N.V., G. A.Sidorova and E. A. Konovalova. 1968. A method of age determination in Clethrionomys. Acta Theriol. 13 :99—115. Yabe,T. 1979. Eye lens weight as an age indicator in the Norway rat. J. Mammal.Soc. Japan 8: HB), (accepted 24 October 1997) Mammal Study 22: 45-52 (1997) © the Mammalogical Society of Japan Age determination in the Smith’s red-backed vole, EKothenomys smithii, using optic lens weight Akiro ANDO! and Satoshi SHIRAISHI? ‘Department of Food Science, Shimane Prefectural Shimane Women’s College, Matsue 690, Japan Fax. ta 81'-852-21-8150 2Zoological Laboratory, Faculty of Agriculture, Kyushu University 46-06, Fukuoka 812-81, Japan Abstract. A technique for age determination based on the dry weight of the optic lens was tested in Smith’s red-backed vole, Eothenomys smithi. The model equation W=a+t+bdlog,A (W: lens weight in mg, A: age in days, @ and b: parameters to be estimated from data) was applied to our data from 65 known-age laboratory-reared voles. As a result, the predicted age in days (A) at a_ given lens weight (W) could be calculated from the equation A=10'" *1419)/2131 For example, an individual with a lens weighing 3.22 mg was estimated as having a predicted age of 150 days, and the 95% confidence interval at 150 days was calculated to be 17 days (142-159 days, or 11.3% of the predicted age) for the mean prediction and 144 days (94-238 days, or 96.0% of the predict- ed age) for the individual prediction. Lens weight can, it appears, provide the best age criterion at present, particularly in rodents with rootless molars such as E. smithiz. Key words: age determination, EKothenomys smithiz, lens weight, Microtinae, red-backed vole. i Information concerning age is a very important aspect of ecological studies of wild animals. Many methods for age estimation have been proposed and used in various mammalian species (see Morris 1972 for review). Among the various methods available, the lens weight technique has been evaluated as a useful and powerful technique in small to medium-sized mammals, such as rodents (Hagen et al.1980 for Microtus oeconomus, Okamoto 1980 for Rattus norvegicus, Tanikawa 1993 for Rattus rvattus, Takada 1982a for Mus musculus molossinus, Takada 1982b for Apodemus speciosus), and lagomorphs (Load 1959 for Sylvilagus floridanus, Dudzinski and Mykytowycz 1961 for Oryctolagus cuniculus, Connolly et al. 1969 for Lepus californicus, Bothma et al. 1972 for S. floridanus, Hearn and Mercer 1988 for Lepus arcticus, Ando et al. 1992 for Lepus brachyurus). Smith’s red-backed vole, Eothenomys smithii, of the subfamily Microtinae, is endemic to Japan, where it occurs widely in forested areas of Kyushu, Shikoku, and western and central Honshu (Kaneko 1992). In contrast to the Japanese gray red-backed vole, Clethrionomys rufocanus bedfordiae (Abe 1976) and the large Japanese field mouse A. speciosus (Hikida and Murakami 1980), 46 Mammal Study 22: 1997 neither the molar root ratio, nor the molar wear pattern, can be employed as an age criterion in FE. smithiz, since its molars are rootless and grow persistently. No information has been available on age estimation in E. smithiz. For the experiment described here, age was estimated for individual E. smithiz, based on the optic lens weight of known-age individuals, using statistical treatments recommended by Dapson (1980). MATERIALS AND METHODS 1. Lenses The Eothenomys smithit used for this study were obtained from a labora- tory colony which originated from wild voles live-trapped on Mt. Wakasugi in Fukuoka Prefecture, northern Kyushu. The colony was maintained under controlled conditions, 7.e., temperatures of 15-20 °C and photoperiods of 12-13 hr light: 12-11 hr dark (Ando et al.1988). A total of 65 voles (33 males, 32 females) ranging in age from 20 to 600 days were killed with ethyl ether. Both right and left eyes were dissected out and placed individually in 10% formalin for two to three weeks, then the optic lenses were carefully removed. After being rinsed with distilled water, the lenses were dried at 80 °C for two days and weighed to the nearest 0.01 mg on an analytic balance (Mettler AE-100). The combined dry weight of both right and left lenses of each individual vole was used for statistical analysis (Table 1). Table 1. The combined lens weight of the right and left eyes in 65 known-age Smith’s red-backed voles, Eothenomys smithit. Age Lens weight Age Lens weight Age Lens weight (days) (mg) (days) (mg) (days) (mg) 20 1eZ9 140 334116) 259 Sar) 20 LoS? 140 3) core) ZOD) 3.80 20 SH 142 2.98 255 3.60 aD Lea 160 D5 /49 258 3.94 a7, 1.92 160 3.08 282 3.80 BY 1.84 160 3) 5 AS) 282 3.90 38 Loos 160 2.85 282 3.80 43 eyes) 160 3 Jha! 300 aecill 44 Dent 176 3.48 300 4.18 44 7) 50) 180 ZZ, 300 4.03 44 eM 180 3.80 350 wy DL 50 Df 180 B sO 350 4025 50 2.06 180 SAS 400 4.00 60 Zijiy MO) 200 3.44 468 bbe 70 1 S$) 200 BLAS) 900 4.60 80 Zea0, 200 3.00 990 4.00 100 2.61 200 D2) 990 AR, 105 3) 5 A! 200 3.36 600 4.40 120 2.69 200 Oe 600 Aa, 120 2.92 214 3.50 600 4.44 140 S02 236 3.43 600 AaAN 140 3.36 250 3.78 Age determination in a red-backed vole A7 2. Statistical procedure The mathematical model for the relationship between lens weight (W) and age in days (A) pioneered by Hagen e¢ a/. (1980) and Takada (1982a, 1982b) was used for this study, 7.é., WV = GOO“! (1) where a and 0 are parameters to be estimated from the data set. Here, when we define W=Y and log,A=X in this model, the equation (1) could be Y = a+ bX, thereby, making linear regression analysis available for the relation- ship between Y (lens weight) and X (age in days after logarithmic transforma- tion). In the regression analysis, data of X and Y should exhibit homoscedas- ticity (Dapson 1980, Zar 1984), which we confirmed for our data in accordance with Zar’s (1984) procedure. The linear regression equation Y =a+6X refers to the regression of Y (the dependent variable) on X (the independent variable). When estimating age using dry lens weight, the lens weight (W) should be regressed on age (A) (Ishii 1975, Hagen et al. 1980, Zar 1984). Therefore, a predicted age X, fora given lens weight Y, and the confidence limits of X; should be calculated on the basis of the procedure known as inverse prediction (Dapson 1980, Zar 1984). Using this procedure, the predicted X; at a given Y; is given by the equation a Neo) Aisi pw and the confidence limit L (L,, the upper limit; L,, the lower limit) is calculated from the equation ibe eT, pGG=s4) iy 2 (Y,—Y)? ik it pk sey Sol KG tT) where X =the mean of X, Y =the mean of Y, K =6?— ??s,?, s,=the standard error of the regression coefficient, S}x=the residual mean square, SSx=the sum of squared deviations of X, t=Student’s ¢t (df=n-2, p=0.05), and n= sample size (Dapson 1980, Zar 1984). When m=co, L indicates the confidence limits of the mean prediction for the population, and when m=1, L represents the confidence limits of the individual prediction (Dapson 1980). For the purposes of this study, X and L have been logarithmically transformed, so that 10*: gives the predicted age in days and 10” gives its confidence limits. In this study, data from both males and females were combined for the regression analysis since no significant difference was detected in the slope and elevation of the regression line between males and females. As for the figure showing the regression line with 95% confidence limits (see Fig. 1), we followed the presentation of Hagen ef a/. (1980). Although lens weight was regressed on age, we used the ordinate for the independent variable (age) and the abscissa for the dependent variable (lens weight) because the age was predicted by inverse prediction. 48 Mammal! Study 22: 1997 RESULTS AND DISCUSSION The regression line and its 95% confidence limits for the individual predict- ion are shown in Fig.l. The linear regression equation from our data in Eothenomys smithit was proved to be W =—1.4154+2.131 logy.A and therefore a predicted age in days (A) for a given lens weight in mg (W) was given by the equation A — ] QW +1.415)/2.131 The slope and Y intercept of the regression line, and statistics necessary for calculating the confidence limit are presented in Table 2. Table 2 also includes comparable information from the root vole, Microtus oeconomus (Hagen et al. 1980), the feral house mouse, M. m. molossinus (Takada 1982a) and the large Japanese field mouse, Apodemus speciosus (Takada 1982b). days 2000 1000 ® ™ 100 < 10 1 2 3 4 5 Lens weight Fig. 1. The relationship between the dry weight of the optic lenses (both the right and left lenses combined) and age in days in 65 known-age Smith’s red-backed voles, Eothenomys smithii. The solid line indicates the regression line, and broken lines its 95% confidence limits for the individual prediction based on inverse prediction. Note that the vertical axis was used for the independent (age) variable, and horizontal axis for the dependent (lens weight) variable, although lens weight was regressed on age. Age determination in a red-backed vole 49 Table 2. Statistics required for calculating the predicted ages and 95 % cofidence limits of the Smith’s red-backed vole, Eothenomys smithii, the root vole, Microtus oeconomus, the feral house mouse, Mus musculus molossinus, and the large Japanese field mouse, Apodemus speciosus. species n a b ry x 7 Syx Syx/Y SSx t E. smithit 6oy lr415 Zee Of ey Zee sie2zo SObZISeeOPOCGORMOS20h 21-998 This study M. oeconomun SI SE 41S) Oss ILS S08 OO 0.0400 2.886 2.045 Hagen et al. (1980) M. m. molossinus (Beek else OL 916) 1 994 Me >eZ8ile e856. 020600 102608 12994 Takada (1982a) A. speciosus 1A (Aelita) 98S a Ms orewl4 2625) s0nSOre 005495) 1230 2179 Takada (1982b) n: sample size,a: Y intercept, b: slope, 7: correlation coefficient, X : mean of X, Y : meanof Y, Syx : standard error of estimate, SSx: sum of squared deviations of X, ¢: Student’s ¢ (da f=n—2, p=0.05). Dapson (1980) and Zar (1984) both recommended the presentation of Syx/ Y (the standard error of estimate (Syx) divided by the mean of Y (Y)), as an indicator for assessing the fitness of the regression and the accuracy of the technique. Smaller values of Syx/Y indicate better fitness of the regression. The value of Syx/Y for E. smithii (0.0660) is very close to that for M. m. molossinus (0.0677) (Takada 1982a), but larger than the values for either /. oeconomus (0.0400) (Hagen et al. 1980) or A. speciosus (0.0549) (Takada 1982b). When studies, which have used the regression analysis for age estimation, are compared (e.g., those on M. oeconomus [Hagen et al. 1980], M. m. molossinus [Takada 1982a], A. sbeciosus [Takada 1982b], S. floridanus [Load 1959], L. californicus [Connolly et al.1969], L. arcticus [Hearn and Mercer 1988] and L. brachyurus | Ando et al.1992]), Syx/Y is found to range from 0.0400 to 0.0823 (calculated by us). It is accordingly inferred that when the regression line fits the data well, Syx/ Y may be smaller than ca. 0.083 in small to medium-sized mammals such as rodents and lagomorphs. Since the value for E. smzthiz (0.0660) falls within the middle of this range, it can be said that our data from FE. smithi fit the model equation (1) well. Confidence intervals also indicate the accuracy of estimates derived from an age determination technique (Dapson 1980). Table 3 shows the predicted age (A) ata given lens weight (W), its 95% confidence limits for the mean prediction and that for the individual prediction in E. smithiz. The 95% confi- dence interval for the mean prediction at the mean of X (z.e., X =2.1769, the predicted age of 150 days) was calculated to be 17 days, occupying 11.3% of the predicted age (150 days). Similar figures have also been obtained for /. oeconomus (8.0%, Hagen et al. 1980), for M. m. molossinus (10%, Takada 1982a) and for A. speciosus (15%, Takada 1982b). In E. smithiz, the 95% confidence interval (144 days) for the individual prediction, at the mean of X, occupied 96.0 % of the predicted age (150 days). The corresponding figure for M. oeconomus is 48 % (Hagen et al. 1980), for M. m. molossinus 83 % (Takada 50 Mammal Study 22: 1997 Table 3. 95 percent confidence limits of predicted ages (A) for the Smith’s red-backed vole, Eothenomys smithit. ; Mean predictions Individual predictions Lens weight Age Ss W (mg) A (days) Lower age Upper age Lower age Upper age limit (days) limit (days) limit (days) limit (days) 36 20 iy 23 12 Sy 1608 30 Dil 33 19 48 2.20 50 46 54 31 80 Day? 70 66 77 45 114 2.85 100 94 106 63 159 S22 150 142 159 94 238 3.49 200 189 ALS 126 318 3.86 300 280 323 189 479 4.04 365 338 397 230 584 4.13 400 369 437 Za 641 AOS) 500 466 563 320 820 4.50 600 044 669 376 967 1982a) and for A. speciosus 55% (Takada 1982b). The 95% confidence interval for E. smithit was similar for the mean prediction, but was slightly broader for the individual prediction, when compared with the three other species. Although the confidence limits are influenced by various factors, such as sample size, the degree of dispersion of data, the mean of X and so on, increas- ing the sample size may be one possible way to improve the accuracy of age estimation of FE. smithiz. The combined dry weights of both right and left lenses from 52 wild E. smithii captured on Mt. Wakasugi ranged from 1.95 to 4.49 mg (Ando unpub- lished data). From the equations defined above, a vole with a maximum lens weight of 4.49 mg would be estimated to be 591 days old, with the 95% confi- dence limits giving a range of 371 to 952 days for the individual prediction. About 80% of the voles (41/52) possessed lenses weighing below 4.04 mg indicat- ing 365 days of a predicted age. Although there have been some field studies on population dynamics of E. smithi (Tanaka 1964, Igarashi 1980), no informa- tion has been available on the longevity of individuals in the wild, for instance, based on the capture-recapture method. Judging from the existence of voles with lenses weighing over 4.04 mg, it would appear, however, that some individ- uals in the wild could survive for over one year. In the laboratory, E. smithi has been known to live for more than three years (Ando et a/. 1988). Field studies, in combination with the lens weight technique, are necessary in order to confirm the usefulness of the technique, especially in older voles. Researchers on rodents have typically used wear of the tooth surface, and the length or the ratio of molar roots to determine age (Abe 1976 for Cleth- rionomys rufocanus bedfordiae, Hikida and Murakami 1980 for Apodemus speciosus, Alibhai 1980 for Clethrionomys glareolus). These methods, however, Age determination in a red-backed vole ol can only be employed in rodents which have rooted molars, and Takada (1982a, 1982b) has already demonstrated that even in M. m. molossinus and A. speciosus which have rooted molars, the lens weight technique may be more reliable than the technique depending on the tooth wear. It should be emphasized, therefore, that the lens weight technique provides the best criterion for assessing age at present, particularly in rodents with rootless molars such as E. smithiz. Acknowledgments: We wish to thank Professor Yoshihira Yamamoto, Shimane Prefectural Shimame Women’s College for his encouragement and Associate Professor Caroline E. Kano, Shimane Prefectural Shimame Women’s College for her kindly checking an English draft. We are also grateful to anonymous referees and Mark A. Brazil for valuable comments on the final manuscript. REFERENCES Abe, H. 1976. Age determination of Clethrionomys rufocanus bedfordiae (Thomas). Jap. J. Ecol. 26: 221—227 (in Japanese with English synopsis). Alibhai, S. K. 1980. An X-ray technique for ageing Bank voles (Clethrionomys glareolus) using the first mandibular molar. J. Zool., Lond. 191 : 418—423. Ando, A., S. Shiraishi and T. A. Uchida. 1988. Reproduction in a laboratory colony of the Smith’s red-backed vole, Eothenomys smithit. J. Mammal. Soc. Japan 13: 11—20. Ando, A., F. Yamada, A. Taniguchi and S. Shiraishi. 1992. Age determination by the eye lens weight in the Japanese Hare, Lepus brachyurus brachyurus and its application to two local populations. Sci. Bull. Fac. Agr., Kyushu Univ. 46:169—175 (in Japanese with English sum- mary). Bothma, J. P., J.G. Teer and C. E. Gates. 1972. Growth and age determination of the cottontail in South Texas. J. Wildl. Manage. 36: 1209—1221. Connolly, G. E., M. L. Dudzinski and W. M. Longhurst. 1969. The eye lens as an indicator of age in the black-tailed jack rabbit. J. Wildl. Manage. 33: 159—164. Dapson, R. W. 1980. Guidelines for statistical usage in age-estimation technics. J. Wildl. Manage. 44: 541—548. Dudzinski, M. L. and R. Mykytowycz. 1961. The eye lens as an indicator of age in the wild rabbit in Australia. CSIRO Wildl. Res. 6: 156—159. Hagen, A., N.C. Stenseth, E. Ostbye and H.-J.Skar. 1980. The eye lens as an indicator in the root vole. Acta Theriol. 25: 39—50. Hearn, B. J.and W.E. Mercer. 1988. Eye-lens weight as an indicator of age in Newfoundland arctic hares. Wildl. Soc. Bull. 16 : 426—429. Hikida, T.and O. Murakami. 1980. Age determination of the Japanese wood mouse, Apodemus speciosus. Jap. J. Ecol. 30:109—116 (in Japanese with English synopsis). Igarashi, Y. 1980. Studies on the population fluctuation of the Smith’s red-backed vole, Eothenomys smithi (Thomas), in young plantations of Sugi and Hinoki in the central highlands of Shikoku. Bull. For. & For. Prod. Res. Inst. (311): 45—64 (in Japanese with English summary). Ishii, S. 1975. Introduction of Statistics in Biology. Baifukan Publ. Co., Tokyo, 288pp (in Japanese). Kaneko, Y. 1992. Mammals of Japan. 17. Eothenomys smithii (Smith’s red-backed vole). Honyurui Kagaku [Mammalian Science] 32 :39—54 (in Japanese). Load, R. D., 1959. The lens as an indicator of age in cottontail rabbits. J. Wildl. Mamage. 23 : 350— 360. Morris, P. 1972. A review of mammalian age determination methods. Mammal. Rev. 2: 69—104. Okamoto, K. 1980. Age determination by eye lens weight in the Norway rat. Jap. J. Sanit. Zool. 31: 57 Mammal Study 22: 1997 193—200 (in Japanese with English summary). Takada, Y. 1982a. Life history of small mammals in fallow fields. 2. The eye lens weight as an age indicator in the feral house mouse, Mus musculus molossinus. Seichou [J. Growth] 21:1—7 (in Japanese with English summary). Takada, Y. 1982b. Life history of small mammals in fallow fields. 4. The eye lens weight as an age indicator in the large Japanese field mouse, Apodemus speciosus. Seichou [J. Growth] 21: 8— 11 (in Japanese with English summary). Tanaka, R. 1964. Population dynamics of the Smith’s red-backed vole in highlands of Shikoku. Res. Popul. Ecol. 6 :54—66. Tanikawa, T. 1993. An eye-lens weight curve for determing age in black rats, Rattus rattus. J. Mammal. Soc. Japan 18: 49—51. Zar, J. H. 1984. Biostatistical Analysis. 2nd ed. Prentice-Hall, Englewood Cliffs, N. J., 718pp. (accepted 26 March 1997) Mammal Study 22: 53-70 (1997) © the Mammalogical Society of Japan Postnatal growth, development and ultrasonic vocalization,of young Japanese field voles, Microtus montebelli Yuko YOSHINAGA, Wakako OHNO and Satoshi SHIRAISHI Zoological Laboratory, Faculty of Agriculture, Kyushu University, Fukuoka 812-81, Japan Fax. +81-92-642-2804, e-mail. yyoshi @ agr. kyushu-u. ac. jp Abstract. Both postnatal growth and development of Japanese field voles, Microtus montebelli, were observed in a laboratory colony. Details of the developmental aspects of the life-history of this species are described focusing on behavioral development including ultrasonic vocalization, sexual dimorphism and the use of sigmoidal models of growth patterns. One purpose of the study was to provide a reliable basis for age-estimation of a wild popula- tion prior to conducting field investigations. The overall pattern of development of M. montebelli was similar to that of other Microtus species, particularly in their relatively rapid develop- ment. Young M. montebelli were found to vocalize intensively at an ultrasonic frequency of approximately 25 kHz until their eyes opened. The Gompertz equation was selected from three non- linear growth models (Gompertz, logistic and von Bertalanffy), as it best described the curves of body mass increase and of four external lengths, and it best estimated maximum growth rates derived from the Gompertz equations fitted to actual rates during a linear growth phase. These features of the Gompertz equation seemed to be useful for analyzing growth patterns of wild voles. After 30 days, growth curves for each morphometric parameter diverged sexually, thus, weight-classes used for age estimation should differ between the sexes. Key words: growth curve, Microtus montebelli, postnatal development, sexual dimorphism, ultrasonic vocalization. Microtus voles grow relatively rapidly when compared with other muroid rodents (Zullinger et al. 1984, Dewsbury 1990), although they appear to show considerable interspecific variation in rates of postnatal development even under similar laboratory conditions (Nadeau 1985, Innes and Millar 1994). It is suggested that among Microtus species, some aspects of interspecific variation in postnatal development correlate with their type of social organization, 7.e., monogamous species tend to develop physically and behaviorally more slowly than polygamous species (Kleiman 1977, McGuire and Novak 1984, 1986, Dewsbury 1990). To make such a correlation clear, data on development as well as on mating systems are required from a substantial number of animals from within a restricted taxonomic group, yet from a group that shows a 54 Mammal Study 22: 1997 diversity of ecological adaptations. The genus Microtus offers an excellent opportunity for this. Physical development, growth and the reproductive patterns of the Japanese, field vole, M@. montebelli, are well documented (Shiraishi 1969, Miyao 1974, Obara 1975, Kudo and Oki 1982). Since variability in these character- istics may exist among local populations of a given species, it is necessary to collect all such data from voles from a single targeted population. Further- more, for M. montebelli little information has been reported on the subjects of fitting sigmoidal models to growth patterns on the appearance of sexual dimorphism, behavioral development or on ultrasonic vocalization by infants. The latter is of particular interest given that interspecific variation in ultra- sonic vocalization has recently been the focus of correlations with social systems (B. H. Blake personal communication). Field researchers often assign captured voles to age-classes (typically juvenile, subadult and adult) on the basis of their weight when caught. As voles from different localities may differ in body size (Bondrup-Nielsen and Ims 1990), it is important to confirm how old the voles in each age-class are on the basis of the weights of known-age voles from the same study population. Moreover, this may be an effective mean of making more detailed age- estimation and growth analyses by restoring original growth curves from sporadic field data. With this aim in mind, it is important to test statistically the effectiveness of fit of growth models using known-age samples. Our primary aim, therefore, in writing this paper is to describe the details of the developmental aspects of MW. montebelli, focusing on fitting various models to growth patterns, and to describe the appearance of sexual dimorph- ism and behavioral development including ultrasonic vocalization, as compo- nents of the species’ life-history. Our secondary aim is to provide a reliable basis for age-estimation of a vole population at our study site prior to conduct- ing field investigations. MATERIALS AND METHODS The captive breeding colony of voles used in this study was derived from wild-caught M. montebelli from a meadow on the northern rim of Mt. Aso, Kumamoto Prefecture, Japan. Pairs of voles were housed in stainless steel cages (2025 x43cm) with chambers containing straw and cotton wool as nesting material. The growth patterns of their infants (7.e., of first generation laboratory-born voles) were observed. The room in which the colony was housed was maintained at 22+2°C with a 14 hour light and 10 hour dark photoperiod (the lights were switched on each day at 08: 00). A commercial herbivore diet (ZF, Oriental Yeast, Tokyo) and water were provided ad libitum with an occasional supplement of sweet potato. Newborn voles were left with their parents from birth (day 0) until 20 days old, when they were removed and housed together with their litter mates until approximately 60 days old. Thereafter, males and females were housed separately. Yoshinaga et al., Postnatal growth of Japanese field voles 55) Fourteen male and 14 female M. montebelli from seven litters were observ- ed closely from birth until day 20. Each infant was removed from its natal nest, placed on to a 50 cm diameter glass tray and its behaviour was monitored for two minutes each day using an 8-mm video recorder (CCD-V800, Sony, Tokyo) connected to a Mini-2 bat detector (Ultra Sound Advice, London, UK) set to 25kHz. This frequency was selected as the frequency at which infant vocalizations were most easily detected, after preliminary tests made at inter- vals of 5kHz. Because ultrasonic vocalizations were likely to change in their duration over time in the preliminary tests, we noted whether vocalizations were sustained for more than one minute (continuous vocalization) or not (discontinuous vocalization), that is more than half of the two minute observ- ation periods. Physical development was also observed, and obvious changes in the eyes, ears, digits, incisors and pelage were recorded individually. Ten males and 10 females from five litters were used as subjects for measurements of five variables. These were: body length (from snout tip to anus), tail length (from anus to tail tip), hind foot length (without claw), ear length and body mass. These measurements were made every second day from day 0 to day 20, every 5days to day 50, then every 10 days to day 150. Weight was measured to the nearest 0.01 g on an electronic balance (PJ3000, Mettler, Switzerland), and length was measured to the nearest 0.1mm with a ruler or vernier callipers. To compensate for the reduction in sample size caused by deaths before weaning, additional growth data were obtained after day 20 from another litter consisting of one male and four females. Growth curves were fitted with non-linear regression models using iter- ative least squares (Zullinger et a/.1984). Three sigmoidal equations were used in this study : the Gompertz equation, WAG) =A xX oper the logistic equation, VE ct) VA ie a alten and the von Bertalanffy equation, Vi) VAL ect / 3) coe anlee 3 where M(t) =mass (g) or length (mm) at age t, A=asymptotic value, K = growth rate constant (day~'), and / =age (days) at the inflection point (Ricklefs 1967). The abilities of these three equations to fit the growth data were compared in relation to: correlation coefficients, coefficients of variation in estimated parameters (A, K, and J), and the residual sum of squares. To compare rates of early growth between males and females, we also calculated simple linear regression equations for mass and lengths over a linear growth phase. A linear growth phase was defined as a period when mass or length increased relatively constantly each day. Sexual differences reflected by regression 56 Mammal Study 22: 1997 equations were tested using the ¢-test following Zar (1984). Maximum growth rates at inflection points (WGRe) were estimated from the parameters of the best fit equations (Ricklefs 1967), and were compared with the observed maximum increases of mass and length per day (WGRo) and the regression coefficients (6), in order to evaluate the usefulness of growth parameters estimated by curve fitting. The formulae for MGRz were as follows: for the Gompertz equation, MGR:e=K XAX1/e for the logistic equation, MGR:=K XAX1/2 and for the von Bertalanffy equation, MGR:r=K XAX8/27 The statistical significance of differences between the sexes was tested using an unpaired two-tailed t-test for the age at which developmental events occurred. All statistical analyses follow Zar (1984). Means are expressed plus or minus one standard deviation. RESULTS 1. Physical development Neonates were essentially naked, but with short pale hairs and pigment- ation just detectable on their backs. Neonates had attached digits, folded ear pinnae and eyelids and lacked erupted teeth. As they grew, their hair gradually became denser, their ear pinnae unfolded (day 2.50.6), their digits separated, their incisors erupted and their auditory meatus (day 7.30.6) and their eyes (day 8.3+0.9) opened. Each event occurred within a range of 1-3 days, and no sexual differences were observed (¢ values ranged from 0.20 to 2.05, all p >0.05). In females, teats became noticeable at day 1.7+1.1. To identify the order of digit separation, digits were numbered one to five from the innermost digit, the first digits in the fore foot were, however, invisible externally. The outermost digits separated first with digits 4-5 in the fore foot separat- ing on day 3.90.7, and digits 4-5 in the hind foot separating on day 4.8£0.7, n=28), then the innermost digits separated, digits 2-3 in the fore foot on day 5.60.7, and digits 1-2 in the hind foot on day 5.10.9), and finally the remain- ing digits became separated (3-4 on the fore foot on day 6.80.6 and 2-3 on the hind foot on day 7.40.8 and 3-4 on the hind foot on day 7.40.8). Each fore foot digit separated significantly earlier than its hind foot homologue (¢ values ranged from 2.86 to 8.63, p<0.01). The lower incisors (day 5.60.6) erupted before the upper incisors (day 5.90.7) in every individual. All individuals completed their external development by day 10, by which time their eyes had opened and their juvenile pelage was complete (day 9.60.7). Pups ingested solid food from day 9 or 10 onwards (day 9.30.5, m=28) and this did not differ Yoshinaga et al., Postnatal growth of Japanese field voles Di between males and females (t=0.39, p=0.699). 2. Behavioral development Nine activities were distinguishable during the daily two minute observ- ation periods. These were: resting, rolling over, pivoting, crawling, walking unsteadily, normal walking, moving backwards, grooming and standing up. Of these nine, the last three were relatively capricious and their developmental stages were not so clear. Rolling over, pivoting, crawling and unsteady walking were specific to younger voles, and mobility developed in this order (Fig. la, b). Neonates were entirely immobile. They were unsteady even while resting and 70% of them rolled over. a 100 80 605 40 Percentage unsteadily walk normally Percentage vocalize continuously over 1 min vocalize discontinuously Percentage Age (days) Fig. 1. Behavioral development of infant Japanese field voles for the first 20 days (n=28). Each column indicates the percentage of individuals which showed behaviors specific to a younger stage, a) rolling over and pivoting, b) moving forward, c) ultrasonic vocalizations during the two minute observation. 58 Mammal Study 22: 1997 The age at which each activity commenced or disappeared ranged from 3-10 days, and this did not differ between the sexes (¢ values ranged from 0.19 to 0.83, p>0.4). After day 14, all individuals were able to walk normally, and by this age they were adult-like in all their activities. 3. Ultrasonic vocalization Ultrasonic vocalizations at around 25 kHz were first emitted as early as day 0.50.9 (days 0-3). Continuous vocalization was recorded for 65% of all neonates (Fig. 1c). Young voles emitted ultrasound especially when they were rolling over, and most individuals (75-96% of examinations) vocalized until day 8, when their eyes opened. Continuous vocalizing was last recorded on day 5.142.1 (days 0-8). After day 9, all vocalizing became discontinuous and fewer than 50% of young voles vocalized at 25 kHz, although some pups continued to vocalize until day 14 (day 10.3 + 2.1 on average). It was clear, therefore, that the incidence and duration of ultrasonic vocalizations among neonates changed once their eyes had opened. 4. Growth curves The body size of neonate males and females was similar. Neonate males weighed 2.99+0.38 g (n=10) and neonate females (x=10) weighed 2.83+0.44 g ({=0.87, p=0.394), body lengths were 38.5+2.3 mm for males and 37.7+2.9 mm for females (f=0.69, p=0.502), tail lengths were 8.4+0.7 mm and 8.6+0.9 mm ({=0.78, p=0.448), and hind foot lengths were 6.6£0.5mm and 6.4+0.4 mm respectively (f=0.91, p=0.375). Body mass increased almost continuously from birth for the first 90 days for males, and for the first 60 days for females (Fig. 2, upper graph). For the first 30 days the growth curves of male and female body mass did not differ (Fig. 2), however the slopes of male (0.74 g/day, 7?=0.995, F =2145.9, p=0.0001) and female (0.69 g/day, r?=0.996, F =2646.1, p=0.0001) regression lines differed significantly (t=2.27, p=0.034). Thereafter, growth rates of males were gener- ally greater than those of females (Fig. 2, lower graph) and the growth curves of males and females continued to diverge (Fig. 2, upper graph). Male and female body length increased linearly for the first 14 days (Fig. 3, lower graph) with the slopes of male and female regression lines not differing significantly (t=0.54, p=0.600). The common regression coefficient was 2.9 mm/day (v?=0.995, F =2888.2, p=0.0001). Similarly, increases in tail length over the first 20 days (t=0.56, p=0.585, Fig. 4, lower graph) in hind foot length over the first 10 days (t=0.48, p=0.646, Fig. 5, lower graph) and in ear length over the first 14 days (t=0.93, p=0.369, Fig. 6, lower graph) were all judged to be linear with regression line slopes that did not differ between males and females. The common regression coefficients for males and females, of tail, hind foot and ear lengths were 1.4 mm/day (7v?=0.995, F = 4383.7, p=0.0001), 0.9 mm/day (7?=0.995, F =1929.5, p=0.0001) and 0.5 mm/day (7?=0.989, F =1215.0, p=0.0001), respectively. Thus, it was apparent that during the linear growth phases, differences in body, tail, hind foot and ear lengths between malen and Yoshinaga et al., Postnatal growth of Japanese field voles 59 50 40 30 . A 0 ) 0 e 20 Yi Body mass (g) 107 —o— Female 0 30 60 90 120 150 Growth rate (g/day) © BS 0 | 30 60 90 120 150 Age (days) Fig. 2. Gompertz plots for postnatal mean body mass (upper graph) and growth rates per day (lower graph) against age in the Japanese field vole. Actual data points are represented by solid circles (male, »=10) and open circles (female, n=10). Vertical bars indicate + 1 SD. Growth parameters are found in Table 1. 60 Mammal Study 22: 1997 —e— Male 40 —o— Female Body length (mm) 0 | 30 60 90 120 150 © aS =a, ( 0 hoa ee Growth rate (mm/day) 0 30 60 wr): 120 150 Age (days) Fig. 3. Gompertz plots for postnatal mean body length (upper graph) and growth rates per day (lower graph) against age in the Japanese field vole. Actual data points are represented by solid circles (male, ~=10) and open circles (female, m=10). Vertical bars indicate + 1 SD. Growth parameters are found in Table 1. Yoshinaga et al., Postnatal growth of Japanese field voles 61 50 ee ee SR Bay) 80: ie = y) E 4 ww 30 4 < (e ~ ° 0) f c N & 20 ff —e— Male = Nis —o— Female fm t ) 104% 0 0 30 60 90 120 150 2 > 1.5 | : 0 ‘ata =~ O e = E 1 v e . \ = 0.5 : <, | ex O - Ja e = 2 0 ao RGA 1) : -0.5 0 30 60 90 120 150 Age (days) Fig. 4. Gompertz plots for postnatal mean tail length (upper graph) and growth rates per day (lower graph) against age in the Japanese field vole. Actual data points are represented by solid circles (male, »=10) and open circles (female, ~=10). Vertical bars indicate + 1 SD. Growth parameters are found in Table 1. 62 Mammal Study 22: 1997 20 -«~ ifr" E fy E 15 al ces ol 0) e {eas ®@ 107 rs) ; —e— Male © f —o— Female O e°* a 0 S 0 30 60 90 120 150 1.4 1.2 = eS Growth rate (mm/day) © roy) 0.2 : t 0 et, —- e 0 f {>> SO < Se -0.2 i 0 30 60 90 120 150 Age (days) Fig. 5. Gompertz plots for postnatal mean hind foot length (upper graph) and growth rates per day (lower graph) against age in the Japanese field vole. Actual data points are represented by solid circles (male, m=10) and open circles (female, ~=10). Vertical bars indicate + 1 SD. Growth parameters are found in Table 1. Yoshinaga et al., Postnatal growth of Japanese field voles 63 Ear length (mm) 0 30 60 90 120 150 Growth rate (mm/day) 0 30 60 90 120 150 Age (days) Fig.6. Gompertz plots for postnatal mean ear length (upper graph) and growth rates per day (lower graph) against age in the Japanese field vole. Actula data points are represented by solid circles (male, m=10) and open circles (female, 7=10). Vertical bars indicate + 1 SD. Growth parameters are found in Table 1. 64 Mammal Study 22: 1997 females were not detectable, however at about day 30 the growth curves of all lengths diverged sexually (Figs. 3-6, upper graphs). Although body mass showed considerable variation (Fig. 2, upper graph), we were able to assign individual voles to one of three age-classes on the basis of body mass (Fig. 7). Among males, 85% of individuals which weighed 15-25 g (n=33) were younger than 30 days, 94% of individuals which weighed 25-35 g (n=51) were 30 to 90 days old, and 69% of individuals weighing over 35 g (n= 86) were more than 90 days old (Fig. 7). Among females, which were lighter than males, 93% of those weighing 15-20 g (7=28) were less than 30 days old, 61% of those weighing 20-30 g (7=93) were 30-90 days old, and 67% of those weighing over 30 g (v=39) were more than 90 days old (Fig. 7). 100 a. Male 80 rb) do) & 60 | ® © 40 i) a. 20 Yy 15-20 20-25 25-30 30-35 35-40 over 40 b. Female 100 80 ® od) S 60 Cc @o © 40 cab) a. 0715-20 20-25 25-30 30- Body mass (g) Fig. 7. The relationship between weight-classes and age-classes. Each colums indicates the percentage of individuals under 30 days (ff), 30-60 days ([ |), 60-90 days (4) over 90 days of age ({_]) in a) males and b) females in each weight class at intervals of 5 g. Yoshinaga et al., Postnatal growth of Japanese field voles 65 5. Models for postnatal growth Data on postnatal growth were evaluated based on three non-linear models (Gompertz, logistic and von Bertalanffy equations, parameter estimates for the best fit equations are summarized in Table 1). The predicted values had correlation coefficients over 0.99 in all cases (Table 1). Because of these high correlations, it was difficult to distinguish graphically among the three models, however, after deriving an equation based on each growth model, we chose the Gompertz equation on the basis of the statistical characteristics of the parame- ter estimates. For all three models, the model showing the lowest residual sum of squares varied with each parameter, for example, the von Bertalanffy equation was Table 1. Growth parameters in the Japanese field vole, M. montebelli, derived from the Gompertz, logistic and von Bertalanffy equations. Asymptote Growth rate constant —_ Inflection point Residual Coefficient Coefficient Coefficient sum of of variation Estimate of variation Estimate of variation Model Sex squares yr _ Estimate* (%) (days”') (%) (days) (%) Body mass Gompertz M 2.0293) 10N998e 43230 ee ORSS LO SO04O3 NEE OE SS 18.3 2.39 F 20.36.50: 9965 30nI2 = S02 02065555 74289 S5 3.80 Logistic M Sallie Osos AZAR) ZO Oey es Belt! Dilea 0 3.14 F 30 407 408993" 297 10 IE 2 0209538" Os07 15 3.84 von Bertalanffy M On W989) 23073 ace! OUBEYA Salil! 13.9 BAG) F 1733202996 S0833N 089%, W0E05625) 44.49 8.4 4.64 Body length Gompertz M 84.84 0.998 118.60 0.52 0.0621 3.40 0.8 41.76 F 73.84 0.997 109.43 0.49 0.0759 3.48 0.4 5S Logitic Mise 17430995 salln90 en ORi2 0K0783 5 4288 6.7 6.56 PAD SOI OLE MOS O259 YY OsC SC aay DES 6.40 von Bertalanffy M OLAS OE S98 Ise S0r ety 0n0n69> 2-90 =1°7 SES F Obe85" OE998 109266" 0247 = 2020695a° 3228 =e 19.50 Tail length Gompertz M U8) O83 40.60) 0.68 OnOsts- S205 6.4 3.36 F Isicove WON — 489 | Oe W029 Aer 5.6 3.44 Logistic M ZTARGATM ORO S a= AG 28 = 0262 ee OEIZ8Ze" = 3.8 10.9 2.48 F LOSSS 0998 ASRS ass ee ORISSA) Mgr a4 9.6 DJA | von Bertalanffy M SSE ORS OS RAG GSae 02 5oO) Se ORORMZe Bel 4.1 5.60 F IG305 O88 48.58" — Ose0 VOSS > "E27 3.6 6.18 Hind foot length Gompertz M 20 OR99Sn 1 ORAG eam 0229) Oe 546 9 2250 0.9 13.95 F est O83 = MSOF. Wes¥e 9 OMe se = Aatsill 0.9 14.02 Logistic M L589 OO - IO4Z0> = Mesh Ons — Bars 3.4 3.61 F V8 OSES MS Ol Ss OA) “OLA ILS Boe 2.38 von Gertalanffy M 4h} O98 I9.49 O83 Osan 2.7 =() 77 (gol F WS OSO AUS a), ESS) We bY S385) =a (vlna GUA Ear length Gompertz M IEOZ. OVS Wace) — Oa Wsilbyisy 215s} do) 3.89 F 2.0 O885 WO68 Oss “OsNeZo 5.0? Ro) 4.42 Logistic M 0.87 O08 Mee» O44 O.7IE) B383 8.2 1.81 F Lik} Os99G" — MOD). — Ose Ws2E0I 415 8.0 e183 von Bertalanffy M ZH Veo = Me OSI. SOIC, B83 Apa 6.24 F D1 O9Oil Ws — Oe Mae 58% 4.2 6.75 *Weight in g and length in mm. 66 Mammal Study 22: 1997 lowest for body mass and length, the Gompertz equation was lowest for tail length, the logistic equation was lowest for ear length, and the Gompertz and logistic equations were lowest for male and female hind foot length, respective- ly (Table 1). The coefficients of variation (a measure of the variation that each parameter exhibits, and the reliability of each parameter without affecting the overall predictive capability of the model) for the estimates of growth parameters of asymptotic values (A) and growth rate constants (K) were consistently less, when derived from the model yielding the lowest residual sum of squares (Table 1). When considering inflection points J, the lowest coeffic- ient of variation was obtained from the logistic equation for all measurements except for body mass. For each approximation where the logistic or von Bertalanffy equation resulted in the lowest residual sum of squares, and the lowest coefficient of variation in A and K, the next best approximation was always provided by the Gompertz model. For these two criteria, the logistic equation provided the worst approximation for body mass and length of the three models, while the von Bertalanffy equation provided the worst approxi- mation of hind foot and ear lengths. Thus the Gompertz model was chosen as the best compromise for approximating all growth curves for M. montebellt, since even those measures best fit by either the logistic or von Bertalanffy models also fitted reasonably well with the Gompertz model. The lines in the upper graphs of Figs. 2-6, portray growth curves predicted by Gompertz equa- tions. When comparing the estimated maximum growth rates (WGRe) derived from fitted Gompertz, logistic and von Bertalanffy equations, a consistent pattern was found in the relative magnitudes of their values (Table 2). The MGRe value was greatest with the logistic equation and least with the von Bertalanffy equation. Since MGRze values derived from the logistic equation were consistently greater than either the observed maximum growth rates Table 2. Comparisons among observed maximum growth rates (WGRo) estimated maxi- mum growth rates derived from three sigmoidal models (M/GRe) and regression coefficients during linear growth phases (0) in five measurements. MGReE Measure Sex MGRo b Gompertz’ _ logistic’ von Bertalanffy* Body mass (g/day) M 0.94 0.74 0.74 145 (51 F 0.98 0.69 ORG 1.42 0.51 Body length (mm/day) M 3.83 DS Do Hk 4.62 2.00 F 35 M9) “Atak 3.06 5) A 2220 Tail length (mm/day) M 1.89 1.36 eit 2.84 Oi F 1.89 1.38 159 2.98 eels Hind foot length (mm/day) M 1 23 0.94 Ul 1.91 0.82 F 110 0.92 1.16 2.00 0.85 Ear length (mm/day) M 0.76 0.52 0.62 WS 0.44 F 0.76 0.55 0.67 1.26 0.47 ‘MGRe=K XAX1/e, *? MGRe=K XAX1/2, * MGRe=K X AX8/27 Yoshinaga et al., Postnatal growth of Japanese field voles 67 (MGR o) or the slopes of regression lines during the linear growth phase (0), those values were considered likely to overestimate growth rates during rapid growth phases (Table 2). Conversely, MGRe values from the von Bertalanffy equation were consistently lower than either MGRo or b values. MGRz values obtained from the Gompertz equation were closest to MGRo and bd values of these three equations in most cases. Thus, the Gompertz equation was again selected as the best model for approximating the growth rates of M. montebelli. When comparing the estimated maximum growth rates (MGR -«) from fitted Gompertz equations and observed maximum growth rates (WGRo) and regres- sion coefficients (6), MGRo values were higher than the other two values in almost all cases. MGRe tended to approximate 06, which reflects average growth rates during the linear growth phase (Table 2). Observed growth rates fluctuated considerably even when growth seemed to be more linear (Figs. 2-6, lower graphs), so it is suggested that WGRz« values derived from the Gompertz equation are a good indication of average growth rates during linear growth phases. DISCUSSION The overall patterns of physical and behavioral development of the Japanese field vole, VM. montebelli, fall within the ranges exhibited by other Microtus species (Pepin and Baron 1978, Nadeau 1985). The growth rate of mass, 0.7 g/day, calculated as the slope of simple regression line places this species within a group with moderate growth rates among the 15 other species of Microtus reviewed by Innes and Millar (1994). Innes and Millar (1994) also found, however, significant positive correlations among Microtus species between female weight and certain other traits, such as litter size, neonate weight and growth rate to weaning. Thus, interspecific comparisons of growth rates should be made after growth rates have been standardized by female weights. When standardized growth rates (weight increase per day as a percentage of female weight) are compared among 13 Microtus species, M. montebelli (2.33 % per day, this study) ranks as the second most rapidly growing species (others range from 0.94% to 3.14% per day, calculated from Innes and Millar’s [1994] data). Although few data relating to postnatal development are available for comparison with this study, the age at which eyes open has been reported for a number of Microtus species, and is used as an index of maturation (Dewsbury 1990). The eyes of M. montebelli open earlier (day 8.3) than in either /. ochrogaster, M. pinetorum, M. montanus or M. pennsylvanicus (days 9.1-11.7, Dewsbury 1990). Thus, it seems that M. montebelli belongs to a rapidly developing sub-group of Microtus species. Kleiman (1977) considered that a long period of maturation for young voles was a characteristic of monogamy, suggesting, therefore, that the rapid growth pattern of young M. montebelli may be related to non-monogamous traits. According to Glucksmann (1974), sexually dimorphic animals are unlikely 68 Mammal Study 22: 1997 to exhibit sexual differences until puberty. Young M. montebelli certainly showed no sexual differences in physical development (completed by day 10), or in the processes of behavioral development (completed by day 14), and until about day 30, the growth curves of body mass and of four external measure- ments were indistinguishable between males and females. After 30 days the growth curves of males and females diverged clearly, and males became larger than females. Even during the linear growth phase, rates of growth of body mass differed sexually, although other measurements did not. A reasonable explanation for male-biased sexual dimorphism among microtine voles has been made only in relation to types of mating systems (Heske and Ostfeld 1990, Boonstra et al. 1993). Through interspecific compari- sons among Muicrotus species, the ratios of male to female body masses fall roughly into three groups corresponding to their mating systems: 1.0 for monogamous species, 1.2 for promiscuous species and 1.3 for polygynous species (Yoshinaga et al.1997b). Thus, the apparent male-biased sexual dimorphism in M. montebelli seems to indicate that they may be polygynous. Observations appear to support this in as much as during the breeding season, resident male wild M. montebelli maintain intra-sexual exclusive home ranges which overlap with those of several females (Yoshinaga unpublished data). There appear to be, however, several discrepancies in previous reports on the correlation between degrees of sexual dimorphism and mating systems in microtine species (Dewsbury et al. 1980, Boonstra et al. 1993, Ostfeld and Heske 1993), indicating that more detailed and more reliable data on development and mating systems among voles are necessary in order to discuss more effectively underlying theories explaining such correlations. For age-estimation in the field, voles could be assigned to three age-classes, 1.€., juveniles (voles younger than 30 days), subadults (30 to 90 days) and adults (older than 90 days), on the basis of growth in body mass data from the labora- tory colony. Since M. montebelli is sexually dimorphic, weight criteria for each age-class should differ between males and females. For males, for exam- ple, voles weighing 15-25 g should be considered juvenile, those weighing 25-35 g should be considered subadult, and those weighing over 35 g adults, whereas for females, the weight criteria for each age-class should be 5 g lighter than in males. These age-weight classes should be applicable for field studies of M. montebelli in our region. Moreover, more detailed age-estimation and growth analyses may be effectively achieved by restoring original growth curves from sporadic field data. During most field studies, rates of weight increase are only available between consecutive captures. Since growth curves of many mammals are sigmoid (Zullinger et al. 1984), the relationship between weight and weight increase should theoretically follow a differentiated sigmoidal equation. For modeling growth patterns of M. montebelli, the Gompertz equation was selected from three sigmoidal models tested statistically in this study. The differentiat- ed Gompertz equation has also been demonstrated to fit a data set of weights and weight increases collected from wild voles (Yoshinaga et al. 1997a). Yoshinaga et al., Postnatal growth of Japanese field voles 69 Restored growth curves of wild voles have asymptotic weights which differ according to the month of birth (Yoshinaga eft al. 1997a), thus it may be of great value to use the generated growth curves for age-estimation of captured voles. Acknowledgments : The comments and criticisms of Dr. T. Mori, of the Kyushu University were helpful during the preparation of the manuscript, and the manuscript was further improved by comments from Dr. B. Chisholm of the University of British Columbia. Dr. M. Brazil kindly improved the English of the final manuscript. REFERENCES Bondrup- Nielsen, S. and R. A. Ims. 1990. Reversed sexual size dimorphism in microtines: are females larger than males or are males smaller than females? Evol. Ecol. 4: 261—272. Boonstra, R., B.S. Gilbert and C. J. Krebs. 1993. Mating systems and sexual dimorphism in mass in microtines. J. Mammal. 74 : 224—229. Dewsbury, D. A. 1990. Individual attributes generate contrasting degrees of sociality in voles. Jn (R. H. Tamarin, R.S. Ostfeld, S.R. Pugh and G. Bujalska, eds.) Social Systems and Population Cycles in Voles. pp. 1—10. Birkhauser, Basel, Switzerland. Dewsbury, D. A., D. J. Baumgardner, R. L. Evans and D.G. Webster. 1980. Sexual dimorphism for body mass in 13 taxa of muroid rodents under laboratory conditions. J. Mammal. 61: 146— 149. Glucksmann, A. 1974. Sexual dimorphism in mammals. Biol. Rev. 49 : 423—475. Heske, E. J. and R. S. Ostfeld. 1990. Sexual dimorphism in size, relative size of testis, and mating systems in north American voles. J. Mammal. 71:510—519. Innes, D.G.L.and J.S. Millar. 1994. Life histories of Clethrionomys and Maicrotus (Microtinae). Mammal Rev. 24 : 179—207. Kleiman, D.G.1977. Monogamy in mammals. Quart. Rev. Biol. 52 :39—69. Kudo, H.and Y.Oki. 1982. Breeding and rearing of Japanese field voles (Microtus montebelli Milne-Edwards) and Hungarian voles (Microtus arvalis Pallas) as new herbivorous laboratory animal species. Exp. Anim. 31:175—183 (in Japanese with English summary). McGuire, B. and M. Novak. 1984. A comparison of maternal behaviour in the meadow vole (Microtus pennsylvanicus), prairie vole (M. ochrogaster) and pine vole (M. Pinetorum). Anim. Behav. 32: Ie = joel McGuire, B. and M. Novak. 1986. Parental care and its relationship to social organization in the montane vole (Microtus montanus). J. Mammal. 67 :305—311. Miyao, T.1974. Ecological niche and growth~- synthesis of the specific characters in Microtus montebelli.- J. Growth 13:61—71 (in Japanese). Nadeau, J. H. 1985. Ontogeny. Jv (R. H. Tamarin, ed.) Biology of New World Microtus. pp. 254—285. Sp. Publ. No. 8. Amer. Soc. Mammal. Obara, I. 1975. Growth and development of Microtus montebelli. J. Mammal. Soc. Japan 6: 107—114 (in Japanese with English summary). Ostfeld, R. S. and E. J. Heske. 1993. Sexual dimorphism and mating systems in voles. J. Mammal. 74: 7) = ORor Pepin, F. and G. Baron. 1978. Development postnatal de l’activité motrice chez Microtus penn- sylvanicus. Can. J. Zool. 56 : 1092—1102. Ricklefs, R. E. 1967. A graphical method of fitting equations to growth curves. Ecology 48 : 978— 983. Shiraishi, S. 1969. Growth and development of the Japanese field vole, Microtus montebelli. Trans. 80th Mtg. Jpn. For. Soc. 259—260 (in Japanese). Yoshinaga, Y., T.Okayama, T. Mori and S. Shiraishi. 1997a. Estimation of seasonally changing 70 Mammal Study 22: 1997 growth curves in wild Japanese field voles, Microtus montebelli. J. Fac. Agr., Kyushu Univ. Al : 189—196. Yoshinaga, Y., T. Okayama, W. Ohno and S. Shiraishi. 1997b. Growth, development, and reproduc- tive patterns in the Japanese field vole, Microtus montebelli. J. Mammal. 78 : 830—838. Zar, J. H. 1984. Biostatistical Analysis. Prentice-Hall, Inc., Englewood Cliffs, New Jersey, 718 pp. Zullinger, E. M., R. E. Ricklefs, K. H. Redford and G. M. Mace. 1984. Fitting sigmoidal equations to mammalian growth curves. J. Mammal. 65 : 607—636. (accepted 9 September 1997) Mammal Study 22: 71-80 (1997) © the Mammalogical Society of Japan Acquisition of food begging behavior by red foxes in the Shiretoko National Park, Hokkaido, Japan Hideharu TSUKADA Regional Sciences, Faculty of Letters, Hokkaido University, N1IO W7 Kita-ku, Sapporo O60, Japan (Present address : Laboratory of Parasitology, Graduate School of Veterinary Medicine, Hokkaido University, NI8 W9 Kita-ku, Sapporo O60, Japan) Fax, +81-11-717-7569, e-mail. tsuka @ vetmed. hokudai. ac. jp Abstract. In order to solve traffic problems and to understand possible epidemic risks resulting from the feeding of wild red foxes, Vulpes vulpes, the acquisition of food begging behavior by foxes in the Shiretoko National Park, Hokkaido, Japan was studied. Foxes were individually identified and their behavior was observed from June to October each year from 1992 to 1994. The locations of family territories and denning sites were estab- lished, and the degree of their tolerance to humans was investigat- ed, and the relevancy of these factors in food begging behavior was examined. The development of food begging behavior among individuals less than one year old was strongly correlated (p <0.01) with their dens being within 20 m of the road edge. Most juveniles which were not born in dens near the roadside showed no food begging behavior and most individuals more than one year old, which had not previously shown such behavior did not acquire it at all, strongly suggesting that food begging behavior was predominantly acquired by juveniles denning near roads. Thus, preventing foxes from denning near roads should be an effective means to obstruct the acquisition of begging behavior. Key words: food begging behavior, tolerance to humans, Shiretoko National Park, Vulpes vulpes schrenckt. Feeding wildlife is considered to be an undesirable recreation, which not only has considerable impact on wildlife (Nature Conservation Society of Japan 1978), but may also lead to risks for humans. Injuries to people have been caused for example by grizzly, Ursus arctos, and black bears, U. americanus (McCullough 1982, Robinson and Bolen 1989, Herrero and Fleck 1990, Wright 1992) in North America and by Japanese monkeys, Macaca fuscata (Wada 1989) in Japan, and Japanese monkeys have caused damage to crops as a result of feeding (Nature Conservation Society of Japan 1978, Wada 1989). In the Shiretoko National Park (SNP), many red foxes, Vulpes vulpes schrencki, have been fed by park visitors since 1970 (Tsukada 1994, Watanabe and Tsukada 1996). The foxes have appeared on the road through the SNP during the daytime, some of them even lying down in the center of the road in order to stop vehicles and to obtain food from the drivers and passengers. iz, Mammal Study 22: 1997 Some traffic accidents have occurred as a result of this behavior, when drivers have dodged foxes on the road. Traffic jams have also occurred in the SNP when vehicles have parked haphazardly to feed the foxes on the road during the peak visitor period of the summer vacation. Some foxes in the SNP have become tame enough to be fed by hand by visitors who, by doing so, unwittingly run the risk of infection, because red foxes in Hokkaido are a definitive host of Echinococcus multilocularis which causes alveolar hydatid disease in humans (Yamashita 1978). Humans become infected accidentally by ingestion of the parasite’s eggs deposited in fox feces (Yamashita 1978). Kondo et al. (1986) found that between 10% and 60% of the foxes in eastern Hokkaido were infected with this parasite. Coproantigen detection of fox feces (Nonaka et al.1996) has confirmed the presence of echinococcus infection among some foxes inhabiting the SNP (Nonaka in prep.). When dogs are infected by Echinococcus multilocularis, various body surfaces, particularly of the anal area, the claws, femora and nose are typically contaminated with echinococcus eggs (Yamashita 1978), and this pattern is believed likely in infected foxes. As a consequence, direct physical contact with infected foxes begging for human food may, therefore, increase the risk of the transmission of this disease. Although prohibiting park visitors from feeding wild foxes would help resolve these problems, there is no legal foundation for such a prohibition. In reality, it is very difficult to stop visitors to the SNP from tossing feeding foxes by hand, even where signs prohibiting the feeding of wild animals have been set up. Controlling the food begging behavior of red foxes is the obvious alterna- tive, however previous studies have not attempted to clarify the conditions under which foxes come to be fed by people (Aoi ef al. 1988). In this paper, a study analyzing how foxes come to be fed by people is described, and means for controlling fox behavior are suggested. MATERIALS AND METHODS 1. Study area The field study was carried out in the Shiretoko National Park (SNP) (44° 06’N, 145° 03’E) in the eastern part of the northern Japanese island of Hokkaido. Every year 1.5 million tourists visit the SNP. An intensive investigation was conducted along the approximately 20 km of main road which crosses the SNP. Half of the length of the road is paved and about 7.5m wide, while the other half is narrow (5m wide) and unpaved (Fig. 1). The whole road is closed throughout winter, from November to May, because of deep snow. 2. Observation of food begging behavior The food begging behavior of foxes was defined as: 1) appearing on or alongside the road during the daytime when people might visit, and 2) staying in positions where drivers or passengers could notice them. Forty-three foxes (18 males and 25 females) begging for food along the road Tsukada, Red fox food begging behavior 73 ~~ Sea Shore — Paved wide road (about 7.5m wide) Unpaved narrow road (about 5m wide) [__] Terriotry of each fox family Fig. 1. Distribution of fox family territories in Shiretoko National Park. Territories II, IV, V, VI, VII and VIII are drawn on the basis of 95% Minimum Convex Polygons (MCP) of all locations of radio-collared females in reproductive condition from May to August 1993. Territory III is drawn by 95% MCP of all locations of a radio-collared male from May to August 1994. Territory I is roughly drawn from many sightings of its residents. were captured either by using handmade blow darts, or padded foothold traps (Victor Soft Catch, Wood Stream Co.), and fitted with individually identifiable colored ear tags (Allflex 25, Allflex New Zealand Ltd.). Standard mor- phometrics such as body weight, body length and hind leg length were recorded. Individuals were assigned to one of three age classes (less than one year old, one year old, and more than one year old) which were determined by the annual attrition of incisors (Harris 1978). Because female foxes are capable of breed- ing at 10 months of age (Ables 1975), animals less than one year old were considered to be juveniles, and those one or more years old were adults. Whether pups were being reared by females was evaluated by the development of their nipples from May to July in 1992-1994. Foxes which could not be captured but which were observed begging several times were identified by unique features such as pelage characteristics and scars, and by the location at which they appeared. Observations of foxes begging were made from a car while driving along the main road through the SNP during the period from June to October in 1993 and 1994. Trips were conducted every two hours from 07 : 00 to 17: 00 for two days each month, with additional trips made at random. Observations in 1992 were only conducted at random. The number of days of observation each month varied from seven to 21 (Table 2). 3. Identification of fox families : As in other areas, related adult foxes in the Shiretoko National Park usually shared common territories (Macdonald 1981, 1983, Murder 1985, Poulle et al. 1994, Tsukada 1997). Therefore, foxes appearing along the same sec- tions of the SNP road were judged to share the same territories, while foxes 74 Mammal Study 22: 1997 appearing at several widely dispersed locations were regarded as itinerants without territories. When there was at least one female in reproductive condition among members sharing a territory, the group was defined as a “reproductive family”. The size of a reproductive family was counted in each territory during the years of the study. Fox dens were searched for by tracking in the snow during the winters of 1992 and 1993. As some reproductive families built their dens near the road, signs of these den sites were searched for along the “roadside”, that is within 20 m of each shoulder of the road during the period from May to August when the dens are usually occupied and used for pup-rearing. 4. The Degree of tolerance to humans To evaluate the degree of tolerance to humans, each fox was approached and the distance at which the fox began to flee was recorded (Table 1). The investigation was conducted more than once for each animal between June and October 1994. Mean scores were calculated for each animal and used as an index of the degree of their tolerance towards humans. Table 1. The scores and criteria of degrees of tolerance to humans in foxes. Scores Criteria Fox begins to flee ; when a vehicle approaches when the researcher alights from the vehicle at > 5m when the researcher approaches to a distance > 5m when the researcher approaches to a distance > 3 and <5m when the researcher approaches to a distance > 1 and < 3m Dm oO FP WW DL FF when the researcher approaches to a distance < 1m or does not flee RESULTS Fifty foxes were observed begging for food from people during the study period. Twenty-eight of these (12 males and 16 females) were adults, six (2 males and 4 females) were juveniles at first but later became adults and 22 (sex unknown) were juveniles. Eight territories were confirmed by radio-tracking (Table 2), four territories (I-IV) were located along the wide paved section of the SNP road, while the other four (V-VIII) were located along the narrow unpaved section (Fig.1). The locations and sizes of these territories were essentially stable during the years 1992-1994. The number of adult foxes observed begging, and the time they spent begging each year varied among the various territories. In territories I, II and III, the maximum number of adults observed begging was two, whereas in territory Vl it was three; and in- IV, V; Vilvand VUE it was tourn ihe maximum number of adults begging in each territory and in each year was significantly higher in territories along the narrow unpaved section of the SNP Tsukada, Red fox food begging behavior 15 road than in territories along the wide paved section (U-test, p<0.01). In territories I and II, adults continued begging until August, while in territories IV-VIII, adults continued the behavior until October (Table 2). The total number of adults begging decreased during September and October each year. Some adults such as the breeding males in territories I and VI and a breeding female in territory III were not observed begging during the study period, even though other members in the same territories were (Table 2). These foxes and a breeding male in territory II in 1994 were observed to avoid all humans. Juveniles from a total of 11 reproductive families were observed begging for food (Table 3). The reproductive families with at least one juvenile beg- ging shared one important feature in common in the selection of their den sites, Table 2. Identified foxes which showed food begging behavior each month from 1992 to 1994. Solid circles and triangles indicate adult and juveniles begging human food, respectively. Open circles and triangles indicate adult and juvenile foxes, which did not beg human food, respectively. Figures under months are observation days in 1992, 1993 and 1994 from left to right. Territory Fox code Sex Jun Jul Aug Sep Oct lanl Bs Zaks 2G Ds 235 20 e224 IW, a8 I Fu F C2 O31 cO1 80s Oo O1OF MONON On HOVOn@ II Hi M @ @ ee ee @©n@ O@ Ne F @o@e@e@0e0e08 000000 O00 Ill Mo M e@o@e@e@ 060608 06080 OO O® IV No M e@o@e@ @080@ @080@ @@0O 68 ®@ Ki F e@o@e@ @0060@8 @00@ @8@0 6808 Th F OOee co0@0 0088 O00 O00 V Na M @oe@ee eee Ox x ) OO ®@ @@o Oi F eee eee eee eee @o le M & 6 e@ ® ® aet F eee @008 080 e@ @ ee Oeb M A @ A ®@ A A A VI Se F @o@e0 6000800800808 08080 Sks F A @ A ®@ A @ A Vil Hy M @o@e@ 600 e0ee0@0oe@e@0 @8@0 Ga F eee eee eee Oe@ @@o Gak F A@@ A@@ A®@®@ ISO") A ®@®@ Gdk F A @ A @ A @ A ®@ AO Vill Ka M @ @ e@ @ @o OO @ O@O Nea F Oe ®@ O@e@ O@e@ ©C..O..© @@o On F O@OdO O@o eee © @O:O @oo Or F O@O O@od @@o O@O OO @ Ty F O@O°O O@O @@o © ©7© @oo Itinerant Si M CFO © O'O'O *" Or OO"? "O1O%O" 19 OO Ma M ClO OOF O©(O* 1 OO" OjnnrOs@nOni © -©O"O M M OChOFO— O° O-O YVO'OtOs HOLOvO M48 © © 76 Mammal Study 22: 1997 Table 3. Correlationship of begging human food by juvenile foxes with the shift of their dens toward the roadside (20 m or less from road shoulders). Begging food by one or more juveniles in each reproductive family is indicated as “+”. Den shift toward the roadside of the main road in the national park is indicated as “+”, and the earliest date of confirmation for the den shift is shown in parentheses. Reproductive family I II Ill IV Begging Roadsideden Begging Roadsideden Begging Roadsideden Begging Roadside den 1992 = = no reproduction _ + (6 Aug) = = 1993 “IF + (17 July) = = _ = 5F + (20 July) 1994 + + (22 June) = = — = oo + (12 July) V VI VII Vill Begging Roadsideden Begging Roadsideden Begging Roadsideden Begging Roadside den 1992 sF + (29 May) z = =F + (3 July) rt > 1993 te +(9 June) 4 + (24 June) + + (23 June) = = 1994 + — — — = + (29 June) = = that is, 10 out of these 11 families moved their dens to the roadside during June and July (Table 3). Conversely, 11 out of the 12 reproductive families which did not move their dens to the roadside also had no juvenile which begged (Table 3). Therefore, whether a juvenile showed food begging behavior or not was significantly correlated with whether its family moved their den to the roadside or not (Fisher’s exact probability test, ><0.01). However, the number of families wherein at least one juvenile begged did not differ significantly between the territories along the wide paved road and those along the narrow unpaved section (Fisher’s exact probably test, p >0.05). The degree of tolerance towards humans was measured among 21 adult foxes. The mean score, 3.66 (range: 1.4-5.9, SE : 1.20) did not differ between age classes, sexes or the reproductive conditions of females (U-test, p >0.05 ; Tables 2 and 4). The foxes in the territories along the narrow unpaved section of the SNP road, however, showed a significantly higher degree of tolerance to humans than those in the territories along the wide paved section (p<0.01). The most highly tolerant foxes lay down in the center of the road in order to Table 4. The degree of tolerance to humans among adult foxes which showed food begging behavior in 1994 comparing age, sex, reproductive condition of females and the road-type in territories. Fox categories nm Mean Se U-test One year old a 62 0.37 More than | year old IO BachD 0.29 p>0.05 Adult male 6335 0.34 Adult female Ie Sons 06350 9 pe 0805 Female in reproductive condition KO SaAld 0.42 Female in non-reproductive condition ete Cedi 0.56 p>0.05 Wide paved road t PeN2 54 0.38 Narrow unpaved road 4 P4672 Ob23 a5 SPOR Oil Tsukada, Red fox food begging behavior 17 stop vehicles and were willing to be fed by hand. Only two adults began begging halfway through the study period. One of these was the male “Ka” in territory VIII, which first began begging for food in May 1993. Even on first contact, “Ka” did not flee, moreover, he approa- ched the survey vehicle even though he had not previously taken food from visitors there. “Ka” was thereafter observed frequently even at night, and showed a high degree of tolerance with a score of 4.5. The other was the adult female “Th”, which first began begging in April 1993. Her behavior was unique in that she began by fleeing as a vehicle approached, but then stayed within sight of the driver and waited to be fed. “Th” was less tolerant of humans in 1993 and this tendency did not change in 1994. Her degree of tolerance towards humans was the lowest scored (1.4) during this study. DISCUSSION There was a strong correlation between the acquisition of begging behav- ior among juveniles and denning near the road. This correlation could be accounted for partly by the fact that juveniles usually confine their activities to the area around their den until July, after which they are taken on exploratory trips by adults (Henry 1986, personal observations). None of the juveniles denning away from the roadside, however, began begging even when they were able to move around the whole of their parent’s range during September and October (personal observations). This strongly supports the belief that den- ning near the road is an important contributory factor in the acquisition of begging behavior among juveniles. The numerous opportunities for interact- ing with people along the road near their den, and for contact with adults already showing begging behavior might facilitate the learning of the same habit among juveniles. Some adults were not observed begging at any time during the study period, even though other individuals living in the same territories were. Furthermore, only two adults commenced begging during the study period. However, one of the two, the adult male “Ka” was considered to have already acquired the begging habit somewhere else before settling in territory VIII in spring 1993, because he was observed begging when he could not have had any opportunities to learn the behavior in the territory. The other individual “Th” began begging in April 1993, but differed from other foxes in that she was extremely intolerant of people. It appears, therefore, that acquiring the beg- ging habit is difficult for adult foxes. The degree of tolerance to humans and the duration of begging among adults differed among territories. Seasonal variation in begging behavior among red foxes in the SNP depends on the availability of its major natural food items (Tsukada and Nonaka 1996). It is assumed, therefore, that the differences in begging behavior observed among adults were related to the availability of natural foods in each territory. Indeed, each territory was located in a slightly different habitat, which would lead to differences in the 78 Mammal Study 22: 1997 available food items among neighboring territories (Macdonald 1981). Adults in the territories along the narrow unpaved section of the SNP road showed a high degree of tolerance to people. Two possible reasons for this should be considered. Firstly, that highly tolerant foxes choose territories along this section of the road, or join a family with such a territory. Secondly, that environmental conditions along this section of the road encourage foxes to be more tolerant. | A fox family is usually composed of a matrilineal kinship group (Mac- donald 1983). Hence, migration of adult females between families does not occur. In fact, only adult males migrated into certain family territories in the study area (unpubl. data). Furthermore, the locations of the territories chang- ed little over three years (Tsukada 1997), and had probably not changed over a longer period (Watanabe and Tsukada 1996). Therefore, the first possible reason is unacceptable. On the narrow unpaved section of the road, the view is blocked by numerous roadside trees and blind corners. Under these condi- tions begging foxes must endure the closer approach of vehicles and people here than on the wider paved section. Furthermore, the narrow shoulders of the unpaved section prevents foxes from taking food from visitors at a distance. Hence, foxes in territories along this section would become more tolerant than those in territories along the wider paved section. A similar effect of road structure where they usually forage on tolerance to people has also been observed among Japanese macaques (Sugiura et al. 1993). In conclusion, begging is a behavior readily acquired by juvenile foxes denning near roads, but is not typically acquired by adults. Environmental factors, such as road type did not affect acquisition of begging behavior, but the degree of tolerance to people among adults did. Therefore, the most effective means of controlling begging by red foxes would appear to be to prevent them from denning near roads. This would eliminate the possibility of juvenile foxes developing the begging habit and result in diffusion of the behavior over generations. It might thus be possible to eliminate begging entirely from the study area. Because physical and human disturbance makes foxes shift their dens (Lloyd 1980, Stubbe 1980, Sargeant et al. 1984, Henry 1986), the selective destruction of dens near roads, and threats made to foxes denning near road by humans or dogs may both be effective means of dispersing problematic foxes. If a direct and intensive control program of foxes in the SNP is necessary, then aversive conditioning should be introduced to a limited part of their range, namely the area along the narrow unpaved road, since that is where potentially infectious (because of their likelihood of having direct physical contact with humans) foxes live. Acknowledgments : I wish to thank M. Yamanaka, H. Okada and M. Ohnuma for supporting my work from the very start, and K. Watanabe and the staff of the Shiretoko Nature Center for supporting and helping my field work. I also thank Y. Ueno who gave me valuable advice on the manuscript and provided encouragement during the writing of this paper. I am grateful to T. Ikeda and Tsukada, Red fox food begging behavior 19 K. Uraguchi for their critical reading of the manuscript. This study was partly funded by a Sasakawa Scientific Research Grant from the Japan Science Society, and also by Shari Town. REFERENCES Ables, E.D. 1975. Ecology of the red fox in North America. Jv ( M. W. Fox, ed.) The Wild Canids: Their Systematics, Behavioral Ecology and Evolution. pp. 216—236. Van Nostrand Reinhold, New York. Aoi, T., K. Koichi, E. Komiyama, N. Kondo, H. Nakagawa, N. Ohtaishi, G. Takahashi, H. Uno and M. Yamanaka. 1988. Conservation and management of animals in Shiretoko. Jn (N. Ohtaishi and H. Nakagawa, eds.) Animals of Shiretoko. pp. 267—342. Hokkaido Press, Sapporo. (in Japanese with English abstract) Harris, S. 1978. Age determination in the red fox (Vulpes vulpes) - an evaluation of technique efficiency as applied to a sample of suburban foxes. J. Zool., Lond. 184: 91—117. Henry, J.D. 1986. Red Fox: the Catlike Canine. Smithsonian Institution Press, Washington, D. Copii4spp: Herrero, S.and S. Fleck. 1990. Injury to people inflicted by black, grizzly, and polar bears recent trends and new insight. Int. Conf. Bear Res. Manage. 8 : 25—32. Kondo, N., K. Takahashi and K. Yagi. 1986. Winter food of the red fox, Vulpes vulpes schrencki Kishida, in the endemic area of multilocular echinococcosis. The Memoirs of the Preparative Office of Nemuro Municipal Museum 1 : 23—31 (in Japanese with English abstract). Lloyd, H.G. 1980. The Red Fox. B. T. Batsford Ltd., London, 320 pp. Macdonald, D.W. 1981. Resource dispersion and the social organization of the red fox (Vulpes vulpes). In (J. A.Chapman and D. Pursley, eds.) Worldwide Furbearer Conference Proceed- ings. Vol. 2. pp. 918—949. University of Maryland Press, Maryland. Macdonald, D.W. 1983. The ecology of carnivore social behaviour. Nature 301 : 379—384. McCullough, D.R. 1982. Behavior, bears, and humans. Wildl. Soc. Bull. 10 :27—33. Murder, J.L. 1985. Spatial organization, movements and dispersal in a Dutch red fox (Vulpes vulpes) population: some preliminary results. Rev. Ecol. 40 : 133—138. Nature Conservation Society of Japan. 1978. Thinking about Feeding Wild Birds and Mammals - from Feeding to Environmental Conservation. Nature Conservation Society of Japan, Tokyo, 42 pp. (in Japanese). Nonaka, N., M. lida, K. Yagi, T.Ito, H.J.Ooi, Y.Oku and M. Kamiya. 1996. Time course of coproantigen excretion in Echinococcus multilocularis infections in foxes and an alternative definitive host, golden hamsters. Int. J. Parasitol. 26 : 1271—1278. Poulle, M. L., M. Artoris and J. J. Roeder. 1994. Dynamics of spatial relationships among members of a fox group (Vulpes vulpes: Mammalia: Carnivora). J. Zool., Lond. 233 : 93—106. Robinson, W. L. and E.G. Bolen. 1989. Wildlife Ecology and Management. Macmillan Publishing Company, New York, 574 pp. Sargeant, A.B., S.H. Allen and R. T. Eberhardt. 1984. Red fox predation on breeding ducks in mid-continent North America. Wildl. Monogr. 89: 1—41. Stubbe, M. 1980. Population ecology of the red fox Vulpes vulpes (L.1758) in the G. D. R. Biogeogra- puica tse 123 — 176: Sugiura, H., N. Agetsuma and T. Tanaka. 1993. Provisioned monkeys among wild population of Japanese macaques in Yakushima Island. Primate Res. 9 : 225—233 (in Japanese with English abstract). Tsukada, H. 1994. A study of the ecology of foxes in Shiretoko National Park and utilization for nature education programs. Bull. Shiretoko Museum 15:63—82 (in Japanese with English abstract). Tsukada, H. 1997. A division between foraging range and territory related to food distribution in the red fox. J sEthol 215227 — 31. 80 Mammal Study 22: 1997 Tsukada, H. and N. Nonaka 1996. Foraging behavior of red foxes Vulpes vulpes schrencki utilizing human food in the Shiretoko National Park. Mammal Study 21: 137-151. Wada, K. 1989. Some problems on and around the provisioning of Japanese monkeys. Honyurui Kagaku [Mammalian Science] 29:1—16 (in Japanese). Watanabe, K.and H. Tsukada. 1996. Survey of the history of feeding foxes, and on the attitude of tour operators towards the problem of feeding foxes in Shiretoko National Park. Bull. Shiretoko Museum 16: 11—24 (in Japanese). Wright, R.G. 1992. Wildlife Research and Management in the National Parks. University of Illinois Press, Urbana and Chicago, 224 pp. Yamashita, J. 1978. Echinococcus. Hokkaido University Press, Sapporo, 246 pp. (in Japanese). (accepted 22 May 1997) Mammal Study 22: 81-87 (1997) © the Mammalogical Society of Japan The age of sexual maturity in Japanese giant flying squirrels, Petaurista leucogenys Takeo KAWAMICHI Department of Biology, Osaka City University, Sugimoto, Sumtyoshi-ku, Osaka 558, Japan Fax. +81-75-551-3936, e-mail. pika @sci.osaka-cu. ac. jp Abstract. I determined the age of sexual maturity in Japanese giant flying squirrels, Petaurvista leucogenys. ‘The degree of tes- ticular development was estimated in 25 males 224 times during eight years. The scrotum began to extend at the age of 7.5-8.5 months, and was slightly swollen in males 8-13 months old. Testes of 1/2-3/4 size were observed in males from 14 months onward. By the mating season when they were 21-22 months old, the proportion with full-sized testes was 57% of the males. All five males of 27-28 months of age had full-sized testes. One 22 month-old male and one 27 month-old were observed copulating. Summer-born males had slightly faster developing testes than spring-born males. None of 19 young females were observed in estrus. The attainment of sexual maturity in males at 21-22 months of age seems very late as the intermediate-sized rodents. It is suggested that mothers allow their young to remain with them for 1-1.5 years until they become sexually mature in order to increase the survival rate of their young, thereby compensating for their small litter sizes of one or two. Key words: flying squirrels, Petaurista leucogenys, scrotum, sexual maturity, testis. Rodents achieve sexual maturity at a great range of ages, depending on the species. In general, sexual maturity is reached later in larger rodents than in smaller rodent species. Beavers, Castor canadensis, and marmots, Marmota monax, for example, which exceed 5 kg in body mass, do not become sexually mature until they are two years old, whereas small voles and mice weighing less than 100 g mature very early ; Microtus pennsylvanicus, for example, becomes sexually mature after 25-45 days (Bourliére 1964, Eisenberg 1981). Adult Japanese giant flying squirrels, Petaurista leucogenys, attain weights of up to 1.3 kg (Kawamichi 1996), and are therefore presumed to become sexually mature relatively late. Various aspects of the ecology of the essentially nocturnal Japanese giant flying squirrel have been investigated. These include: food habits (Ando et al. 1985a, Kawamichi 1997) ; feeding behavior (Ando et al. 1984, 1985b, Funako- shi and Shiraishi 1985), and activity rhythms (Baba ef al. 1982). No informat- ion has previously been available, however, on the age of sexual maturity in 82 Mammal Study 22: 1997 either captive or wild populations. The purpose of this paper, therefore, is to describe for the first time the age of sexual maturity in wild Japanese giant flying squirrels, and to discuss the factors affecting the age of sexual maturity in this species. MATERIALS AND METHODS The study area consisted of 0.65 km? (65ha) of mixed deciduous and coniferous temperate forest situated adjacent to Nara City, central Japan (34° AI’N, 135°50’E ; elevation 98-150 m), (see Kawamichi 1997). The climate of the study area is relatively mild, with snow falling occasionally in winter, but with snow-cover not lasting more than a few days. Research into the ecology and behavior of P. leucogenys was conducted at this site for eight years, from April 1983 to January 1991. 7 Hs : 5 a fs cel wl ¥ (in b , r aw = sat! 8 B re (an ; as | = Sih ad > s i= i Pod ae Al - H i = Cay Bs x i Wy yo} c nS i = ~ ne P 33 4 “\\ ae w the inating em claw ree ae ont es fe C a ee od a “ate 108 Re. vi dant: x 68. t genta: Tray ; bn bei ISR, moaaqgalyoe ie d chins ativritar | Tube 1 3 ot 99 sap Spl Pigs ‘grils’ i "ts the. interval between the twa ams! matin ‘patton ong Ste fie tsuki fait seth rast nies Th ay pe ahs t ie Oh a. fost: ay ara | ito lal aa a Rete ee) adsl. ‘i balay canbe Aare ha app er re rere ere Yor tiaibe aac fos ie. destiast att im SSHivHAR ik oot: Wedigeds eligde itr Va Seen Pt HH Bae Sese ge maa! a shanties ae aL! ot avrixel Oe wen yeoe tats wi ane. wit esnips at atinie hany wize” in. (Seorseaah wi) wigs ‘fexletediolu erg zy res sili pA BTTHE, RE & 39301) Ce Ri Ole beg 2 ze ih i ty ( , eee: pe a { » c . ; er ; me if “ 3 * i = ‘ q C—" ans “me Rite «% a vt ae ‘ ra Oy, ae nate yer + Gilpise tS : ote AY . a in} 9 R25 i BN tt ao sare Be Ye : tT ase a) ; ponte: : : ‘ wit: 4 , ees ¢ ; ! seta vs fe 23" iv! E 4 j } 3 wi ohh = - L 7 £ er ns) Pie Le : 5 Race. 4s t= as a3 i é | ; iN c : { oer ee yin E | : ‘ LS i. ; S.- " “j De a ‘ oe : : - a ‘ a ESA: F 5 3 - = 7 1 1 x 2 j 4 = 3 = rs . ‘ 2 . Lt 5 yi 4 FAA 2 of ; = : os ) J i ' & a { - = ‘ af “o5 — pate ed f Ele hy i ij rc! 2 N. is ‘ f i 4 ‘at oe rik etaas ay a) ig UA SY ire ere ts \y ult 3 > i bl ; ; = F; ; ql 7 * ati t= aks i Z ; = ' : } S + " j ae i y L\ 44 - G a, P : ‘ j £ ee ; ‘3 é 5 ‘ei ’ ae 5 i ae ; 3 ies, Ae . i ras _ ees 4 i= ar 4 . de . : “a J} — 4 Hs XY & 3 ‘ ane gy I "e , Gk eT ; , eeu E f t HG, Ree 3 qi y Ee a Mammal Study 22: 89-93 (1997) © the Mammalogical Society of Japan Structure of a breeding nest of the Daurian pika, Ochotona daurica, in Mongolia Takeo KAWAMICHI’ and Samdannyamin DAWANYAM? ! Department of Biology, Osaka City University, Sugimoto, Sumiyoshi-ku, Osaka 558, Japan Fax. +81-75-551-3936, e-mail. pika @sci. osaka-cu. ac. jp 2 Rodent Research Section, Mongolian Plant Protection Institute, Ulanbator, Mongolia Abstract. We excavated a breeding nest of the Daurian pika, Ochotona daurica, in central Mongolia. Four young were captur- ed within the burrows. Three food storage chambers contained plant fragments and a large amount of fecal matter, indicating that hoarded food had been consumed during the last winter. The nest chamber was spherical and measured 22*18xX21cm. Most of the nest chamber was filled with piles of grasses, and these piles were presumably their resting site. The burrow system had three entrances, and the nest chamber was connected to three burrows. Multiple nest entrances were provided ready access to refuge for pikas active on the ground surface from aerial and terrestrial predators, while multiple burrows also provide refuge against the intrusion of predators such as stoats into nest chambers. Key words: Daurian pika, food storage, nest burrows, nests, Ochotona daurica. The nest, or burrow system, has been described for four species of pikas in the genus Ochotona: O. daurica (Dmitriyev 1991), O. rufescens (Puget 1971), O. pallast (Simirnov 1974), and O. pusilla (Simirnov 1974). Although Dmitriyev (1991) revealed the distribution of nest chambers in the complicated burrow systems of a colony of O. daurica, for none of these four species, have the detailed structure of nest chambers, or breeding nests, been described. The Daurian pika, O. daurica, occurs commonly throughout grasslands or steppes in the south-eastern corner of west Siberia in Russia, the northern half of Mongolia, and northern China (Ognev 1940). Despite their extensive range, little information on their natural history has been gathered, other than details of their reproduction, vocalization, and of the hay piles accumulated at their nest entrances (Loukashkin 1940, Zevegmid 1975, Orr 1977, Dlamtcheren ef al. 1989, Dmitriyev 1991). The purpose of this paper, therefore, is to provide detailed information on the structure of a breeding nest of the Daurian pika, and to discuss the function of its complicated burrow system in steppe habitats. MATERIALS AND METHODS The study area was in the grassland at Baan-tsagaan Som (Village) (45°50’ 90 Mammal Study 22: 1997 Food chamber ——— Nest entrance Nest chamber O 60cm iN Fig. 1 Horizontal section of burrow system of Ochotona daurica consisting of one nest chamber, three vacant food chambers (hatched), and three nest entrances (large arrows). N, 99°30’E), 126km south-west of Bayan-hongor, Bayan-hongor Prefecture, central Mongolia. We located one breeding nest of O. daurica after observing that young pikas repeatedly entered and left a burrow entrance on 14 July 1992. The burrow system was excavated carefully with a shovel, a knife, and by hands, and measured to the nearest centimeter. Three-dimensional measurements are given as: length X width X height. RESULTS 1. Burrow system The burrow system had three entrances to the ground surface (Fig. 1). These entrances, measuring 5cm in diameter, gave access to sloping burrows which were 5-7 cm in diameter. In vertical section, the burrows were round with flat bottoms, and extended to a depth of 20-38 cm. The distance from the left entrance to the two entrances on the right (Fig. 1) was 280 or 290 cm. Three food storage chambers were detected. Two spherical chambers measured 21 X21 X*18cm and 22 x 22x20 cm, respectively. The ceilings of the two chambers were 20 and 21 cm below ground. The remaining chamber was 55cm long and 17 cm wide at its widest point. The three food storage chambers contained small quantities of plant fragments and a large amount of fecal matter which was not old, indicating that food had been hoarded and consumed during the winter of 1991-1992. Feces were only noticeable in these three food storage chambers and the corner of the nest chamber. Kawamichi and Dawanyam, Nest of Ochotona daurica 9] Ground surface Excrement O 20 cm (| Fig. 2. The structure of a nest chamber. The nest chamber was linked to the surface by three burrows; 4-5 layers of dry grasses were accumulated, and two mounds of feces were at the bottom. Prior to our excavation, an adult pika, presumably the mother, ran away from the burrow system. We were able to capture four young of similar sizes within the burrows (body weight 34.0+0.9 (SE) g; ear length 12.3+0.4 mm; hind foot length 22.5+0.5mm; total length 106.5+2.3mm, n=4). These observations indicated that this nest was being used for rearing young, and because of the large amount of feces found in the three chambers, we believe that this burrow system was in continuous use throughout the winter of 1991- 1992 and the spring of 1992. 2. Nest chamber The nest chamber was spherical and measured 22 X18X21cm. The ceiling of the nest chamber was 16cm below ground. The nest chamber was con- nected to three burrows each running in a different direction (Fig. 1). There were two mounds of feces in the corner of the nest chamber. Most of the nest chamber was filled with fibrous grasses as nesting material. These grasses, presumably the same as their food plants, included both leaves and roots. Most of these grasses were curled and intertwined, so that the piles formed a soft cushion. Piles of grasses (18x21x13cm) were composed of four or five layers (Fig. 2). The top layer consisted of a 4cm thick dried disk weighing 42g. The central part was depressed, and was 92 Mammal Study 22: 1997 presumably their resting site. The distance from the top layer to the chamber’s ceiling was 8cm. Lower layers were less dry, and indicated that O. daurica had repeatedly added fresh piles of nesting material on top of material which had lost its softness and/or become damp. DISCUSSION Ochotona pikas exhibit three types of habitat preference. They either occupy rocks, steppes, or habitats intermediate between these two (Kawamichi 1971, Smith 1988). Of the four species whose nests or burrow systems have been described, O. daurica (Dmitriyev 1991) and O. pusilla (Simirnov 1974) are “steppe dwellers”, and O. rufescens (Puget 1971) and O. pallasi (Simirnov 1974) are intermediate types. All four species have complex burrow systems with many entrances. Rock dwelling species inhabit rock slides, however their nests have not so far been described, because of the difficulty of excavating rock slides. Dmitriyev (1991) described the distribution of burrows in a colony of O. daurica. The largest burrow system had three nest chambers and 42 nest entrances within an area of 3.8 X 2.8 m (calculated from Dmitriyev’s [1991] Fig. 1). In both Zevegmid (1975) and Dmitriyev’s (1991) colonies, burrows were 5 cm in diameter, whereas they were 5-7 cm in this study. The diameter of the nest chambers was 27.622.5..(SE),cm, (range=22-36, .n=5, ,caleulated ) irom Dmitriyev’s [1991] Fig.1), which was similar to the 22cm of this study, although Zevegmid (1975) found them to be much smaller at 11-12 cm. Dmitriyev’s (1991) burrow system, extending 22-30 cm below the surface, was very similar in depth to ours (20-21 cm; this study), whereas Zevegmid’s (1975) burrow system was, at 11-12 cm, much shallower. O. daurica typically accumulates large amounts of hay at its nest entrances for winter food (Loukashkin 1940, Ognev 1940, Zevegmid 1975, Orr 1977, Dlamtcheren et al. 1989). By mid-July, however, when we excavated the nest, there were no signs of plant material accumulations around the nest entrances. We were, however, able to describe, for the first time, the existence of food chambers underground in this species, though this is by no means unique to the genus, as Puget (1971) has described a similar burrow structure with food chambers underground and accumulated hay piles at nest entrances for O. rufescens. Although the food storing capacity of O. daurica’s chambers does not seem to be great enough for the length of the winter in this region, the large amount of feces in the chambers suggests that they carried hay from the nest entrances into these chambers where they fed on it. It is considered that the complex burrow system serves important funct- ions. Pikas are often active above ground, thus having many nest entrances provided ready access to refuge from predators such as snowy owls, Nyctea scandiaca, corsac foxes, Vulpes corsac, wolves, Canis lupus, and particularly upland buzzards, Buteo hemilasius (Ognev 1940). Conversely, pikas under- ground are able to flee to the surface, escaping from ground predators such as Kawamichi and Dawanyam, Nest of Ochotona daurica 93 the stoat, Mustela erminea, which penetrates their burrow systems, by using one of the many burrows. Dmitriyev (1991) found each of six nest chambers to be connected to the surface by 2-3 burrows, as did we, and Simirnov (1974) found that O. pallasi chambers were similarly connected to the surface by three burrows and O. pusilla chambers by five burrows. These facts indicate that multiple burrows also provide refuge against the intrusion of predators into nest chambers. Acknowledgments : We are greatly indebted to Prof. Masao Onuki of Shiga University for participating in the Gobi Project, and to other members of this project for supporting our field study. REFERENCES Dlamtcheren, S., D. Tschendjav, and D. Avirmed. 1989. Animals of Mongolian People’s Republic, Mammals. Academy of Mongolian People’s Republic, Ulanbator, 160 pp (in Mongolian). Dmitriyev, P. P. 1991. Vegetation of holes of Daurian pika and their importance for steppe eco- systems. Jn (A.D. Bernstein and N. A. Formozov eds.) Ecology of Pikas of USSR. pp. 5—13. Publisher Nauka, Moscow (in Russian). Kawamichi, T. 1971. Daily activities and social pattern of two Himalayan pikas, Ochotona macrotis and O. roylei, observed at Mt. Everest. J. Fac. Sci. Hokkaido Univ., Ser. VI, Zool. 17 : 587— 609. Loukashkin, A. S. 1940. On the pikas of north Manchuria. J. Mammal. 21 : 402—405. Ognev, S. I. 1940. Mammals of the U.S.S. R. and Adjacent countries. Vol. IV. Rodents. (1966, Israel Program for Scientific Translations, Jerusalem). Orr, R. T. 1977. The Little Known Pika. Macmillan Publishing Co., Inc., New York, 144 pp. Puget, A. 1971. Ochotona r. rufescens (Gray, 1842) en Afghanistan et son elevage en captivite. Mammalia 35: 25—37. Simirnov, P. K. 1974. Biotopic distribution and territorial relationships of the steppe and the Pallas’s pikas in the sympatric zone of their ranges. Bull. Moscow Soc. Natur., Biol. Ser. 79 : 72—79 (in Russian). Smith, A. T. 1988. Patterns of pika (genus Ochotona) life history variation. Jn (M.S. Boyce, ed.) Evolution of Life Histories: Theory and Patterns from Mammals. pp. 233—256. Yale Univ. Press, New Haven. Zevegmid, D. 1975. Zur Biologie der Pfeifhasen (Ochotonidae) in der Mongolischen Volksrepublik. Mitt. Zool. Mus. Berlin 51 : 41—53. (accepted 23 June 1997) weneo en BE ORAS oA Bh leseribed, 0. danricn ‘ gies Bpe ¢ dwellers"; and Oratescen are iitOrrmediate Ys Pes Alt four. = Hany ehiraqces. Babcle dwell ng pedi rattitunydon welqaet: neitogrobenspthata roe imiegeoM od aq el aotednall) vildegest 2: 98 FINI, Sige i-riteds, Pape shine , * 10; aa sk ern Tat z shine ena ousaa apa nL is Rote cal | Gradrthaseyae aed aiken pint: "Sebi aN ac EL | aaa ee webre 1 nigga rhey ante 57 cet io this att ty, aes penaeN, sia ysiut sh ae } ae oe) a af, At: ey ae ide aie ng ban hy 4 ni a ahaa ii eee May al ae oF shania Ga meee’ agi Fannie eee VHD} eae 1% covabtn A tome AROE er } ce ss ag ie eh vests c¢ ‘arse ish et ee SaaS study, es geen Deigoaer. att ty n meeoiials bgt a bas gaiudtreth onqO! Wes) on li 4" " en On * 2. a iorit eS he eh eee Nos niet Hy Mae GTO" Hou Huh, Peale tai Le Ps ee es tee #69 we: Caste a a Vista mine fitt uae aay RG ; hw eae aAet- Rea sf ee oo Gea ener EDS Eee : antesie" n ve aos y 26 7 Pay me > cic Se hi ae % " ' web acs ie a he Te. ey os © ee vit wisi 5 } i ts o | as | Koen wz vs 2 orf yet iiluganalle if pedoaitoonh, any fi, Laahnde oiad af) reagtini 293); aigole ihe , sae " : : > a ae a edt +S xy a 5 sal by i ' ‘ era - r - hOhiaeet & it} es Ce € é. it a . 4 i Z ir? i, t “4 _ ts : i Sey re a _ Diy yore ee ‘Pr ) 3 iar ee rei 4 - BD eeans - : (sy = RED T UC ce Stee eae: SRIORR Sp is ES: pps) * oY hey Palate act arr ve * = ; F ; ) JM 1992 1993 1994 Fig. 1. Seasonal changes in the composition of fruit bats captured by mist net. Abbrevia- tions: C. b.=Cynopterus brachyotis ; C. h.=C. horsfieldi. 98 Mammal Study 22: 1997 (Fig. 1). The other seven species, Rousettus amplexicaudatus, Macroglossus sobrinus, Balionycteris maculata, Eonycteris spelaea, Megaerops ecaudatus, Chiro- nax melanocephalus, and Penthetor lucasii, were far less abundant and were only captured occasionally in the study area. Adult C. horsfieldi were found to be both significantly larger (t-test, p< 0.001 applied to forearm length), and significantly heavier (t-test, <0.01) than adult C. brachyotis, and females of both species averaged larger and heavier than their respective males. Adult male C. horsfieldi had forearms measuring 74.343.1 (SD) mm, and they weighed 56.7+6.1 (SD) g (n=19), while adult females measured 75.1+2.3 mm and weighed 59.7+6.9 g (n=26). Adult male C. brachyotis measured 60.542.4 mm, and weighed 30.6+3.8 g (7=23), whereas adult females measured 61.442.5 mm and weighed 33.1+4.0 g (n=40). 2. Day roosts The daytime roosts of Cynopterus horsfieldi were found mainly in the eastern portion, or along the periphery, of the study area (Fig. 2). They roosted in trees, preferring the axilla of palm fronds of trees such as Cocos nucifera and Corypha sp. There were fewer than 20 palm trees over five metres tall in the study area. Two radio-tagged male C. horsfieldi changed roosts every 1-7 days, while four radio-tagged females changed roosts less often (every 3-14 days). The day roosts of C. brachyotis were mostly in dense foliage more than five metres above ground either in trees, such as Durio zibethinus (Bombacaceae) or in bamboos such as Gigantochloa scortechenit (Bambusoideae). Roosts were abundant, widely scattered in the study area with many being difficult to locate precisely due to the dense foliage, and they mostly occurred in trees other than palms (Fig. 2). Three radio-tagged male C. brachyotis made only transient use of foliage roost sites, occupying each site for only 1-5 days before moving on to another site. One of the males changed its roost almost everyday (Fig. 3). Gombak River 0 50m Fig. 2. Location of day roosts of Cynopterus brachyotis (W) and C. horsfieldi (V’) tracked in July-August 1993. P=palm trees where bats roosted. Funakoshi and Zubaid, Ecology of dog-faced fruit bats 99 Fig. 3. Flight movements of an adult male Cynopterus brachyotis between 28 July and 12 August 1993. Locations of day roosts are indicated by solid triangles and those of feeding sites or resting rooosts by open triangles. Figures show the successive days on and after 28 July 1993. In contrast, four radio-tagged female C. brachyotis changed roosts only every 2 -13 days, with most only occasionally changing their roosts. 3. Nocturnal activity patterns Activity patterns were ascertained from the numbers of captures made during the night. Cynopterus brachyotis were most active within an hour after sunset (Fig. 4), with activity declining somewhat as the night progressed, whereas C. horsfieldi were most active from two to four hours after sunset, and again three hours before sunrise (Fig. 4). 4. Food habits and feeding sites The dominant fig species in the study area was Ficus variegata (Moraceae), with a mean density of 1.5 large trees (about 30m tall) per hectare. These trees fruited asynchronously, and the ripe fruits were produced on a recurrent cycle of five to eight months, the average being seven months (~=6). Piper aduncum (Piperaceae) trees were also common, occurring on the edge of the forest along the river or the road, and fruited throughout most of the year. Figs featured heavily in the diet of C. horsfteldi in the Ulu Gombak study area throughout the year, with 88% of 32 feces containing fig seeds in July- August 1993. Piper aduncum seeds were never found in C. horsfieldi feces, perhaps because, owing to their weight, it was difficult for these bats to hang from the thin fruit-bearing branches of P. aduncum. The bulk of the diet of C. 100 Mammal Study 22: 1997 20 ‘ —e— Cb. (N=502) @ Ch. (N=155) 2 = =) c >) a 10 fe c @ oO he ® ra 0 0 2 4 6 8 10 V2 Hours after sunset Fig. 4. Temporal activity patterns of Cynopterus brachyotis (C. 6.) and C. horsfieldi (C. h.). The graph is based on the percentage of the total number of bats captured at hourly intervals from 1992-1994. brachyotis consisted largely of the soft fruits of Ficus variegata, F. viridicarpa and Piper aduncum, and the flowers of Duvio zibethinus (Bombacaceae). Leaf pellets were also found occasionally under its feeding sites, however the species could not be identified. Small fig and P. aduncum seeds were frequently found in C. brachyotis feces, with fig seeds comprising 71%, and P. aduncum seeds comprising 25% (by number of identifiable seeds) of 48 feces in July-August 1993. Neither species of bat ate fruits in fruiting trees. Instead they carried them from the foraging site to a feeding site in a neighboring tree. Such feeding sites were located by direct observation and radio tracking, or indirect- ly by searching for pellets regurgitated by the bats and which fell beneath the feeding site. The wet weight of the figs carried (into mist nets) by C. horsfieldi on their way to feeding sites were significantly heavier than those carried by C. brachyotis (Mann-Whitney U-test, U=4, p< 0.01). Those carried by C. hors- fieldi averaged 17.8+5.7 (SD) g (n=9), while those carried by C. brachyotis averaged 7.94+2.5 g (n=11). When a fig was too heavy to be carried, the bats bit off pieces and carried them in their mouths. Although there was no significant difference between the maximum diam- eter of disc-shaped pellets regurgitated by the two species (Mann-Whitney U-test, Z=—1.76, p<0.05), fresh pellets from C. horsfieldi were significantly heavier than those from C. brachyotis (Mann-Whitney U-test, Z=—3.73, p< 0.001). Fresh pellets produced by C. horsfieldi averaged 17.0+1.3 (SD) mm in Funakoshi and Zubaid, Ecology of dog-faced fruit bats 101 maximum diameter and weighed 123.3425.3 mg dry weight (~=15), whereas those of C. brachyotis averaged 15.9+1.3 mm and 94.4+19.0 mg (n=41). The distances between Ficus variegata trees bearing ripe fruits and neighb- oring feeding sites averaged 59.4+14.1 (SD) m (v=21) and 78.3+21.8 m (n=12) in July and August 1993, and 50.4+21.7 m (n=11) in March 1994 (Fig. 5). The shortest distances between F. variegata trees averaged 35.1414.6 (SD) m (v=9). The height of the branches used by bats as feeding sites averaged 3.34+1.0 (SD) m (v=14) above the ground. O 50m Fig.5. Location of feeding sites of Cynopterus brachyotis (open triangles) and C. horsfieldi (solid triangles) during (a) July and August 1993 and (b) March 1994. The locations of Ficus variegate trees bearing ripe fruits, and trees not bearing ripe fruits are indicated by open circles and solid circles, respectively. 102 Mammal Study 22: 1997 5. Home ranges The distances travelled by Cynopterus horsfieldi were significantly further than those travelled by C. brachyotis (Mann-Whitney U-test, U=1, p< 0.01). These measurements were based on the means of the greatest distances trav- elled by each radio-tracked individual over 12 days, which were 475+105 (SD) m (n=6) for C. horsfieldi, and 295+55 m (n=7) for C. brachyotis. The overlap of home ranges, both within and between species, was high (Fig. 6), however the home ranges of both male and female C. horsfieldi were significantly larger than those of C. brachyotis (Mann-Whitney U-test, U=2, p<0.01). Home ranges of adult male C. horsfieldi averaged 8.0 ha (n=2) while those of adult females averaged 5.8+2.5 ha (n=4), whereas in C. brachyotis, adult male home ranges averaged 3.1 ha (x=3) and adult female ones averaged 3.2+1.4 ha (n= 4). 6. Reproductive cycles Female Cynopterus horsfieldi in the later stages of pregnancy, and lactating females and young, were captured intermittently throughout the year, with percentages fluctuating aseasonally (Fig. 7). Although the main pregnancy peaks apparently occurred in four to six month cycles, the cycle of the occur- rence of lactating females could not be clearly identified because of our small sample size. Female C. brachyotis in the later stages of pregnancy, and young, were captured almost every month with the percentage fluctuating aseasonally (Fig. 7). Lactating females, however, were captured only intermittently, with lacta- tion peaks apparently occurring in three to four month cycles. Female A005 100m Fig.6. The home ranges of three adult male (a), and four adult female (b) Cynopterus brachyotis, and of two adult male (c), and four adult female (d) C. horsfieldt. Funakoshi and Zubaid, Ecology of dog-faced fruit bats 103 Af 0 ZO Uo 44) Seo AZ Zee) 33) ASS) Zoe) Bars 2S 16 Percent by number a8) Sill la coglel Ful Opes is eA te SiSie Girt al Aves 2) 212 7 Percent by number ug Fig. 7. Seasonal changes in the composition of late-pregnant females (Lpf), lactating females (Lf) and young (Y) in Cynoperus brachyotis (a) and in C. horsfieldi (b). Data are based on the ratios of the number of late-pregnant females, and lactating females, to adult females, and the ratio of the number of young to the total catch every month. Monthly sample sizes are indicated above graphs. was heavily pregnant when caught and banded on 17 August 1992, and was lactating when recaptured on 21 December 1992, while female A292, also heavily pregnant when caught on 24 May 1993, was again in the same reproduc- tive condition when recaptured on 8 October 1993. DISCUSSION 1. Day roosts The daytime roosts of Cynopterus horsfieldi and C. brachyotis are quite 104 Mammal Study 22: 1997 different. Whereas C. brachyotis usually roost in pairs, or in small groups, in trees, under leaves, and occasionally in the twilight areas of caves (Lim 1966, Lekagul and McNeely 1977, Medway 1983, Payne et al. 1985, Mickleburgh e¢ al. 1992), and in our study area, under fronds near the trunk and beneath the crowns of various trees, C. horsfieldi on the other hand is more gregarious and often roosts in shallow caves or rock shelters, and occasionally in trees, especially palms (Lim ef al. 1974, Medway 1983, Payne et al. 1985). These differences in roost site preference were also noted in the Ulu Gombak study area. Most C. brachyotis roosts were in trees other than palms, while those of C. horsfieldi were sparsely distributed because of the small number of palms and the absence of cave or rock shelter roost sites. Furthermore, C. horsfteld’s pattern of roost site distribution may also result from the scarcity of sites to accommodate their larger size, and larger roost numbers. Males of both species frequently changed their roost sites, while most of the females rarely changed theirs. Such differences between the sexes have also been shown to occur in the phyllostomid bat, Artibeus jamaicensis (Morrison 1978, Morrison and Handley 1991). According to Lekagul and McNeely (1977), C. horsfieldi and C. brachyotis often share roosts, however it remains to be determined just how many individuals typically occur in these aggregations. 2. Activity patterns during the night The temporal activity patterns of Cynopterus horsfieldi and C. brachyotis differ greatly. The initial peak of flight activity of C. brachyotis after sunset was one or two hours earlier than that of C. horsfieldi. After the first peak, C. brachyotis’s activity gradually declined during the night, whereas activity among C. horsfieldi decreased around midnight, but then increased again three hours before sunrise. Radio-tracking data indicate that the smaller C. bra- chyotis is more active during the night than the larger C. horsfieldi, with C. brachyotis moving around frequently, and with some individuals being captured and recaptured in the same night. The activity patterns of C. brachyotis are somewhat similar to those of Carollia perspicillata (Heithhaus and Fleming 1978, Fleming and Heithhaus 1986). Radio-tracked C. perspicillata fed intensively during their first activity period, then settled down to a routine of about one feeding bout per hour (Fleming 1988). In contrast, the basic activity pattern of C. horsfieldi may be bimodal with a resting period around midnight. 3. Food habits and fig seed dispersal It seems that C. horsfieldi has a narrower dietary range than C. brachyotis, with the former depending almost entirely on fruits as food (Lekagul and McNeely 1977, Medway 1983, Payne et al. 1985, this study), while the latter eats a wide range of fruits weighing 0.4-68.2 g (Boon and Corlett 1989) but also takes flowers, nectar, pollen, leaves and insects (Lim 1970, Medway 1983, Marshall 1985, this study). Among frugivorous New World Phyllostomid bats there is a high correlation between body weight and the weight of fruits carried away (Bonaccorso 1979). This correlation is also apparent when examining C. Funakoshi and Zubaid, Ecology of dog-faced fruit bats 105 horsfieldi and C. brachyotis, with the larger former species carring off fruits averaging 17.8g, whereas the smaller latter species only carries off fruit averaging 7.9g. Such size differences may play an important role in the partitioning of food resouces among similar species of fruit bats occurring sympatrically. In our study, the average distance between fruiting trees and feeding sites was 50-78 m, while in a young secondary forest in Singapore it was within 100 m (Boon and Corlett 1989). As the home ranges of C. horsfieldi are larger than those of C. brachyotis, we assume that C. horsfieldi transport figs further from foraging sites than do C. brachyotis, though we have insufficient data to prove this. In our study area, the shortest distance between Ficus variegata trees with heights of 30m or more averaged only 35m. Cynopterus were the most frequently mist-netted bats in the Ulu Gombak study area. Of the 754 fruit bats of nine species captured, 87.1% were Cynoptrus species. Similarly, Cynopterus comprised about 70% of the fruit bats captured at Bangi, a frag- mented secondary forest site, but only 39% at Kuala Lompat, a primary forest site (Zubaid 1993, 1994). Thus it seems that Cynopterus species predominate in secondary forest. In addition to the suite of frugivores birds and arboreal mammals to be found in forests, frugivorous bats such as these Cynopterus species are likely to be important seed-dispersal agents for fig trees, enabling such trees to quickly invade a gap or disturbed forest. 4. Home ranges In both species, the greatest movements measured equalled the distances between the day roosts and feeding sites. In the Ulu Gombak study area the mean distance of 295m moved by C. brachyotis was much shorter than by the Same species in Philippine submontane rainforest (650m; Heideman and Heaney 1989). This difference between sites may result from the fact that our 15 day period of radio-tracking was much shorter than the length of time between captures (10-100 days) in the Philippine study, or from the fact that fruiting trees or feeding areas were closer to the day roosts at our site. In addition, home ranges in the Phillippines may have shifted during those periods. The mean distance moved by C. horsfieldi was significantly further than that of C. brachyotis. The home ranges of individuals of both species overlapped, suggesting that neither roosting sites nor food resources were limiting, and thus eliminating the need for the bats to hold territories. The estimated home range sizes may, however, be somewhat smaller than the actual sizes, because of the short periods of radio-tracking. Whereas Heideman:-and Heaney (1989) estimated that the population density of C. brachyotis in primary submontane forest on Negros Island was only 0.2 individuals per hectare, in our secondary forest study area, C. brachyotis densities were very high (Funakoshi and Zubaid, unpublished) and home ranges were very small. Such high densities at Ulu Gombak may be associated with the abundance of roost and food resources. 106 Mammal Study 22: 1997 5. Reproductive cycles Pregnant female C. brachyotis and C. horsfieldi have been captured in all months, suggesting that breeding is non-seasonal (Lim 1970, Medway 1983). Lim (1970) found that peaks in pregnancies among C. brachyotis occur in January, May, and September at the same latitude in Malaysian rainforest as our study area. Such seasonal peaks differ, however, from those in our Ulu Gombak study area where the timing of peaks of pregnancy and lactation vary from year to year. As for the effects of environmental factors on reproduction, Lim (1970, 1973) found that the highest frequency of pregnancy coincided with the greatest availability of fruits. In the Ulu Gombak study area, it seems that female C. brachyotis may produce two or three young each year. This assumption is based on the main pregnancy and lactation peaks (Fig. 7a), and the fact that female A292 had just one reproductive cycle between late May and early October, and female A005 had the opportunity to produce two young between mid August and mid December. On the Philippine island of Luzon, at 14°N, C. brachyotis reproduce seasonaly with two birth periods per year (Ingle 1992). On Negros Island (9°22’ N), the length of gestation in C. bvachyotis is approximately four months, and lactation lasts for about 6-8 weeks (Heideman 1987). At lower latitudes, such as at our study area, both gestation and lactation periods may be shorter because of the short reproductive cycle at Ulu Gombak. Most female C. brachyotis become pregnant at about 6-8 months of age, while males become sexually mature at about one year old (Heideman 1987, Mickleburgh e¢ al. 1992). In C. horsfieldi, the peaks of pregnacies occurred in 4 to 6 month inter- vals, with most females probably producing two young per year (Fig. 7b). The ages of sexual maturity of this species, however, remain unknown. The relatively short reproductive cycle of female C. brachyotis may be one of the factors contributing to the greater size of their populations. In conclusion, both C. brachyotis and C. horsfieldi are abundant in partially disturbed rainforest, and can coexist in the same habitat through differences in roost site selection and partitioning of food resources in relation to their different body sizes. Cynopterus brachyotis predominates, probably because of the abundance of roost sites and food resources and its more rapid rate of reproduction with two or three litters per year. Acknowledgments : We thank Drs Y. Tsubaki and H. Nagata of the National Institute for Environmental Studies for their encouragement and valuable advice, Dr H.I. Azarae of the University of Malaya for permission to use facilities there, and Messrs S. Ripin and S. Dali for assistance in the field. We are also indebted to Mr T. Kirwan and other staff of the Field Study Center, University of Malaya for help with field research, and to Mrs B. Andre for comments on the manuscript. This work was supported in part by grants from the National Institute for Environmental Studies of Japan. Funakoshi and Zubaid, Ecology of dog-faced fruit bats 107 REFERENCES Bhat, H.R. 1994. Observations on the food and feeding behaviour of Cynopterus sphinx Vahl (Chiroptera, Pteropodidae) at Puna, India. Mammalia 58 : 363—370. Bonaccorso, F. J. 1979. Foraging and reproductive ecology ina Panamanian bat community. Bull. Florida State Mus., Biol. Sci. 24 : 359—408. Fleming, T. H. 1988. The Short-tailed Fruit Bat. University of Chicago Press, Chicago, 365 pp. Boon, P. P. and R. T. C. Corlett. 1989. Seed dispersal by the lesser short-nosed fruit bat (Cynopterus brachyotis, Pteropodidae Megachiroptera). Malay. Nat. J. 42: 251—256. Fleming, T. H. and E. R. Heithaus. 1986. Seasonal foraging behavior of Carollia persipicillata (Chiro- ptera: Phyllostomidae). J. Mammal. 67 : 660—671. Heideman, P. D. 1987. The reproductive ecology of a community of Philippine fruit bats (Megachiro- ptera, Pteropodidae). Ph.D. thesis, University of Michigan, Ann Arbor, 320 pp. Heideman, P. D. and L. R. Heaney. 1989. Population biology and estimates of abundance of fruit bats (Pteropodidae) in Philippine submontane rainforest. J. Zool., Lond. 218 : 565—586. Heithaus, E.R. and T.H. Fleming. 1978. Foraging movements of a frugivorous bat, Carollia per- spicillata (Phyllostomatidae). Ecol. Monogr. 48 : 127-143. Heller, K.G. and M. Volleth. 1989. Fledermadse aus Malaysia. 1. Beobachtungen zur Biologie, Morphologie und Taxonomie (Mammalia: Chiroptera). Senckenbergiana Biologica 69: DAS 210. Ingle, N. R. 1992. The natural history of bats on Mt. Makiling, Luzon Island, Philippines. Silliman jeso l= 26. Jones, C. 1972. Comparative ecology of three pteropid bats in Rio Muni, West Africa. J. Zool., Lommel 1O¢2 S33 si) Kitchener, D. J., A. Gunnell. and Maharadatunkamsi. 1990. Aspects of the feeding biology of fruit bats (Pteropodidae) on Lombak Island, Nusa Tenggara, Indonesia. Mammalia 54 :561—578. Krishna, A. and C. J. Dominic. 1983. Growth of young and sexual maturity in three species of Indian bats. J. Anim. Morphol. Physiol. 30 : 162—168. Lekagul, B. and J. A. McNeely. 1977. Mammals of Thailand. Kurusapha Ladprao Press, Bangkok, 758 pp. Lim, B. L. 1966. Abundance and distribution of Malaysian bats in different ecological habitats. Federation. Mus. J. 11 :62—76. Lim, B.L. 1970. Food habits and breeding cycle of the Malaysian fruit-eating bat, Cynopterus brachyotis. J. Mammal. 51: 174—177. Lim, B. L. 1973. Breeding pattern, food habits and parasitic infestation of bats in Gunong Brinchang. Malay, Nate J26=6— 13) Lim, B.L., C.K. Shin and I. Muul. 1974. Notes on food habits of bats from the fourth division, Sakawdke | oarawak Minus) J. 20 235i 3517. Marshall, A.G. 1970. The life cycle of Baszlia hispida Theodor 1967 (Diptera: Nycteribiidae) in Malaysia. Parasitology 61:1—18. Marshall, A.G. 1985. Old World Phytophagous bats (Megachiroptera) and their food plants: a survey. Zool. J. Linn. Soc. 83 : 351—369. Marshall, A.G. and A. N. McWilliam. 1982. Ecological observations on epomorphorine fruit-bats (Megachiroptera) in West African savanna woodland. J. Zool., Lond. 198 :53—67. Medway, L. 1972. Reproductive cycles of the flat-headed bats Tylonycteris pachypus and T. robustula (Chiroptera: Vespertilioninae) in a humid equatorial environment. Zool. J. Linn. Soc. 51: 33-01. Medway, L. 1983. The Wild Mammals of Malaya (Peninsular Malaya) and Singapore. 2nd ed. Oxford Univ. Press, Kuala Lumpur, 131 pp. Mickleburgh, S. P., A. M. Hutson and P. A. Racey. 1992. Old World Fruit Bats: An Action Plan for their Conservation. IUCN, Gland, Switzerland, 252 pp. Mohr, C.O. 1947. Table of equivalent populations of North American small mammals. Amer. 108 Mammal Study 22: 1997 Midl. Nat. 37 : 223—249. Morrison, D. W. 1978. Foraging ecology and energetics of the frugivorous bat A7tibeus jamaicensis. Ecology 59 : 716—723. Morrison, D. W. and C. O. Handley. 1991. Roosting Behavior. Jn (C.O. Handley., D. E. Wilson and A. L.Gardner, eds) Demography and natural history of the common fruit bat, Avtibeus jamaicensis, on Barro Colorado Island, Panama. pp. 131-135. Smithsonian Institution Press, Washington. Payne, J., C.M. Francis and K. Phillipps. 1985. A Field Guide to the Mammals of Borneo. The Sabah Society, Sabah, 332 pp. Sandhu, S. 1984. Breeding biology of the Indian fruit bat, Cynopterus sphinx (Vahl) in central India. J2Bombay Nat Hist Soe cilyac00=.o12: Wolton, R.J., P. A. Arak, H.C. J.Godfray and R.P. Wilson. 1982. Ecological and behavioural studies of the Megachiroptera at Mount Nimba, Liberia, with notes on Microchiroptera. Mammalia 46: 419—448. Zubaid, A. 1993. A comparison of the bat fauna between a primary and fragmented secondary forest in Peninsular Malaysia. Mammalia 57 : 201—206. Zubaid, A. 1994. Vertical stratification of pteropodid bats in a Malaysian lowland rainforest. Mammalia 58 : 309—311. (accepted 23 June 1997) 109 ERRATUM The following table was omitted from Asada and Ochiai’s paper in Mammal Study 21(2) and should have been inserted on page 157. Table 1. Number of sika deer of conceiving before and after mid October on Boso Peninsula, central Japan. Maternal age Conception periods 1-year-old 2 and 3-year-old 4-year-old and more __ Total Sep. to mid. Oct. 10 47 91 148 Late Oct. to Dec. i) il} 7 20 Total 12 58 98 168 INSTRUCTIONS TO CONTRIBUTORS The Mammal Study (the continuation of the Journal of the Mammalogical Society of Japan) publishes original Articles and Short Communications, written in English, on all aspects of mammalogy. In principle, membership of the Society is a prerequisite for the submission of papers, but non-members may be co-authors. Manuscripts are submitted to qualified referees for critical scientific reviewing. Authors are notified, with referees’ comments, on acceptance, rejection or need for revision. The editor also customarily sends manuscripts to qualified reviewers for English editing. Manuscripts should be submitted typewritten on one side of the paper (use A4 21.0 cm X 29.7 cm paper), and double-spaced. An approximately 3 cm margin should be left on all sides. Do not hyphenate words at the right margin. Manu- scripts should be arranged in the following order: the title, name(s) of author(s) and affiliation, fax number and E-mail number if available, abstract (fewer than 200 words) and key words (five words or fewer), main text, acknowledgments, references, tables, figure legends, figures. Titles of papers must be accurate and concise, and (for abstraction services) include any relevant taxonomic name. A Japanese title and a Japanese abstract should be written on separate sheets. Text pages should be numbered through from title to references. Manuscripts should be line-numbered, every five lines, in the left margin. Short Communications do not exceed four printed pages. Abstracts and key words are omitted from Short communications. Tables and figures should be simple and self-explanatory, and their preferred locations should be indicated in the right margin of the text. The ratio of tables and figures to text pages cannot exceed 1:2 and they should be as few as possible. The author’s name and figure numbers should be written on the back of original figures and on the surface of copies. Scientific names should be underlined. All measurements should be in metric units. The following abbreviations should be used. Length: km, m, cm, mm, etc. ; ahead tics etce volume: km®, m*, kl, | mil~ete.> weight: ke, s, me, etc. ; time: hr, min, sec, etc.; others: cal, kcal, C, Hz, p (probability), SD, SE, etc. Arabic numerals should be used for numbers exceeding 10. References in the text should follow the forms: “Uchida and Shiraishi (1985) stated that ...” (Abe and Kawamichi 1990), and (Miura et al. 1993). More than one reference within the same parentheses should be listed chronologically, alphabeti- cally if of the same year. Full references cited must be listed alphabetically by the first author according to the following examples: Abe, H., S. Shiraishi and S. Arai. 1991. A new mole from Uotsuri-jima, the Ryukyu Islands. J. Mamm. Soc. Japan 15: 47—60. Eisenberg, J. F. 1981. The Mammalian Radiations. Univ. of Chicago Press, Chicago, 610 pp. Geist, V. 1982. Adaptive behavioral strategies. Jn (J.W. Thomas and D.E. Toweill, eds.) Elk of North America. pp. 219—277. Stackpole, Harrisburg. Obara, Y. 1991. Karyosystematics of the mustelid carnivores of Japan. Honyurui Kagaku [Mammalian Science] 30: 197—220 (in Japanese with English abstract). Authors are recommended to refer to recent issues of the journal for details of style and layout. Manuscripts should be submitted in triplicate, with a separate sheet giving the title, author(s) name(s) and address(es) for editorial correspondence, a running head (fewer than 20 letters), the numbers of main text pages, tables and figures, and the number of copies of reprints requested. Galley proofs will be sent to the author. Reprints may be purchased in blocks of 50. Mammal Study | i ee Vol. 22, Nos. 1/2 December 1997 CONTENTS FOREWORD is/algaia orale eceiaere has eidve orclencle tee bVorerlove avsin eles oPPaare ele We -a'e'eie alte iciee aa eee eee at ee seresecerene | . MEMORIAL PAPERS FOR DR H. ABE > Ishibashi, Y:, & Saitoh, S- Abe and M. C. Yoshida: Cross- -species amplificsamae of microsatellite DNA in Old World microtine rodents with PCR primers forse a oar the gray- -sided vole, Clethrionomys rutocanus ie ele ee 9\e/ewisicle solu «/sla\e/s/elole\eintete apatateletelateteeaetiats 7 ate) 5 i Ohdachi, S: Laboratory experiment on spatial use and aggression in three "sympatric species of shrew in Hokkaido, Japan oils doteedescterer ee SSee aes 20>: zosc]liL : Saitoh, T. and A. Nakatsu : The impact of forestry on the small rodent commu- nity of Hokkaido, Japan vcrrvrreererreeeee crete teeeeeetetecseeeceneeececeeees os a0res aa oT. Takahashi, K. and K. Satoh: Growth of eye lens weight and age estimation ite the northern red-backed vole, Clethrionomys rutilus -cvttttttttttt ete steeees 39 MEMORIAL PAPERS FOR DR S. SHIRAISHI - Ando, A. and S. Shiraishi: Age determination in the Smith’s red- backed oole oe Eothenomys smithii, using optic lens weight Sieleleleie/ele jo. 06,0 6 «0 ce 0c sine sleclsivcielcialsiole seeeeeeeeeA5 Yoshinaga, Y., W. Ohno and S. Shiraishi: Postnatal growth, development and ultrasonic vocalization of young Japanese field voles, Microtus montebelli:+-53 ORIGINAL PAPERS = Tsukada, H: Acquisition of food begging behavior by red foxex in the Shire- toko National Park, Hokkaido, Japan ree scne beds orn eet ee eters 71 Kawamichi, T: The age of sexual maturity in Japanese giant flying squirrels, amare ‘and S: pace ae Struct ofa breeding nest in the Daurian pika, Ochotona daurica, in Mongolia -stterrttteestteeettteees ana nbsines Sane eee B89 Funakoshi, K. and A. Zubaid: Behavioural and reproductive ecology of the ; dog-faced fruit bats, Cynopterus brachyotis, and C.horsfieldi, in a ~— Malaysian rainforest siesenensseseeesseessseensssesseseneseeesceseressssessecerecstececeresenssnsQh The Mammalogical Society of Japan ISSN 1343-4152 The Continuation of the Journal of the Mammalogical Society of Japan THE MAMMALOGICAL SOCIETY OF JAPAN OFFICERS AND COUNCIL MEMBERS FOR 1997 - 1998 President : Hisashi Abe Secretary General : Takashi Saitoh Executive Secretary : Keisuke Nakada Treasurers : Seiji Ohsumi, Toshiro Kamiya Council Members: Noriyuki Ohtaishi, Koichi Kaji, Yukibumi Kaneko, Takeo Kawamichi, Takashi Saitoh, Seiki Takatsuki, Teruo Doi, Kimitake Funakoshi, Kashio Maeda, Shingo Miura, Okimasa Murakami, Takanori Mori, Kazuo Wada The Mammalogical Society of Japan publishes original papers in two journals: the Mammal Study (the continuation of the Journal of the Mammalogical Society of Japan) for papers written in English, and Honyurui Kagaku |Mammalian Science] for those submitted in Japanese. Each jour- nal is published twice a year. Submissions are considered on the understand- ing that they are being offered solely for publication by the Mammalogical Society of Japan. In principle, authors submitting articles to the journals should be members of the Mammalogical Society of Japan. Both journals are distributed free of charge to the members of the Society. The following are the annual dues for the membership : Domestic members ¥7,000 (Student ¥6,000) Overseas members US $60.00 Institutional subscriptions ¥20,000 All correspondence regarding application for membership, subscription, address change, and other matters should be addressed to: The Mammalogical Society of Japan Business Center for Academic Societies of Japan, Academic Society Center C21, 16-9 Honkomagome, 5-chome, Bunkyo-Ku, Tokyo 113, Japan Mammal Study : the continuation of the Journal of Mammalogical Society of Japan Editor-in-Chief : Seiki Takatsuki Editorial Secretary : Yukihiko Hashimoto, Masamichi Kurohmaru Editorial Board: Mark A. Brazil, Hideki Endo, Hirofumi Hirakawa, Toshio Kasuya, Takeo Kawamichi, Shingo Miura, Takashi Saitoh, Hitoshi Suzuki, Hidetoshi Tamate All correspondence regarding manuscripts and editorial matters should be addressed to : Dr. Seiki Takatsuki The University Museum, The University of Tokyo, Hongo 7-3-1, Bunkyo-ku, Tokyo 113, Japan : Fax. +81-3-3815-7053, e-mail. taka@um.u-tokyo.ac.jp Mammal Study 23: 1-8 (1998) © the Mammalogical Society of Japan The functional anatomy of the masticatory muscles of the Malayan pangolin, Manis javanica Hideki ENDO, Isao NISHIUMI, Masamichi KUROHMARU’, Jarujin NABHITABHATA?, Tanya CHAN-ARD’, Nivesh NADEE?, Srihadi AGUNGPRIYONO%, and Junzo YAMADA° Department of Zoology, National Science Museum, Tokyo, Tokyo 169-0073, Japan ‘Department of Veterinary Anatomy, Faculty of Agriculture, The University of Tokyo, Tokyo 113 -8657, Japan 2 Natural Science Research Division, National Science Museum, Thailand, Bangkok 10900, Thailand 3Energy and Environment Research Department, Thailand Institute of Scientific and Technological Research, Bangkok 10900, Thailand “Department of Veterinary Anatomy, Bogor University of Agriculture, Bogor 16152, Indonesia >Department of Veterinary Anatomy, Faculty of Agriculture, Obthivo University of Agriculture and Veterinary Medicine, Hokkaido O80-8555, Japan Fax. +81-3-3364-7104 Abstract. The masticatory muscles of the Malayan pangolin, Manis javanica, were observed in dissection, and relative positions of the cranium and the mandible were examined under soft-X ray photographs. The WM. temporalis was well-developed in the medial area of the zygomatic process of temporal bone. The /. masseter was found to consist of three large well-developed bun- dles between the zygomatic arch and the mandible. Based on these observations, it is suggested that the thin V-shaped mandible may act as a substantial support in the ventral portion of the oral cavity, and that the M. masseter and M. temporalis may serve to help fix the shape of mouth, when the pangolin uses the specialized tongue for feeding. We demonstrated that the M. digastricus is at least functionally able to depress and open the mandible. In addition, the well-developed M. mylohyoideus may contribute to the control of intraoral pressure during mastication. Key words: digastric muscle, mandible, masseter muscle, pangolin, temporal muscle. Although the tongue structure of pangolins has attracted the interest of a number of anatomists (Ehlers 1894, Edgeworth 1923, Sonntag 1923, 1925, Lubo- sch 1938, Kubota et al. 1962, Saban 1968, Doran and Allbrook 1973, Yen 1984, 1985, Chan 1995), who have pointed out that the Manidae species use their uniquely elongated tongue for feeding on termites and ants, the morphology of the masticatory muscles and of the mandibular bone of the pangolins has been overlooked. The mastication system has so far been considered functionally vestigial or insignificant (Doran and Allbrook 1973, Walker 1991, Chan 1995), but without there having been detailed descriptions of the masticatory muscles. 2D Mammal Study 23: 1998 The purpose of this study therefore was to examine macroscopically the three dimensional relationship between the cranium and the mandible, and the development of the masticatory muscles in order to clarify their functional significance. MATERIALS AND METHODS One formalin-fixed head and three skulls of the Malayan pangolin, Manis javanica that had been stored in Thailand Institute of Scientific and Technologi- cal Research, in the Department of Veterinary Anatomy of The University of Tokyo and in the Department of Zoology of National Science Museum, Tokyo were used in this study. The skin, subcutaneous tissue and globe were removed from the fixed head, then the masticatory muscles, Muscul: masseter, digastricus, temporalis, pter- ygoider and Musculus mylohyoideus were observed macroscopically. Soft-X ray photographs were taken to examine the articulation and the positional relation- ship between the mandible and the cranium, and the areas of attachment of the masticatory muscles on the skulls were observed. The anatomical nomencla- ture of the muscular system was based on Miller’s Anatomy of the Dog (Evans 1993). Fig. 1. Lateral soft-X ray photograph of the head of a Malayan pangolin. Rostral direction at the top. The thin mandible (small arrow) is gently curved and connects to the ventro- caudal area of zygomatic process of the temporal bone (large arrow). Arrowheads, incom- plete zygomatic arch. Fig.2. Dorso-ventral soft-X ray photograph of the head of a Malayan pangolin. Rostral direction at the top. The thin mandible represents the V-shape (arrow). Arrowhead indi- cates the auditory bulla. The atlas vertebra is present in this specimen. Endo et al., Pangolin Masticatory Muscles 3 RESULTS The relative positions of the mandibular bones and the cranium were observed using soft-X ray photographs (Figs. 1,2). The mandibular body was found to be slender and gently curved dorso-ventrally, but was not generally well-developed (Figs. 3, 4). The symphysis was relatively long and strong in comparison with the thin mandibular bone. The lateral surface of the man- dible was flat and lacked processes for the insertion of muscles, while the medial side had a shallow groove to which M. mylohyoideus was attached. The mandible connected to the ventro-caudal area of the zygomatic process of the temporal bone. The articulation area was slightly depressed, and the zygomatic process had no specialized surfaces for articulation (Figs. 3, 4). All three skulls and the preserved head possessed incomplete zygomatic arches which varied in their developmental state (Figs. 1-4). The temporal bone was well-developed dorso-rostrally in the area of the zygomatic process (Fig. 3), which we have called the “temporal-muscle process”. The orbit was surround- ed by depressed frontal and developed temporal bones, and there was a deep hollow in the caudal part of the orbit. Fig. 3. Left side of the skull of a Malayan pangolin. Rostral direction at the top. The mandible has been artificially attached to the cranium. The skull is elongated and simple in lateral view, while the mandible bone is slender. The zygomatic arch is not developed (arrows). The temporal bone is dorso-rostrally well-developed in the part of zygomatic process (arrowhead). The depressed orbit is surrounded by the temporal muscle process in the caudal part. Fig. 4. Ventral view of the skull specimen of a Malayan pangolin. Rostral direction at the top. The mandible articulation area is slightly depressed (arrow). 4 Mammal Study 23: 1998 Fig.5. Right side of the head of a Malayan pangolin. Rostral direction at the top. The wedge-shaped WM. temporalis is well-developed in the caudal part of the orbit and in the medial side of the temporal-muscle process of the temporal bone (small arrows). The M. masseter consists of three main bundles reaching from zygomatic arch to the caudal part of the mandible (intermediate arrows). Large arrows, zygomatic arch. Arrowhead, mandible. Fig. 6. Dorso-lateral view of the orbit region of a Malayan pangolin. Rostral direction at the top. The wedge-shaped M. temporalis is well-developed in the medial side of the zygomatic arch (small arrows). The large arrow indicates a part of the M. masseter. The M. temporalis was well-developed on the medial side of the zygomatic arch of the temporal bone and the temporal muscle process (Figs. 5,6). The /. temporalis, which was found to be wedge-shaped, was largely attached to the caudal part of the orbit, and was rostrally extended to the medial surface of the zygomatic arch. The muscle was inserted vertically into the caudal mandible body. The M. masseter consisted of three well-developed main bundles (Figs. 5, 7). The two cranial bundles originated form the medial side of the zygomatic arch and the most caudal bundle arose from the ventral part of the arch. All three bundles reached the caudal half of the mandible laterally (Fig. i). The WM. digastricus consisted of two thin parts, the lateral part originating from the ventral area of temporal and occipital bones inserting into the ventral edge of the mandible (Figs. 7, 8), while the thinner medial part arose from the ventral surface of the M@. mylohyoideus (Fig. 7), and did not attach to the caudal part of the mandible. The M. mylohyoideus was thick and occupied the space between the mandibular bones, and provided an area of attachment for the medial portion of the M. digastricus (Fig. 8). The WM. pterygoideus lateralis was found to consist of two small, short bundles lying parallel and rostro-laterally oriented from the palatine bone to the medial side of the mandible (Fig. 9). Endo et al., Pangolin Masticatory Muscles D Fig. 7. Ventro-lateral view of the head of a Malayan pangolin. Rostral direction at the top. Superficial muscles are removed. The M. masseter consists of three main bundles (small arrows). The MM. digastricus can be seen. The lateral part of the WM. digastricus (intermedi- ate arrow) originates from the ventral area of the temporal and the occipital bones (arrow- heads), while the thinner medial portion (large arrow) rises form the ventral surface of the M. mylohyoideus. Asterisks, the ventral edge of the mandible. S, submandibular gland. Fig. 8. Ventro-lateral view of the head of a Malayan pangolin. Rostral direction at the top. The M. digastricus is turned out, and the two distinctive parts can be observed (small arrows). The M. mylohyoideus, which is thick and occupies the space between mandibles (large arrow). Fig. 9. Ventral view of the head of a Malayan pangolin. The M. pterygoideus lateralis consists of two small and short bundles (small arrows). The large arrow indicates the ventral edge of mandible to which the ™. digastricus is attached. Rostral direction at the top. DISCUSSION The possibility of morphological differences between species of Manidae in the developmental of the masticatory muscle should be taken into account, particularly given that previous descriptions have not been consistent (Lubosch 1938, Saban 1968, Yen 1985, Chan 1995). Firstly, it is suggested that the thin V-shaped mandible may provide significant support for the ventral portion of the oral cavity. It became clear during this study of the Malayan pangolin that the M. temporalis was developed and had the enlarged attachment to the temporal-muscle process. The multi- bundled MM. masseter was also found to be a strong mastication motor. Although the developmental state of the zygomatic arch was found to vary between individuals, we believe, contrary to Saban (1968), that the arch is not 6 Mammal Study 23: 1998 vestigial. Although active movement of mandible is certainly not important for feeding in this species, we suggest that the zygomatic arch and its temporal- muscle process, the M. masseter and M. temporalis, may all serve to help fix the shape of mouth. Although the mandible is simple and thin, the symphysis is relatively well-developed in the pangolins (Lubosch 1938, Saban 1968) indicating that mandibular bones may support the shape of the oral cavity while feeding with the tongue. In comparison with the M. masseter and M. temporalis, the M. digastricus of the Malayan pangolin is not comparable with that of other mammals (Edgewor- th 1923, 1935, Evans 1993). Although Chan (1995) pointed out that the /. digastricus disappears into the submandibular gland, in this study we have demonstrated that the lateral part of the VW. digastricus is at least functional in depressing and raising the mandible. It is further suggested that the medial part of the M. digastricus only assists the action of the well-developed M. mylohyoideus. The M. mylohyoideus may support the function of M. digastricus and act as a depressor of the mandible. In addition, the well-developed MM. mylohyoideus may contribute to the control of intraoral pressure during masti- cation. Specimens with intact hyoid bones should be examined morphological- ly in the future to elucidate this. Our description of Mm. pterygoidei is similar to that of Yen (1984). The M. pterygoideus lateralis could not be confirmed in this specimen. It remains unclear how this muscle has changed in form and function. The functional significance of masticatory muscles of certain rodents has been described (Kesner 1980, Bekele 1983, Druzinsky 1995), and functional models of mandibular movement have also been established for some rodents (Weijs 1975, Gorniak 1977, Byrd 1981, Satoh 1997). On the basis of data from Apodemus and Clethrionomys species (Satoh 1997), it has been suggested that patterns of mandibular movement are directly modified by adaptations in dental morphology. We speculate, however, that the masticatory muscles in toothless mammals such as the pangolin have also been functionally affected by their special feeding pattern. In such mammals, the primary function of masticatory muscles may not be to generate occlusal force, but to control the air pressure within the oral cavity. In contrast with previous speculations (Doran and Allbrook 1973, Chan 1995), the present study has clearly demonstrated that the masticatory muscles of the Malayan pangolin are not vestigial, but functional, well-developed, fix the mandibular bones, support the shape of the oral cavity, and help control the pressure in the oral cavity during feeding with the tongue. The masticatory muscles of other toothless mammals may also be a func- tional part of the mastication system and may also have been adapted for special feeding as a form of functional convergence. Acknowledgements : We wish to thank: Drs. R. Niphan, K. Sunee, P. Lakkana and the staff of Thailand Institute of Scientific and Technological Research, Dr. T. Nishida of the Department of Anatomy and Physiology of Nihon University, Endo et al., Pangolin Masticatory Muscles 7 Kanagawa, Japan; and Dr. R. Worawut of the Department of Veterinary Anatomy in Kasetsart University, Bangkok, Thailand. We are also grateful to Mrs. C. Nisa of the Department of Veterinary Anatomy of Bogor University of Agriculture and to Dr. Y. Hayashi of the Department of Veterinary Anatomy in the University of Tokyo. The work was supported by the Asian and Pacific co-operative research program of the National Science Museum, Tokyo, and by a Grant-in-Aid from the International Scientific Research Program of the Ministry of Education, Science and Culture of Japan. REFERENCES Bekele, A. 1983. The comparative functional morphology of some head muscles of the rodents Tachyoryctes splendens and Rattus rattus. Mammalia 47 : 395—419. Byrd, K. E. 1981. Mandibular movement and muscle activity during mastication in the guinea pig (Cavia porcellus). J. Morphol. 170: 147—169. Chan, L. K. 1995. Extrinsic lingual musculature of the pangolins (Pholidota: Manidae). J. Mammal. 76 : 472—480. Doran, G. and D. B. Allbrook. 1973. The tongue and associated structures in two species of African pangolins, Manis gigantea and Manis tricuspis. J. Mammal. 54 : 887—899. Druzinsky, R. E. 1995. Incisal biting in the mountain beaver (Aplodontia rufa) and woodchuck (Marmota monax). J. Morphol. 226 :79—101. Edgeworth, F. H. 1923. On the development of the cranial muscles of Tatusza and Manis. J. Anat. 57: Sil aS0: Edgeworth, F. H. 1935. The Cranial Muscles of Vertebrates. Cambridge University Press, Cambrid- ge, 493pp. Ehlers, E. 1894. Der Processus Xiphoideus und seine Muskulatur von Manis macrura Erxl. and Manis tricuspis Surdev. Zoologische Miszellen I. Abhandlungen der K6nigliche Gesellschaft der Wissenschaften, Gottingen 39: 1—34. Evans, H.E. 1993. Miller's Anatomy of the Dog, 3rd ed. W.B. Saunders, Philadelphia. Gorniak, G. C. 1977. Feeding in golden hamster, Mesocricetus auratus. J. Morphol. 154 : 427—458. Kesner, M. H. 1980. Functional morphology of the masticatory musculature of the rodent subfamily Microtinae. J. Morphol. 165 : 205—222. Kubota, K., J. Kubota, T. Nakamura, N. Fukuda, S. Asakura, S. Nakagawa and M. Masui. 1962. Comparative anatomical and neurohistological observations on the tongue of pangolin (Manis pentadactyla, Linnaeus). Anat. Rec. 144: 43—55. Lubosch, W. 1938. Muskeln des Kopfes, Mammalia. Jn (Bolk, L., E. Goppert, E. Kallius and W. Lubosch, eds.) Handbuch der vergleichende Anatomie der Wirbeltiere. 5, pp. 1065—1106. Urban & Schwarzenberg, Berlin and Wien. Saban, R. 1968. Musculature de la téte. Jn (Grassé, P. P., ed.) Traité de Zoologie. pp. 279— 471. Masson et C'®, Paris. Satoh, K. 1997. Comparative functional morphology of mandibular forward movement during mastication of two murid rodents Apodemus speciosus (Murinae) and Clethrionomys rufocaus (Arvicolinae). J. Morphol. 231 :131—142. Sonntag, C. 1923. The comparative anatomy of the tongues of the Mammalia. IX. Edentata, Dermoptera, and Insectivora. Proc. Zool. Soc. London 1923 :515—529. Sonntag, C. 1925. The comparative anatomy of the tongues of the Mammalia. XII. Proc. Zool. Soc. London 1925: 701—762. Walker, E. P. 1991. Order Pholidota. Ju (R. N. Nowak and J. L. Paradiso, eds.) Walker’s Mammals of the World, vol. 1, 4th ed. pp. 470—472. Johns Hopkins Univ. Press, Baltimore and London. Weijs, W. A. 1975. Mandibular movements of the albino rat during feeding. J. Morphol. 145: 107— 124. 8 Mammal Study 23: 1998 Yen, Y.C. 1984. Comparative studies on characteristics structures of sensory and motor mechanisms in the stomatognathic system of the pangolin, Manis aunta (Mammalia): 1. Masticatory muscles and their spindle supply in the pangolin. J.Stomatol. Soc. Japan 51: 674—688. Yen, Y. C. 1985. Comparative studies on characteristics structures of sensory and motor mechanisms in the stomatognathic system of the pangolin, Manis aurita (Mammalia): 2. Electron micro- scopic observations on the masticatory muscle spindles in the pangolin. J. Stomatol. Soc. Japan 52: 16—43. (accepted 2 March 1998) Mammal Study 23: 9-18 (1998) © the Mammalogical Society of Japan Histochemical properties of the masticatory muscles of murids Katsumi SUGASAWA and Takayuki MOorI* Zoological Laboratory, Faculty of Agriculture, Kyushu University 46-06, Fukuoka 812-81, Japan Fax: +81-92-642-2804, e-mail: sugar @agr.kyushu-u. ac. jp Abstract. Histochemical studies were made of the masticatory (temporal, masseter and digastric) muscles of the laboratory mouse, Mus musculus, and laboratory rat, Rattus norvegicus, which are omnivorous, the golden hamster, Mesocricetus auratus, which is omnivorous but with a tendency to eat much vegetable matter, and the Japanese field vole, Microtus montebelli, which is herbivorous. It was found that the masticatory muscles were composed almost entirely of fast-twitch fibers. Interspecific differences were found in the oxidative enzyme activity of the masseter muscle in relation to rodent dietary habits. The masseter muscles of the mouse and rat consisted of fast-twitch oxidative glycolytic and fast-twitch glycolytic fibers, thus they appear to have the capacity for power- ful, or sudden, and enduring contractions. ~The masseter muscles of the hamsters were composed only of fast-twitch intermediate fibers, thus giving them the capacity for moderately enduring contractions, whereas the vole masseter muscles consisted only of fast-twitch oxidative fibers, and consequently they appear to have the capacity for particularly enduring contractions. Key words: fiber types, food habits, histochemistry, masticatory muscles, murids. The wide range of mechanical demands imposed upon the masticatory appara- tus of mammals is reflected in its structural and functional diversity. Despite detailed descriptions of skull and mandible anatomy, and analyses of patterns of jaw movements and coincident muscle activity in a wide variety of mammals (De Gueldre and De Vree 1988), little is known about the histochemical charac- teristics of the masticatory muscle fibers themselves. Studies of the masticatory muscles of laboratory animals (Taylor ef al. 1973, Schiaffino 1974), livestock (Suzuki 1977), and man (Ringqvist 1973, 1974) have demonstrated that, like most limb muscles, these muscles are generally heterogeneous with respect to fiber type. Other studies have shown that the masticatory muscles have regional differences in fiber length and fiber distribu- tion, and that these structurally different regions imply different patterns of muscular activity (Herring ef al. 1979, Maxwell et al. 1979, Gorniak 1985). Carnivores chew rapidly, have blade-like dentition for slicing, show little *To whom correspondence should be addressed 10 Mammal Study 23: 1998 horizontal jaw movement, possess a large temporalis and relatively small masseter complex, and have a high percentage of fast-twitch fibers in their masticatory muscles. In contrast, herbivorous animals, such as cows, sheep and rabbits, chew relatively slowly, have flat teeth for grinding, show extensive horizontal movements of the lower jaw, possess a large masseter complex and relatively small temporals, and have a high percentage of slow twitch fibers within their masticatory muscles. The characteristic specialization of the Rodentia is their ability to use their incisors to gnaw hard fibrous substances. Gnawing is possible because their large upper and lower incisors grow continuously. In rodents, both gnawing and chewing involve predominantly anteroposterior (pvopalinal) movements of the mandible. The characteristic structural modifications of rodent mandibles and masticatory muscles are all related to this propalinal movement. Although a number of functional studies have been made on mammalian masticatory muscles, few studies have focussed on the relationships between the histochemical characteristics of these muscles and the food habits of rodents. The purpose of the present study is to clarify aspects of adaptation for particular feeding habits in murids by comparing the histochemical characteris- tics of the masticatory muscles of the omnivorous mouse, Mus musculus (Cunliffe-Beamer and Les 1986) and rat, Rattus norvegicus (Weihe 1986), the omnivorous golden hamster, Mesocricetus auratus which tends to eat a great deal of vegetable matter (Hobbs 1986), and the fully herbivorous Japanese field vole, Microtus montebelli. MATERIALS AND METHODS Five adult laboratory mice, four laboratory rats, three golden hamsters, and eight Japanese field voles were euthenased for this study. The anterior part of the temporal muscle, Musculus temporalis, the superficial masseter muscle, M. masseter superficialis, and the anterior belly of the digastric muscle, M. digastricus, were all removed. For light microscopy, muscle tissues were rapidly frozen in isopentane solution cooled with dry ice. Serial cross-sections of the muscles, 8 wm thick, were obtained and stained: for myosin adenosine triphosphatase (ATPase) (Padykula and Herman 1955) after alkaline (pH 10.5) or acid (pH 4.3) pre- incubation (Brooke and Kaiser 1970a, b, Suzuki 1977); for reduced nicotinamide adenine dinucleotide dehydrogenase (NADH-DH) (Burstone 1962), and for phosphorylase activities (Takeuchi and Kuriaki 1955). Fibers were classified as either: slow-twitch oxidative (SO), fast-twitch oxidative glycolytic (FOG), fast-twitch glycolytic (FG), fast-twitch intermediate (FI) with intermediate NADH-DH activity between FOG and FG, and fast- twitch oxidative (FO) on the basis of their differences in their reactivity for myosin ATPase after alkali and acid pre-incubation, and activity for NADH- DH and phosphorylase (based on Peter et al. [1972] and Armstrong et Sugasawa and Mori, Murid masticatory muscles iat Table 1. Histochemical enzyme activities of myofiber types in the masticatory muscles of the mouse, rat, hamster and Japanese field vole, Microtus montebelli. —, Unreactive; +, weak ; ++, modemate; +++ to +++4, strong. For myofiber type, see in the text. Myofiber ___ Myosin ATP ase NADH-DH Phosphorylase type pH 10.5 pH 4.3 SO 2 +++ +++ ne FOG +4+4++ - +++ to ++++ t+ to +++ FG ++++4 = + Ba FI ++4++ = to at FO ++4++4+ - +++4+++4 + ae wT. see Dable 1). The sizes of the muscle fibers concerned were determined by measuring the maximum distance across the lesser diameter of 50 fibers (Brooke 1970) of each type on photographs (1,000) using sections stained for myosin ATPase after alkaline pre-incubation. Means and standard deviations of the diameter were calculated. RESULTS In the mouse, the temporal, masseter (Figs. la, b, c) and digastric muscles were composed of 35-46% FOG and 54-65% FG fibers (Table 2). Concerning NADH-DH activity of the mouse masseter muscle FOG fibers, diformazan Table 2. Percentages (means + SD) of myofiber types in the masticatory muscles of the mouse, rat, hamster and Japanese field vole, Microtus montebelli. The numbers of animals analyzed are given in parentheses. Animal Myofiber types (%) Muscle SO FOG FG FI FO Mouse (5) Temporal 0 46.0+5.9 5A Oat 59 0) 0 Masseter 0 Sb Oareie Il Golesi Seal 0 0 Digastric 0 30 ete 410 rec aselall () 0) Rat (4) Temporal 0) S10) sl) 5), (0) TOSOEE a8 0 0) Masseter () AblenG iste 37) Nod Baers Uf 0 0) Digastric 0 SOR Er eZ GOR Sse 542 0 0 Hamster (3) Temporal 0) se, 3 Si 0EE O33 ) 0) Masseter 0 0 0) 100+0 0) Digastric 0 50 else See3 49.9+8.3 0 0 Vole (8) Temporal 0 SL ay 0 ASO sis 5) 7, 0) Masseter 0 0) 0) 0) 1000 Digastric Grazie S58 0 0 Oiek ste SEIS 0 WZ Mammal Study 23: 1998 deposits were larger than those of the rat. In mouse masticatory muscles, the diameter of the FOG fibers in the temporal muscles was smallest (20.37+4.27 um), while the diameter of the FG fibers in the digastric muscles was largest (42.39+3.84 um) (Table 3). In the rat, the temporal, masseter (Figs. 2a, b, c) and digastric muscles were composed of 30-42% FOG and 58-70% FG fibers (Table 2). NADH-DH activ- ity of the FOG fibers in rat masseter muscles was weak, and diformazan deposits were smaller than those in the mouse. In rat masticatory muscles, the diameter of the FOG fibers in the masseter muscles was smallest (19.52+2.80 ym), while the diameter of the FG fibers in the digastric muscles was largest (46.3845.38 wm) (Table 3). In the golden hamster, the temporal muscles were composed of 13% FOG and 87% FG fibers. The masseter muscles consisted only of FI fibers which reacted strongly for myosin ATPase after pre-incubation at pH 10.5 (Fig. 3a), did not react at pH 4.3 (Fig. 3b), and reacted intermediately for NADH-DH (Fig. 3c). In particular, the NADH-DH activity of the FI fibers in the masseter muscles was weak in the sarcoplasm and strong beneath the sarcolemma. The digastric muscles were composed of 50% FOG and 50% FG fibers (Table 2). The diameter of the FOG fibers in the temporal muscles was smallest in the hamster masticatory muscles (31.12+7.12 um). On the other hand, the diame- ter of the FG fibers in the digastric muscles was the largest among the murid masticatory muscles (68.582 5.99 wm) (Table 3). In the vole, the temporal muscles were composed of 54% FOG and 46% FI fibers. The masseter muscles consisted only of FO fibers which strongly reacted for myosin ATPase after pre-incubation at pH 10.5 (Fig. 4a), but which Table 3. Diameters (means + SD) of myofiber types in the masticatory muscles of the mouse, rat, hamster and Japanese field vole, Microtus montebellz. Animal Diameter of each myofiber type (um) Muscle SO FOG FG FI FO Mouse Temporal = Nsey(aet i seh a=) aloe = 7 Masseter a D552 He) 1 S022 3) 24 = aa Digastric = Me ae 5) Sl AY SO ae3} so = ae Rat Temporal aad Men (zaz leo SO S020 5), 0 =a a Masseter = IS Se Za) SOSO0 ES. 910 = =e Digastric = DOES Cie Aras) ae By) So) = = Hamster Temporal = Sl ae AY eS SO ae 6.40) == Ts Masseter a = =a 36.80+6.16 i Digastric = ADEN On MOOR DO=aOROO a oa Vole Temporal = 19PATE 3726 = 20.40+2.98 = Masseter = = = = 1SHO0 aa sRS Digastric 6)5 Wael a = a 22.72 14.17 Sugasawa and Mori, Murid masticatory muscles Is Fig. 1. Histochemical profiles of the masseter muscles in the mouse.a: myosin ATPase activity at pH 10.5, b: myosin ATPase activity at pH 4.3, c: NADH-DH activity. FG: fast-twitch glycolytic fiber, FOG: fast-twitch oxidative glycolytic fiber. Bar: 100 wm. Fig. 2. Histochemical profiles of the masseter muscles in the rat. Explanations for a, b and c are the same as for Fig. 1. FG: fast-twitch glycolytic fiber, FOG: fast-twitch oxidative glycolytic fiber. Bar: 100 um. 14 Mammal Study 23: 1998 Fig. 3. Histochemical profiles of the masseter muscles in the hamster. Explanations for a, b and c are the same as for Fig. 1. FI: fast-twitch intermediate fiber. Bar: 100 wm. Fig. 4. Histochemical profiles of the masseter muscles in the vole. Explanations for a, b and c are the same as for Fig. 1. FO: fast-twitch oxidative fiber. Bar: 100 um. did not react at pH 4.3 (Fig. 4b), although they reacted strongly for NADH-DH (Fig. 4c). Large granular diformazan deposits and a strong reaction in the subsarcolemmal region for NADH-DH were recognized in the masseter muscle fibers. The digastric muscles were composed of about 10% SO, and about 90% Sugasawa and Mori, Murid masticatory muscles 15 FI fibers (Table 2). The diameter of the SO fibers in the vole digastric muscles was the smallest among the murid masticatory muscles (8.70 +/—1.74 wm). On the other hand, the diameters of the FOG, FI and FO fibers in the vole masticatory muscles were about 20 wm (Table 3). DISCUSSION Adult mammalian skeletal muscles are composed of mixtures of highly specialized fibers in proportions that reflect the muscle’s function. As for the muscle fiber types found in this study, it was previously well known that: small diameter SO fibers predominate in continuously active muscles that generate low force; FOG fibers are found in muscles capable of maintaining contractile activity with high force; and large diameter FG fibers are found in muscles involved in phasic bouts of very high force (Pette and Vrbova 1985). Although, according to Pette and Staron (1997), IIA fibers do not necessarily equate to FOG fibers, vole masseter muscle FO fibers, with strong oxidative activity, may be classified as FOG (IIA) subtype, because the FO fibers of the pectoral muscles of the bat, Myotis lucifugus, are composed just of rat ILA myosin heavy chains (Hermanson eft al. 1991). Thus, the FO fibers of vole masseter muscles also seem to be extremely specialized for fast and sustained contraction. The FI fibers appear to correspond to IIX fibers characterized by an aerobic oxidative capacity intermediate between those of FOG (IIA) and FG (IIB) fibers according to Pette and Staron (1990). Most information obtained to date on the histochemistry of fiber composi- tion of masticatory muscles in mammals indicates that they are of a heterogene- ous nature, and that they vary considerably in the proportion and cross- sectional area of each fiber type both within and among species (Suzuki 1977, De Gueldre and De Vree 1991, Hurov et al.1992, Miyata et al. 1996). Such interspecific variation may be due to differences in feeding specializations among mammals. The movement of the jaw during the feeding cycle is relatively complex, and differentiation in muscle fiber composition among the masticatory muscles reflects the different functions that they play during the feeding cycle. The murid masticatory muscles examined in this study were composed almost entirely of fast-twitch fibers, seeming to imply that murids can quickly masticate various types of food. The temporal muscles facilitate the powerful upward movement of the mandible (Hiiemae and Houston 1971). In the omnivorous mouse, rat and hamster, these were composed of 13-46% FOG and 54-87% FG fibers, thus giving them the capacity for powerful, or sudden, and enduring contractions suitable for gnawing. The temporal muscles of the hamster contained the most FG fibers indicating that of the species studied, they excelled in phasic bouts of very high force. In contrast, since the temporal muscles of the herbivorous vole consist of 54% FOG, and 46% FI fibers, they have a more enduring contractile ability than either the mouse, rat or hamster. 16 Mammal Study 23: 1998 The masseter muscle, which protracts and elevates the mandible (Hiiemae and Houston 1971), is the largest masticatory muscle in rodents. The histo- chemical properties of this muscle in rodents are controversial, because this muscle contains various proportions of fiber types (Mao et al.1992). The masseter muscles of the rat were composed of both FOG and FG fibers. These findings confirmed Miyata et al.’s (1993) observations of rat masseter muscles. Since the masseter muscles of the mouse and rat consisted of 35-42% FOG and 58-65% FG fibers, they appeared to have the capacity for powerful, or sudden, and enduring contractions suitable for chewing. The masseter muscle of the hamster was composed entirely of FI fibers, thus it seemed to have a greater capacity for enduring contractions than those of either the mouse or the rat. On the other hand, as pointed out by Sugasawa et al. (1997), the masseter muscle of the vole consisted only of FO fibers with a remarkably enduring contractile ability, indicating that among the murids studied here, the vole’s masseter muscle appears to be best adapted for masticating coarse fibrous materials. The digastric muscles, which serve to retract the mandible (Woods 1975), were found to be composed of FOG and FG fibers in both the mouse and the rat, confirming Hurov ef al.’s (1992) findings for the mouse and Kiliaridis e¢ al.’s (1988) findings for the rat. Furthermore, since the digastric muscles of the mouse, the rat and the hamster were composed of 37-50% FOG and 50-63% FG fibers, they were able to open their mouths rapidly. In contrast, the vole, with digastric muscles consisting of 91% FI fibers, is better suited for enduring contractions, than the other murids. In conclusion, murid masticatory muscles are composed almost entirely of fast-twitch fibers, enabling them to masticate quickly. The masticatory muscles of herbivorous voles have enduring contractile ability, while those of omnivorous murids have powerful or sudden contractile ability. Such a ten- dency was particularly reflected in the histochemical properties of the masseter muscles. Acknowledgments: We are indebted to Emeritus Professor T. A. Uchida of Kyushu University for his kind and considerate guidance during the course of this study, to Emeritus Professor H. Takahara of Kyushu University and Professor H. Iwamoto of the Laboratory of Animal Husbandry II, Faculty of Agriculture, Kyushu University for their facilities for histochemical examina- tions. REFERENCES Armstrong, R. B., C. D. lanuzzo and T. H. Kunz. 1977. Histochemical and biochemical properties of flight muscle fibers in the little brown bat, Myotis lucifugus. J. Comp. Physiol. 119: 141—154. Brooke, M. H. 1970. Some comments on neural influence on the two histochemical types of muscle fibers. Jn (Briskey, E. J., R. C. Cassens and B. B. Marsh, eds.) Physiology and Biochemistry of Muscle as a Food. Vol. 2, pp. 131-153. Univ. of Wisconsin Press, Madison. Sugasawa and Mori, Murid masticatory muscles 7, Brooke, M. H. and K. K. Kaiser. 1970a. Three myosin adenosine triphosphatase system: the nature of their pH lability and sulfhydryl dependence. J. Histochem. Cytochem. 18 : 670—672. Brooke, M.H.and K. K. Kaiser. 1970b. Muscle fiber types: How many and what kind? Arch. Neurol. 23: 369—379. Burstone, M.S. 1962. Enzyme Histochemistry. Academic Press, London, England. Cunliffe-Beamer, T. L. and E. P. Les. 1986. The laboratory mouse. Jz (Poole, T. B. ed.) The UFAW Handbook on the Care and Management of laboratory animals. pp. 275—308. Longman Scientific and Technical, England. De Gueldre, G. and F. De Vree. 1988. Quantitative electromyography of the masticatory muscles of Pteropus giganteus (Megachiroptera). J. Morphol. 196 : 76—106. De Gueldre, G. and F. De Vree. 1991. Fiber composition of the masticatory muscles of Pteropus giganteus (Brunnich, 1782) (Megachiroptera). Belgian J. Zool. 121 :279—294. Gorniak, G.C. 1985. Trends in the actions of mammalian masticatory muscles. Am. Zool. 25: S333. Hermanson, J. W., W. A. LaFramboise and M. J. Daood. 1991. Uniform myosin isoforms in the flight muscles of little brown bats, Myotis lucifugus. J.Exp. Zool. 259:174—180. Herring, S.W., A. F.Grimm and B.R.Grimm. 1979. Functional heterogeneity in a multipinnate muscle. Am. J. Anat. 154 :563—576. Hiiemae, K.and W.J.B. Houston. 1971. The structure and function of the jaw muscles in the rat (Rattus norvegicus L.). I. Their anatomy and internal architecture. Zool. J. Linn. Soc. 50: 75—99. Hobbs, K.R. 1986. Hamsters. Ju (Poole, T.B.ed.) The UFAW Handbook on the Care and Management of Laboratory Animals. pp.377—392. Longman Scientific and Technical, England. Hurov, J., B. W. C. Rosser, K. M. Baker, R. Choksi, B. J. Norris and P. M. Nemeth. 1992. Metabolic transitions in rat jaw muscles during postnatal development. J. Craniofacial Genet. Dev. Biol. IOS — 06. Kiliaridis, S., C. Engstrom and B. Thilander. 1988. Histochemical analysis of masticatory muscle in the growing rat after prolonged alteration in the consistency of the diet. Archs. Oral Biol. Som lo — 193, ; Mao, J., R. B. Stein and J. W. Osborn. 1992. The size and distribution of fiber types in jaw muscles: A review. J.Craniomandib. Disord. Facial Oral Pain 6: 192—201. Maxwell, L.C., D.S. Carlson, J. A. McNamara, J. A. Faulkner. 1979. Histochemical characteristics of the masseter and temporalis muscles of the rhesus monkey (Macaca mulatta). Anat. Rec. 193 : 389—402. Miyata, H., T. Sugiura, Y. Kawai and Y.Shigenaga. 1993. Effects of soft diet and aging on rat masseter muscle and its motorneuron. Anat. Rec. 237: 415—420. Padykula, H. A. and E. Herman. 1955. Factors affecting the activity of adenosine triphosphatase and other phosphatases as measured by histochemical techniques. J. Histochem. Cytochem. 3: 161—169. Peter, J. B., R. J. Barnard, V. R. Edgerton, C. A. Gillespie and K. E. Stempel. 1972. Metabolic profiles of three fiber types of skeletal muscle in guinea pigs and rabbits. Biochemistry 11 : 2627— 2633. Pette, D. and R.S. Staron. 1990. Cellular and molecular diversities of mammalian skeletal muscle fibers. Rev. Physiol. Biochem. Pharmacol. 116: 1—76. Pette, D. and R. S. Staron. 1997. Mammalian skeletal muscle fiber type transitions. Int. Rev. Cytol. OR WAS 223: Pette, D. and G. Vrbova. 1985. Invited review: neural control of phenotypic expression in mam- malian muscle fibers. Muscle Nerve 8 : 676—689. Ringqvist, M. 1973. Histochemical enzyme profiles in human masseter muscle with special regard to fibers with intermediate myofibrillar ATPase reaction. J. Neurol. Sci. 18:133—141. Ringqvist, M. 1974. Fiber types in human masticatory muscles. Relation to function. Scand. J. Dent. Res. 82 : 333—355. Schiaffino, S. 1974. Histochemical enzyme profile of the masseter muscle in different species. 18 Mammal Study 23: 1998 Anat. Rec. 180 :53—62. Sugasawa, K., K. Ando, T. Mori and S. Shiraishi. 1997. Histochemical and electron microscopic properties of the masseter muscle in the Japanese field vole Microtus montebelli. Zool. Sci. 14: 369 oA. Suzuki, A. 1977. A comparative histochemical study of the masseter muscle of the cattle, sheep, swine, dog, guinea pig and rat. Histochemistry 51 :121—131. Takeuchi, T. and H. Kuriaki. 1955. Histochemical detection of phosphorylase in animal tissue. J. Histochem. Cytochem. 3:153—160. Taylor, A. F., F. W. J. Cody and M. A. Bosley. 1973. Histochemical and mechanical properties of the jaw muscles of the cat. Exp. Neurol. 38 : 99—109. Weihe, W.H. 1986. The laboratory rat. UI (Poole, T. B. ed.) The UFAW Handbook on the Care and Management of Laboratory Animals. pp. 309—330. Longman Scientific and Technical, England. Woods, C. A. 1975. The hyoid, laryngeal and pharyngeal regions of bathygerid and other selected rodents. J. Morphol. 147 : 229—250. (accepted 16 January 1998) Mammal Study 23: 19-30 (1998) © the Mammalogical Society of Japan Regulation of reproduction in a natural population of the small Japanese field mouse, Apodemus argenteus Keisuke NAKATA Hokkaido Forestry Research Institute, Bibai, Hokkaido 079-0198, Japan Fax: +81-1266-3-4166, e-mail: nakata @hfri.bibai.hokkaido.jp Abstract. Changes in reproductive parameters were analyzed quantitatively in a natural population of the small Japanese field mouse, Apodemus argenteus. Among individuals born in the cur- . rent year, the lightest female weighed 8 g at sexual maturity and the lightest male weighed 10 g._ Irrespective of season, the lightest mice were found only during the phase of population increase. Among mice that had over-wintered, the lightest individuals of each sex to reproduce during the spring population decline weigh- ed 10 g. In years of high population density, the reproductive rates of females, even at their peak during August, was below 10%. In contrast, in low-density years, much higher rates, over 69%, lasted until October during the increase phase. The patterns for males were almost the same as those of females during survey years. According to multivariate analysis, the reproductive rate of males was largely explained by population density (partial correlation, 0.732), whereas the reproductive rate of females was largely explained by the fluctuation phase (0.848). The number of each sex to reproduce increased in proportion to the density of potentially reproductive mice at lower densities, but then de- creased at higher densities. The observed maximun number of reproductively active mice was 15 males and 21 females in a one-hectare grid. Temperature appeared not to cause any varia- tion in the breeding season in this population. Key words: age at sexual maturity, breeding season, limitation of reproduc- tion, population density, temperature. In contrast to the considerable amount of information available on arvicoline rodents (e.g., Alibhai and Gipps 1985, Taitt and Krebs 1985), little is known about the multi-annual fluctuations of murine rodent population densities, particularly of Apodemus species. In almost all cases reported so far, Apodemus populations usually repeat similar seasonal patterns of density change from year to year (eé.g., Fujimaki 1969, Watts 1969, Bobek 1973, Nishi- kata 1979, Flowerdew 1985, Moreno and Kufner 1988, Lin and Shiraishi 1992). These repeating patterns have led to analyses of density variation in relation to extrinsic factors such as seed crops and temperature, which show marked seasonal variation. With the exception of aggression among adult males (see Watts 1969), however, the effects of intra-population or intrinsic factors affect- 20 Mammal Study 23: 1998 ing Apodemus species have been little studied. Reproductive inhibition has been stressed as one of the most critical aspects of population regulation in small rodents. For example, limitation of the number of reproductively active individuals is corroborated in natural populations of arvicoline rodents, and the limitation is interpreted as a key attribute in explaining delayed maturation in individuals of the year (e.g., Saitoh 1981, Ostfeld 1985, Nakata 1989). Montgomery (1989) described spatial density-dependence in the reproduc- tive activity of female Apodemus sylvaticus, a dependence which he suggests is a likely regulatory mechanism leading to reproductive inhibition. Temporal density-dependence in reproduction, however, has hardly been studied in Apodemus species. The present study was designed, therefore, to make quantitative analyses of: 1) multi-annual density fluctuations, and 2) the parameters of reproductive inhibition in the small Japanese field mouse Apodemus argenteus. MATERIALS AND METHODS The study was conducted in a natural mixed forest at Mizuho (43°42’N, 142° 39’E), about 25 km east of Asahikawa, in central Hokkaido, Japan. This semi-boreal forest consists of both coniferous and broad-leaved trees (Tatewaki 1958, Hamet-Ahti et al. 1974). The dominant tree species are Abies sachalinen- sis, Picea yezoensis, Cercidyphyllum japonicum, Tilia japonica and Acer mono, and the undergrowth consists mainly of a dense layer of Sasa senanensis. The output of seed from these species appeared to be rather constant from year to year during the years of the study according to local foresters. Climatic data for the study area can be found in Nakata (1989). Capture-mark-release studies were undertaken from June 1975 to October 1979 in a trapping grid set at an elevation of about 460 m. One hundred trap stations were set 10 m apart ina 10 X 10 pattern in this grid. During 1975, and for two months of 1976, however, the trapping pattern of the grid was changed. A 5 X 6 pattern was used in June 1975, a 7 X 6 pattern in August and October 1975, and a5 X 10 pattern in May and September 1976. Two Sherman-type live traps, baited with oats, were set less than one metre apart at each trapping point, and one trapping session was conducted on three consecutive days each month during the snow-free seasons. Captured mice were sexed, weighed, their point of capture was noted, and their reproductive condition recorded. Assuming that marked individuals were removed, the size of the population was estimated using Zippin’s (1956) methods. In order to estimate the effective trapping area (Dice 1938), the mean observed range lengths were calculated from mice which were captured three times at two or three different trap points during each trapping session. The population density per hectare was obtained by dividing the estimated number of mice by the effective trapping area. The study area and the trapping procedure are described in more detail in Nakata (1986, 1989). Nakata, Regulation of reproduction in field mice 21 Males with descended testes were regarded as sexually active, while sexually active females were those either visibly pregnant, or with medium or large nipples indicating that they were lactating, or those with perforated vaginae. In order to obtain further reproductive data, mice for autopsy were captur- ed from trap lines located 250-500 m away from the live-trapping grid. These trap lines were situated in the same vegetation as the main trapping grid, however some additional trapping sessions were undertaken during months with snow-cover. The following data were recorded from these mice: weight, total length, tail length, length of testes, condition of the epididymal tubules (visible to naked eyes or not: see Jameson 1950), number of embryos, number of placental scars and uterus width. In addition, the development and wear of the third upper molar (M?) were used as indices of age (Fujimaki 1966). In order to be able to make comparisons with other rodent studies, a “cyclicity” index was calculated for the population: s= /(logN;-logN;,)?/("— 1), where log WN, is the log density at the same time each year, log N; is its mean and n the sample size (Stenseth and Framstad 1980, Henttonen ef al. 1985). This index is the standard deviation of the log density. Four phases of the fluctuating population were arbitrarily defined (Fig. 1), these were: 1) the low phase when there were fewer than eight individuals/ha, 2) the increase phase when increase was rapid, 3) the peak, and 4) the decline phase when decrease was rapid. These four phases occurred in rapid succes- sion during a period of less than one year (Krebs and Myers 1974). In order to assess the effect of temperature on the population (see Fig. 5) temperature records were obtained from the Higashikawa Meteorological Station (alt. 216m) 10 km south-west of the grid. Records of monthly precipita- tion and snow depth can also be found in Nakata (1989). RESULTS 1. Density changes During the course of our five year study, the Apodemus argenteus popula- tion varied in size, such that some years were high-density, and others were low-density (Fig.1). In 1976 and 1978, high-density years, the population density increased rapidly from May to July, reached its peak in August, then declined from September onwards. In contrast, in 1977 and 1979, low-density years, the population decreased from May to June or even August, then in- creased until October. The autumnal increases were not gradual, and they were at similar rates of growth as found during high-density years. The changes in density recorded in 1975 may be somewhat over-estimated as a result of bias caused by the small-scale of trapping at that time, however, despite that, the changing pattern was similar to that observed in both 1977 and 1979. The highest density recorded during the study was 78.5 individuals/ha in August 1978, whereas the lowest density was 2.8 individuals/ha in August 1977. The amplitude of the change was 28-fold. As described above, a sharp con- je Mammal Study 23: 1998 1975 1976 1977 1978 1979 o>) o>) i.e) 12) NUMBER PER HECTARE x ro) A oa co MJJASON MJJASO MJJASO PHASE aerle: IPDia AP Dia) al a i Rae ! Fig. 1. Fluctuation in population density of live-trapped Apodemus argenteus. L=low phase, I=increase phase, P=peak phase, D=decline phase. trast was found between different summers and consequently the s-values varied during the five years being 0.453 in June, 0.567 in August and 0.173 in October. The duration of the increase phase was highly variable, ranging from three months (from September to July in 1976) to eleven months (from September 1977 to July 1978). The over-winter decline phases were rather longer, namely from September 1976 to May 1977 and from September 1978 to June 1979. The low phase lasted for three months in 1977, and in 1979 there was no low phase between the decline and increase phases. The population declined just after attaining its peak density, and accordingly the peak phase was regarded as a brief time covering just one month. 2. Age and body weight at reproduction Among mice of the year, the lightest sexually mature males weighed 10 g (one male in June 1976), and the lightest sexually mature females 8 g (two females in July 1976 and October 1977; see Fig. 2). Irrespective of season, these lightest mice were found only during the increase phase. Among the autopsied mice, the youngest male was 2-4 months old, and the youngest female was 1-2 months old (Appendix 1). Among those mice that had over-wintered, the lightest individuals to reproduce weighed 10 g (one male and one female in May 1977, and one female in May 1979), when the population was in the decline phases (Fig. 2). These light mice were presumably more than eight months old, given that reproduc- tive activity stopped early in the preceding year (no reproductive females were live-trapped either in October 1976, or during September and October 1978). The existence of shortened reproductive seasons was corroborated by the findings from the autopsied samples (Appendix 1). Nakata, Regulation of reproduction in field mice i) 3. Reproductive rate and the number of reproductively active individuals Temporal changes in the reproductive rate of Apodemus argenteus were examined. In order to quantify the reproductive rate (the percentage of indi- viduals reproductively active), males were considered capable of reproducing MALES 7 20 f 1 oh t 1 1s = , al i int itl ~ ae | | Bie a] 1m 1 |e i rts a L ne 1 P ora trba i a ; mp j prac Pi 1! 2 Po opteedp ot om hiaooo P TT | 7 i a po Tedd Tal ; ; = [ 2 aI i poco |r ir — 1 H bla Se 1 leis) a0 f 0 0 0 lo o O 7 A 10 ea oO 1 : ail f :; i I od Tee B J Ty FEMALES ' , i I \ =20 l =, “eae ja: ! =a ant ee G) | PEE io a Ws i oF j s i 7 ; i a 4 F i o = a: a i © 10 q D 1 1 0 Bao eeee al ep lor POD DERE Tiggat |! rPDD DI Gli J A QO MJJASO MJJASON MJJASO MJ JASO V9.5 1976 1977 1978 nos Fig. 2. Body weights of live-trapped male and female A. argenteus. Each small rectangle represents one mouse. Ml=reproductively active mouse, [)=immature mouse including post-reproductive males, [‘]=post-reproductive female. Numbers are sample sizes. Other symbols are as in Fig. 1. All mice trapped in May had over-wintered except for one female of the year in 1978 (see text). 24 Mammal Study 23: 1998 when they weighed 10 g or more, and females were considered capable of reproducing when they weighed 8 g or more. Rates of reproduction were closely associated with fluctuation phase and population density (Fig. 3). The proportion of reproductively active females during the peak phase in August in high-density years was just 1% in 1976 and only 5% in 1978, whereas in low-density years (1977 and 1979) much higher rates, over 69%, lasted until October during the increase phase. Very similar patterns were found for males, except that in July 1979 the proportion suddenly dropped to 52% and then remained lower than that of females. The effects of the three important variables, population density, fluctuation phase, and season, were estimated using the quantification-I method (a multiple regression analysis using dummy variables: Hayashi 1952, Tanaka et al. 1984). Population density and fluctuation phase were each divided into four cate- gories, while the seasons were divided into three (Table 1, for internal correla- tions see Appendix 2). For males, the rate of reproduction was largely ex- plained by population density (partial correlation, 0.732), whereas for females the rate of reproduction was largely explained by the fluctuation phase (0.848). Furthermore, season contributed considerably to the variance of the rate for each sex (0.514 or 0.456), however its partial correlation coefficients were the smallest among the three variables. Thus the intra-population variables affected the reproductive rates of the two sexes in different ways, and made a greater contribution in explaining the reproductive rates than did the climate variable. oe 100 LJ > = O a | : Wh \3 og ae LJ og 0 PHASE II 1 PODDD Dee Lee II] 1PDDD Drie JI A OQ MJJASON MJJASON MJJASON MJJASO 1975 1976 1977 1978 1979 Fig.3 Changes in the reproductive rate of A. argenteus. @=males,=females. Numbers are sample sizes of less than six. Samples from the live-trapping grid and trap-lines were pooled to increase sample size. Other symbols are as in Fig. 1. Nakata, Regulation of reproduction in field mice ap) Table 1. Variables and their category scores correlated with reproductive rates of the two sexes in Apodemus argenteus. Males Females Variables Categories Freq. : SSE SSS Scores Partial cor.* Scores Partial cor Population 0-19 10 falls G5) 0.732 10.631 0.466 density(/ha) 20-39 9 = 474 —(0.965 40-59 he) = 9.994 =—4-390 60-79 4 oll sults — 18.920 Fluctuation Increase ial 11.508 0.679 6.999 0.848 Phase Peak 3 = 6.17 —= hs). (All Decline 6 = 5 SAE — 39.146 Low 8 (35 30.509 Season May-Jun 9 15.246 0.514 12.688 0.456 Jul-Aug 9 = 3,485) SOC Sep-Nov 10 = 10) 63 ONS Multiple correlation coefficient (R?) 0.811 0.838 *Partial correlation coefficient. Reproductively active mice were trapped until August or September during the decline phase in the high-density years of 1976 and 1978, whereas they were found until October or even November during the increase phase of the low- density years 1977 and 1979 (Fig. 2). In the latter two years, the extended reproductive activity included elements of the following two cohorts. During 1979, for example, the mice that had over-wintered continued to breed until as late as October, and a large number of mice of the year bred between July and October (see also Appendix 1). Similarly, both continuance and participation were found in 1977. In contrast, in the high-density years of 1976 and 1978, over-wintering mice played a large part in reproductive activity by June or July compared with just a few mice of the current year which reproduced by July. Regarding the relationship between the number of reproductively active mice and the number of potentially reproductive mice (the potential density), the number of reproductively active females increased in proportion to the potential female density at lower density levels, but then decreased at higher potential female densities (Fig. 4). A similar relationship was found for males. The maximum number of reproductively active males in a one-hectare grid was lower than that of reproductively active females: 15 males and 21 females. Reproductively active mice were found in November 1977, when the mean temperature was 4.0 °C, but not in either October 1976 when the temperature was 10.4 °C, or September 1978, when it was 14.3 °C (ten day means were obtained from meteorological data). Furthermore, reproductively active mice occurred naturally in October 1977 and October 1979, when the mean tempera- tures were both 11.0 °C. Thus the relationship between autumn temperature and the occurrence of reproductively active mice was contradictory. 26 Mammal Study 23: 1998 Nh O —_) un © U1 NUMBER OF REPRODUCTIVELY ACTIVE MICE O 10 20 30 40 NUMBER OF POTENTIALLY REPRODUCTIVE MICE Fig.4 The relationship between the number of reproductively active individuals and of potentially reproductive individual live-trapped A. avgenteus. @=males, O=females. DISCUSSION Henttonen ef al. (1985) used an s-value greater than 0.5 and a summer decline to classify populations as cyclic. Furthermore, among Microtus popu- lations, Taitt and Krebs (1985) revealed that the amplitude of a cyclic popula- tion is usually more than ten-fold. The present study population was found to: have an s-value of 0.567 in August samples ; decline during summer ; and have an amplitude of more than 28-fold. According to Henttonen ef al.’s (1985) and Taitt and Krebs’ (1985) criteria, the fluctuation observed during this study may be regarded as cyclic. The population fluctuations of A. avgenteus have been commonly found to be rather stable, repeating similar seasonal patterns from year to year (é.g., Fujimaki 1969, Nishikata 1979). The density variation described in this study substantiates the wider variability of population fluctuation, and essentially provides the first example of cyclicity in a population of this species. Age and body weight at sexual maturity were closely associated with the fluctuation phase. Mice matured sexually as early as 30-60 days of age during the increase and low phases (see Appendix 1). The rapid maturity achieved among the autopsied samples was exactly the same as that under laboratory conditions (Fujimaki and Kuwahata 1985). In contrast, delayed maturity occurred with greater frequency during the peak and decline phases in the Nakata, Regulation of reproduction in field mice 27 high-density years. Such changes in maturation closely resemble those of arvicoline rodents (Krebs and Myers 1974, Nakata 1989). Reproductive intensity was found to be both density- and phase-related (Table 1, Figs. 2, 3 and 4). Considering that decreasing rates of reproduction, and delayed maturation, both occurred earlier in high-density years, these changes are thought to suppress reproductive output and thus accelerate population decline. It suggests, therefore, that the principal regulating factors act on the density- and phase-related reproductive activity. Density-related population regulation has also been described by Montgomery (1989) for Apodemus sylvaticus, although Murakami (1974) disregarded the significance of density in population regulation of A. speczosus. The limitation of the number of reproductively active mice may be a key attribute causing reproductive inhibition in a given year. Although a temporal reduction in the proportion of reproductively active adult females has been reported at high densities in some Apodemus populations (e.g., Watts 1969, Nishikata 1979, Montgomery 1989), the factors limiting the number of re- productively active mice has hardly been demonstrated so far. Ostfeld (1985, 1990) hypothesized that female numbers are self-regulating through female territoriality, and that female numbers partly or wholly determine male num- bers in relation to mating success. Although the mechanism was not elucidat- ed in our study population, Ostfeld’s (1985, 1990) arvicoline-based hypothesis is as plausible for A. avgenteus as for A. sylvaticus (see Wilson et al. 1993). In comparison with the sympatric Clethrionomys rufocanus, reproduction of A. argenteus was suppressed at lower density levels with smaller observed maxi- mum number of reproductively active individuals for each sex, though the density amplitudes for both species were almost the same (Nakata 1989). Such interspecific differences in reproductive suppression were also observed among mature females of the sympatric A. agrarius and Microtus arvalis (Bujalska 1981). These findings suggest that reproduction inhibition is more intense in Apodemus than in arvicoline species. In other words, reproduction inhibition probably depends on differences in home range size and in socio-spatial organi- zation between mice and voles. Geographical variation in the timing of the breeding seasons of A. specizosus and A. argenteus seems to be related more intimately with temperature than with day length (Murakami 1974, Kimura 1977). According to Nishikata (1979), A. argenteus’ breeding seasons occur in spring when mean temperatures range from 2.5 to 13 °C, and in autumn when they range from 22.5 to 11.5°C. In our study population, however, reproduction occurred in autumn 1979 at tem- peratures well below 11.5 °C and contrarily reproduction did not occur above 11.5 °C in autumn 1978 (Fig. 5). Thus temperature does not always cause the variations in the breeding season of wild A. argenteus. When a population fluctuates in a uniform pattern from year to year, the effect of climate on the breeding season is likely to be well documented. In contrast, when a population exhibits significant multi-annual fluctuations, the effects of ecological factors such as density, seed yield and/or predation are 28 Mammal Study 23: 1998 thought likely to be of importance relative to the proximate factors. Adamcz- ewska (1961) found that an A. flavicollis population reproduced either in autumn or in spring-summer, and assumed that the crop of tree seeds exerted an important influence on the duration of the breeding season. Jensen (1982) then found that A. flavicollis extended its breeding season into winter in years when trees produced large crops of seeds. Furthermore, A. semotus’ summer decline in breeding, described by Lin and Shiraishi (1992), is a consequence of large numbers of yearlings entering the population. These findings also discredit the effect of temperature on breeding by Apodemus spp. Acknowledgments : I appreciate the continuous encouragement and the invalu- able suggestions of Dr. H. Abe throughout this study. I also thank Dr. K. Kamijo, Dr. T. Saitoh, Dr. T. Kawamichi and Mr. T. Shida for helpful com- ments on early drafts of this paper. Dr. M. Brazil kindly improved the English of the final manuscript. This paper is dedicated to Professor H. Abe on his retirement from teaching at Hokkaido University in March 1997. = LD) (@) (@) MEAN TEMPERATURE (°C) (@) Fig.5 Monthly mean temperature records at Higashikawa Meteorological Station. A= 1975, 0=1976, LJ=1977, @=1978, VW =1979. Nakata, Regulation of reproduction in field mice 29 REFERENCES Adamczewska, K. A. 1961. Intensity of reproduction of the Apodemus flavicollis (Melchior 1834) during the period 1954—1959. Acta Theriol. 5:1—21. Alibhai, S. K. and J. H. W. Gipps. 1985. The population dynamics of bank voles. Symp. Zool. Soc., LOGE Se Silay Bobek, B. 1973. Net production of small rodents in a deciduous forest. Acta Theriol. 18 : 403—434. Bujalska, G. 1981. Reproduction strategies in populations of Microtus arvalis (Pall.) and Apodemus agrarius (Pall.) inhabiting farmland. Pol. Ecol. Stud. 7: 229—243. Dice, L. R. 1938. Some census methods for mammals. J. Wildl. Manage. 2: 119—130. Flowerdew, J. R. 1985. The population dynamics of wood mice and yellow-necked mice. Symp. Zool. Socweona: 555015 —-o30: Fujimaki, Y. 1966. Age variation in the external characters of Apodemus argenteus. Memm. Fac. Agr. Hokkaido Univ. 5: 212—217 (in Japanese with English summary). Fujimaki, Y. 1969. The fluctuation in numbers of small rodents. Bull. Hokkaido For. Exp. Stn. 7: 62—77 (in Japanese with English summary). Fujimaki, Y. and T. Kuwahata. 1984. Life histories. Jn (K. Ota, ed.) Study of wild murid rodents in Hokkaido. pp. 47—76. Hokkaido Univ. Press, Sapporo (in Japanese). Hamet-Ahti, L., T. Ahti and T. Koponen. 1974. A scheme of vegetation zones for Japan and adjacent regions. Ann. Bot. Fennici 11 :59—88. Hayashi, C. 1952. On the prediction of phenomena from qualitative data and the quantification of qualitative data from the mathematico-statistical point of view. Ann. Inst. Stat. Math. 3 :69— 98. Henttonen, H., A.D. McGire and L. Hansson. 1985. Comparisons of amplitudes and frequencies (spectral analyses) of density variations in long-term data sets of Clethrionomys species. Ann. Zool. Fennici 22 : 221—227. Jameson, E. W. Jr. 1950. Determining fecundity in male small mammals. J. Mamm. 31 : 433—436. Jensen, T.S. 1982. Seed production and outbreaks of non-cyclic rodent populations in deciduous forests. Oecologia (Berl) 54: 184—192. Kimura, Y. 1977. On the breeding activity of the Japanese long-tailed field mouse, Apodemus argenteus, in Urabandai in Fukushima Prefecture. Sci. Rep. Fukushima Univ. 278 :51—57 (in Japanese with English abstract). Krebs, C. J. and J. H. Myers. 1974. Population cycles in small mammals. Adv. Ecol. Res. 8 : 267—399. Lin, L.-K. and S. Shiraishi. 1992. Reproductive biology of the Formosan wood mouse, Apodemus semotus. J. Fac. Agr. Kyushu Univ. 36: 183—200. Montgomery, W.I. 1989. Population regulation in the wood mouse, Apodemus sylvaticus. II. Density dependence in spatial distribution and reproduction. J. Anim. Ecol. 58 : 477—494. Moreno, S. and M. B. Kufner. 1988. Seasonal patterns in the wood mouse population in Mediterranean scrubland. Acta Theriol. 33 :79—85. Murakami, O. 1974. Growth and development of the Japanese wood mouse (Apodemus speciosus) I. The breeding season in the field. Jap. J. Ecol. 24:194—206 (in Japanese with English synop- sis). Nakata, K. 1986. Litter size of Apodemus argenteus in relation to population cycle. J. Mamm. Soc. Japane liye li: Nakata, K. 1989. Regulation of reproduction rate in a cyclic population of the red-backed vole, Clethrionomys rufocanus bedfordiae. Res. Popul. Ecol. 31 :185—209. Nishikata, S. 1979. Ecological studies on the population of Apodemus argenteus argenteus in Mt. Kiyosumi, Chiba Pref. I. A life cycle and fluctuations of population size. J. Mamm. Soc. Japan 7: 240—253 (in Japanese with English abstract). Ostfeld, R.S. 1985. Limiting resources and territoriality in microtine rodents. Am. Nat. 126:1—15. Ostfeld, R.S. 1990. The ecology and territoriality in small mammals. Trends Ecol. Evol. 5: 411— 415. 30 Mammal Study 23: 1998 Saitoh, T. 1981. Control of female maturation in high density populations of the red-backed vole, Clethrionomys rufocanus bedfordiae. J. Anim. Ecol. 50 :79—87. Stenseth, N.C. and E. Framstad. 1980. Reproductive effort and optimal reproductive rates in small rodents. Oikos 34 :23—34. Taitt, M. J. and C. J. Krebs. 1985. Population dynamics and cycles. Jn (R. H. Tamarin, ed.) Biology of New World Microtus. pp. 567-620. Am. Soc. Mammal. Spec. Publ. 8. Tanaka, Y., T. Tarumi and K. Wakimoto. 1984. [Handbook of Statistical Analysis by Using Personal Computers. II. Multivariate Analysis.] Kyoritsu Press C. Ltd., Tokyo, 403 pp. (in Japanese). Tatewaki, M. 1958. Forest ecology of the islands of the north Pacific Ocean. J. Fac. Agr. Hokkaido Umi HO SS7URKASS. Wilson, W. L., W.1. Montgomery and R. W. Elwood. 1993. Population regulation in the wood mouse Apodemus sylvaticus (L.). Mammal Rev. 23 :73—92. Watts, C.H.S. 1969. The regulation of wood mouse (Apodemus sylvaticus) numbers in Wytham Woods, Berkshire. J. Anim. Ecol. 38 : 285—304. Zippin, C. 1956. An evaluation of the removal method of estimating animal population. Biometrics 132 NOs =), (Accepted on 13 November 1997) MALES V [ 1IMNIZ2 Tl I | 6L Mp B2tt V LEO 0 | ol peer i 0 86od | © ct, Ole | ANN! peifpent. [ee | U | ial U < | Id [a l >t BMA's OV zi Lag | lIB@GZde mil IV 1 il Zl em 277ml | | Hi El tia [Me | ‘Tete! tl I] I J D00 100 O00 | ww I IU [ [ a ee J A QO MJJASON MJ JASON MJ JASON MJ JASO 1975 1976 1977 1978 1979 Appendix 1. Age distribution of trapped A. argenteus. Each small rectangle represents one autopsied mouse. MHl=reproductive, //=post-reproductive, |)=immature mouse. Age clas- ses were: I =25 days old, Il =1-2 months old, III =2-4 months old, VW =4-10 months old, and V =10-18 months old. Appendix 2. Simple correlation coefficients between reproductive rate (Y), population density(X,), fluctuation phase(X,), and season(X;) Males Females xe xe X53 Xy Xo X3 Y 0.746 0.562 0.618 0.637 0.822 0.410 xX 0.184 0.467 0.386 0.458 X2 OL178 0.083 Mammal Study 23: 31-40 (1998) © the Mammalogical Society of Japan Den site selection and utilization by the red fox in Hokkaido, Japan Kohji URAGUCHI: and Kenichi TAKAHASHI? Hokkaido Institute of Public Health, Sapporo O60-O819, Japan Fax. +81-11-736-9476, ‘e-mail. ura @iph.pref.hokkaido.jp, *e-mail. takaken @iph.pref.hokkaido.jp Abstract. Den site selection and den use by the red fox, Vulpes vulpes, were studied on the Nemuro Peninsula, eastern Hokkaido, Japan. Certain physical variables of 144 fox den sites were compared with those of 236 randomly selected control locations. The red foxes on the Nemuro Peninsula clearly preferred to den on slopes in woodlands near open spaces and streams. The seasonal pattern of den utilization was studied from June 1986 to May 1987. Red foxes used dens mainly during the period from January to June. Since this period coincides with the gestation, parturition and cub rearing periods of the red fox, it was confirmed that the red fox’s den was fundamentally a breeding site. Almost all dens were observed each spring from 1986 to 1996 to establish whether they were used for breeding or not, and it was found that the number of fox families was stable during this decade. Key words: den, Hokkaido, red fox, habitat selection, Vulpes vulpes. Habitat selection is a reflection of a species’ environmental, ecological and physiological requirements. For the red fox, Vulpes vulpes, den sites are very important because the cubs are born there and because they are reared there while still juveniles. Therefore, foxes might be expected to exercise some preference when choosing locations for their dens. Although many studies have described fox den characteristics in different habitats (e.g., Scott and Selko 1939, Storm et al. 1976, Roman 1984, Zhou et al. 1995), there have been few quantitative studies on den site selection by red foxes (Nakazono and Ono 1987, Meia and Weber 1992). Information on den site preferences, and on the number of breeding dens being used in a given area, are useful for understanding both the habitat evaluation being made by red foxes for reproduction, and any trends in their population dynamics. Furthermore, such an understanding is helpful in the development of control measures against zoonoses transmitted by red foxes. In this study, we describe the habitat factors associated with dens that we detected by comparing certain variables from den sites with those of control sites, and we also describe the utilization pattern of fox dens in Hokkaido, Japan. 32 Mammal Study 23: 1998 STUDY AREA The study area (73.0 km?) is located in the central part of the Nemuro Peninsula in eastern Hokkaido. The area is composed of low rolling hills with about twenty streams in small eroded valleys with steep slopes. The highest point was only 55 m above sea level. The study area consisted of a mosaic of pastures (43.6%), grasslands (24.7%), woodlands (20.7%) and residential areas (11.0%). The pastures consisted largely of Phleum pratense which was culti- vated for pasturage and hay-making. The grasslands were dominated by Sasa nipponica, Gramineae spp. and Avtemisia montana. The woodlands were principally located along the banks of streams and were dominated by broad- leaved deciduous trees such as Quercus nipponica, Alnus hirsuta and Betula ermani. There were also small woodlots of Abzes sachalinensis. The climate of this area is cool: the mean February temperature is —5.3°C and the mean August temperature is 17.1°C. It usually snows from late December to March, and the average yearly precipitation is 1,035mm (National Astronomical Observatory 1996). The human population of this area was about 30,000, 95% of whom lived in two residential areas. There were some fishing ports along the sea coast, and 54 dairy farms were scattered through the area. METHODS The field work for this study was conducted from 1986 to 1996, however forty-eight fox dens had already been located before the main field study began as a result of questioning farmers and from field inspections made during 1984 and 1985 (Kondo pers. comm.). Since this preliminary information suggested that there were few dens in pastures, we searched for fox dens in grasslands and woodlands mainly during May and June 1986. Because most of the woodlands in this area were located along streams, almost all stream banks were inspect- ed. Stream banks were usually surveyed by one observer traversing upstream along one bank and downstream along the other. In open areas, such as grassland slopes, binoculars were also used. Most dens observed in Hokkaido consist of tunnels with a diameter of some 20cm excavated by the foxes themselves. Although rabbits, Ovyctolagus cuniculus, and badgers, Meles meles, dig tunnels in this size range elsewhere, hence leading to some difficulties of identification (Cowan 1991, Roper 1992), neither rabbits nor badgers are found in Hokkaido. Raccoon dogs, Nyctereutes procyonoides, possibly use such tunnels as their dens, but few individuals occur in this study area (Kondo pers. comm.). Therefore, we regarded all excavated tunnels with a diameter of circa 20 cm as fox dens. All dens were marked on a 1: 50,000 map, and numbered in the order that they were found. At each site, we measured a series of variables which were considered likely to be associated with dens, as in previous studies (Zhou e¢ al. 1995, Scott and Selko 1939, Roman 1984, Nakazono and Ono 1987, Meia and Uvaguchi and Takahashi, Den site selection by red fox 33 Weber 1992). These variables included: 1) habitat type within 10m of the primary entrance, 2) the number of entrances, 3) eight grade directions of the slope of the primary entrance, 4) the angle of the slope on which the primary entrance was located, 5) the distance to the nearest open space (non-wooded area which was more than 10m in diameter), 6) the distance to the nearest source of water, 7) the distance to the nearest dwelling house, and 8) the distance to the nearest road. The occurrence of red fox dens within habitats versus the relative avail- ability of habitats, determined from vegetation maps was tested using the G-test for goodness of fit (Sokal and Rohlf 1981). On the Nemuro Peninsula, even if foxes were to excavate dens in pastures, they would soon be destroyed, because the pastures are harvested by tractor every summer and autumn, and are plowed every three to five years. Two fox families that made their dens in residential areas during this study were immediately turned out or captured by city officers as pests. We, therefore, regarded pastures and residential areas as unsuitable habitat for denning by red foxes, and have excluded them from further discussion of den site selection by foxes on the Nemuro Peninsula. To ascertain which habitat factors influenced den site selection by red foxes, variables from den sites were compared with control sites within grass- lands and woodlands. Five hundred control locations were marked randomly onal: 25,000 map; the 264 control sites that fell within pastures or residential areas were excluded from the analysis leaving 236 control sites within grass- lands and woodlands. Distances to the nearest house and road were measured from maps, and the distance to the nearest open space was measured from aerial photographs. Because the direction and angle of a slope and the dis- tance to the nearest source of water were difficult to measure from either maps or aerial photographs, 80 of the 236 control sites were chosen randomly and visited using a hand-held GPS receiver (GPS45, GARMIN INTERNATIONAL) and the variables of the sites were measured directly. The habitat surrounding fox dens and habitat availability were compared using a 4X2 G-test of fitness. The mean values of the angle of the den slope and four kinds of distances for both den sites and control locations were compared using the two-tailed Mann-Whitney U-test. The frequencies of eight grade directions of the slope in the two samples were compared using an 8x2 G-test of independence (Sokal and Rohlf 1981). Repeating individual statistical tests increased the chance of type I errors. To compensate for this, we took the standard probability of $0.05 and divided it by the total number of tests (x=6) looking for differences in physical variables between den sites and control locations (Ortega 1987). Consequently, the conservative signifi- cance level (f/$0.008) was used. Dens were defined as either a) unoccupied, b) occupied but without cubs, or c) occupied with cubs (breeding dens) based on the presence of signs found during monthly visits from June 1986 to May 1987. The distinction between dens with or without cubs was based either on the direct observation of cubs, or on the presence or absence of conspicuous marks indicating their presence, 34 Mammal Study 23: 1998 e., polishing of excavated soil by cubs moving in the out of the den, fecal remains, and signs of play such as flatten grasses. From 1988 to 1996, dens were usually observed just once a year in spring in order to check the breeding status of the fox population. As the peak of fox parturition occurs from late March to late April in Hokkaido (Abe 1974), and because juveniles usually begin to emerge from the dens when about six weeks old, that is during May (Lloyd 1980), we mainly observed dens during the latter half of May. Red foxes are susceptible to even slight disturbance, and often move their juveniles from one den to another (Sargeant 1975, Storm ef al. 1976, Lloyd 1980, Stubbe 1980, Nakazono and Ono 1987) making it difficult, therefore, to distin- guish between natal dens and to which juveniles have been moved (rearing dens). In this paper, therefore, we have used the term “breeding den” to include both natal and rearing dens. Given the risk of disturbing the foxes and causing them to move by observing them, adjacent dens were always observed on the same day so as to avoid double-counting litters. A single vixen and her cubs might use several breeding dens, hence the number of breeding dens used did not equate to the number of families. In this study, the minimum distance from a breeding den to an adjacent family was assumed to be 500 m because 12 out of 15 known den translocations involved movements of less than 500m from the original den as indicated by radio- tracking and tag observation (Uraguchi unpublished). Dens within 500m of each other were regarded, therefore, as belonging to one pee and all other dens were assigned to different families. RESULTS 1. Den site selection by red fox A total of 161 fox dens were found in the study area by May 1996. The defining variables of 144 of those dens were recorded (the remainder were either destroyed by man or collapsed naturally). One hundred and twenty-eight, out of the 144 dens (88.9%), consisted of tunnels excavated by the foxes themselves, while the remaining 16 dens were artificial (underfloors of abandoned houses or warehouses, and under concrete debris). One den was found in pasture land, although systematic searching was not conducted in this habitat. Table 1. A comparison between the habitats of red fox den sites and habitat availability in a study area on the Nemuro Peninsula (7=140). Habitat type Deciduous Coniferous Mixed Grassland forest forest forest Percent available 40.0 A Ls yA Observed number (%) of dens* 50), oe ao) (eo) 53 (37.9) Expected number of dens 56.0 Ons. 4 (Ase) *Excepted four dens that were situated pastures or under the floors of houses. G=20.8, ad.f.=3, p<0.005. Uraguchi and Takahashi, Den site selection by red fox 30 Table 2. Mean values (+ SD) of physical variables of fox den sites and control sites within woodlands and grasslands on the Nemuro Peninsula. Variables Den sites n Control sites n p Angle of slope (° ) 305 (GE6 2) 107 55,6) (aes 20) 80 <0.0001* Nearest stream (m) 85.6 (4134.9) 144 185.9 (4260.0) 80 <0.0001* Nearest open space (m)** 137 (e207) 87 38.4! (2235..0) 85 0.0003* Nearest house (m) 408.7 (4248.6) Wal AGG83 (GEL 3) 236 0.0251 Nearest road (m) BUG (aeV 13) dal 48808 (GEA 5) 236 ORSSia7 *p<0.008 **Comparison between den site and control site within forests. Red fox den sites were not distributed randomly according to habitat availability. Dens were found more often than expected in woodlands and less often than expected in grasslands (Table 1). Furthermore, dens within wood- lands were located significantly closer to open spaces than were control loca- tions within woodlands (p=0.0003, Table 2). In our study area, most of the open spaces close to dens were grasslands. Fox dens were also located signifi- cantly closer to water sources (usually a stream), and on steeper slopes than the control sites. Den sites and control locations did not differ significantly in their distance from either the nearest house or the nearest road. The direction that slopes on which dens were located faced were recorded at 111 den sites and at 69 control locations. Dens occurred more frequently on slopes facing west and south-west and less often on slopes facing east or south-east than control locations, but this difference was not significant (G=15.4, d.f.=7, p=0.03). The average number of entrances per den for 140 dens was 3.5£3.6 (meant SD, range 1-36). Five physical variables of 20 dens used for breeding more than five times during the 11 year study were compared with those of 21 dens that were never used for breeding during the same 11 years. There was surprisingly no signifi- cant difference between them (Table 3). 2. Seasonal patterns of den utilization Although fox dens were utilized all year around, the proportion of dens utilized varies seasonally (Fig. 1). The percentage of dens utilized decreased during July, and remained low until December, then increased again during January, and remained high until June. Dens occupied by cubs were found from April onwards, but most of them were observed during May, June and July. 3. Annual change in the number of breeding dens The numbers of breeding dens and the numbers of families (estimated by the use of the 500m criterion) were calculated each year from 1987 to 1996, though not from 1986 because the sample size that year was too small (Table 4). The number of the breeding dens was 22-41 and the estimated number of families was 20-31. There were no significant differences between successive 36 Mammal Study 23: 1998 Table 3. Mean values (+ SD) of physical variables at dens used for breeding more than five times (7=20) and dens never used for breeding (x=21) during the 11 years from 1986 to 1996 on the Nemuro Peninsula. Variables Breeding dens Non-breeding dens p Angle of slope* (° ) 315.3 (a215L,,0) 29 56.(GE 5a) 0.402 Nearest stream (m) 85.0 (4148.7) 4: OF Gali 8i40) 0.657 Nearest open space (m) Gan (== 19>) BAS (E23 .,5)) 0.408 Nearest house (m) A063) (GE 17553) ANQ 3) GE22252) 0.927 Nearest road (m) 248.8 (4148.1) 238.9 (+185.9) 0.676 *For this variable only, the sample size for breeding dens was 19, and that for non-breeding dens was 18. years in either the numbers of breeding dens used or the estimated number of families, however, the number of breeding dens fluctuated more than the estimated number of families, and their trends were not always consistent with each other. Eighty-two dens were observed every year from 1986 to 1996. Of these 82, 61 (74.4%) were used for breeding at least once during the 11 year study. One den was used 11 times, three were used nine times each, and six were used eight times for breeding. These estimates are considered to be lower than actuality, because most dens were visited only once a year from 1988 onwards, thus breeding activity may have been missed. ” ec ® 3 SO T © a 40 oO (o) So 30 5 eZ S Cc Bie cool ® Of 8G J RSS +O ON UD Jd CRO M AM 88 93 95 95 96 99 102 71 101 102 101 103 1986 1987 Fig.1. Monthly variation in the proportion of dens occupied during the period from June 1986 to May 1987. MH: dens with cubs, LJ: dens without cubs. The number below each column represents the number of dens observed. Uraguchi and Takahashi, Den site selection by red fox ot Table 4. The number of breeding dens and estimated families. Expected numbers were calculated from the ratio of the average number of breeding dens and families to the average number of observed dens. 0.1 GS3 4) 9019 DISCUSSION Although red foxes are able to make their dens in various environments such as in woodlands, grasslands, plowed fields, pastures, dunes, among rocks and residential areas (Sheldon 1950, Nakazono 1970, Sargeant 1972, Abe 1974, Storm et al. 1976, Harris 1977, 1981, Macdonald and Newdick 1982, Roman 1984, Nakazono and Ono 1987), in this study area, their dens were strongly associated with relatively steep slopes near streams and open spaces in woodlands. The question remains open as to why they prefer these areas rather than others for denning. Den sites on steep slopes, as found during our study, may well be advanta- geous because of their good drainage. Some previous studies have also demon- strated that many fox dens are to be found in well-drained soil (e.g., Scott and Selko 1939, Sheldon 1950, Roman 1984), and most dens have been found on slopes with gradients of 5-10% or more (Scott and Selko 1939). On the Nemuro Peninsula, the angle of the slopes on which primary den entrances were located were relatively steep (meant SD =32.5+15.2°). Such den site selection may have been related to the fact that the soil of the study area consisted largely of Gleyic Cumulic Andosols which are badly drained (Hokkaido National Agricul- tural Experiment Station 1985). Slopes may be advantageous for denning for other reasons in addition to drainage. Digging and the removal of soil may be easier, for example, and on steep slopes perhaps rain and snow are less likely to fall into the dens. Goszczyfski (1989) described forests as primary shelter for foxes and for raising their young. Woods may also serve to provide shelter for juvenile foxes. In the present study area, however, fox dens within woodlands were situated closer to open spaces than were control sites within woodlands indicat- 38 Mammal Study 23: 1998 ing that open areas are also important for them. Nakazono and Ono (1987) suggested that juvenile foxes require substantial amounts of sunshine for normal growth. Marginal sites in woodlands might be preferable both for sheltering and for providing sunning opportunities for juveniles. Although many fox dens were situated near streams, we do not believe them to be essential for drink water, because adult foxes are able to find water to drink in many situations. Moreover since one den, located 300 m away from a stream, was used for breeding four times during five years, a stream does not seem necessary for juveniles to drink at either. The Nemuro Peninsula experi- ences many foggy days during late May and June when young foxes are being raised in the breeding dens. It is more than likely that the cubs are able to obtain sufficient water by licking leaves wet with fog and from the food provided by their parents. There is a tendency for steeper locations to be closer to a source of water (Fig. 2), thus the reason why many dens were situated near streams was probably the result of the foxes’ preference for well-drained, steeper slopes. No difference was found in five physical variables between breeding and non-breeding dens. During the course of this study, we were unable to evaluate the impact of disturbance by other animals, especially humans and stray dogs, on fox breeding, because it was difficult to express quantitatively. Distur- bance is, however, considered an important variable affecting selection and (") 60 50 40 30 Angle of slope 20 10 0 200 400 600 600» *' TOGO" 1200 Vim Distance to the nearest source of water Fig.2. The relationship between the angle of slope and the distance to the nearest water source of 80 control locations. Uraguchi and Takahashi, Den site selection by red fox 39 utilization of fox den sites (Storm et al. 1976, Harris 1977, 1981). One reason why no difference was found between breeding and non-breeding dens might be because of the absence of any measure of this “disturbance” factor in our analysis. In the Nemuro area, fox dens were mainly used during the period from mid winter to early summer, a tendency also reported for the red fox in Kyushu, southern Japan (Nakazono and Ono 1987). In Hokkaido, fox mating peaks from late January to mid February followed by a peak in parturition from late March to late April (Abe 1974). The period during which dens were used most intensively in the Nemuro area corresponded, not surprisingly, with the period of mating, parturition and rearing of cubs, confirming that dens are fundamen- tally breeding sites for the red fox. Of interest, therefore, is the fact that about half of the dens occupied were not used for rearing cubs during the later winter and early spring period, and 11-17% of dens were used even during the period from August to December, though not for breeding. Since few of the signs typical of frequent use such as polishing of excavated soil were observed, these dens might have served just as temporary retreats (Nakazono and Ono 1987). The density of families estimated using the 500m criterion was 0.27-0.42 families/km?, and was stable over a period of 10 years. There have been few studies on the density of fox families in Japan, however, the density in Nemuro was clearly higher than in either Yabe, Kyushu (0.18 families/km’, Nakazono and Ono 1987) or in Koshimizu, Hokkaido (0.24 families/km?, Abe 1974). Some studies in southern Sweden, central Europe and England have indicated that where vole densities are high, then fox populations became socially regulated stable and dense. The relatively high and stable density of fox families on the Nemuro Peninsula is probably due to the high density of voles in the area (Saitoh and Takahashi 1998) and the richness of alternative food, such as organic waste from fisheries and from dairy farms (Kondo eft al. 1986). Acknowledgments: We are grateful to Dr.H. Abe for his valuable advice during the course of this study, and dedicate this paper to him on his retirement from Hokkaido University. We thank T. Saitoh, E. Misawa, K. Yagi and the students of the Institute of Applied Zoology of Hokkaido University who assisted us with the search for fox dens. We also thank N. Kondo, many dairy farmers, hunters and citizens of Nemuro City and the staff of the Nemuro Health Center and of the Nature Preservation Section of Nemuro Sub- prefectural Office of the Hokkaido Government for useful information about the red fox on Nemuro Peninsula. REFERENCES Abe, H. 1974. Biology of red fox. Jn (Taketazu, M. ed.) Red Fox. pp. 76—83. Heibonsha, Tokyo (in Japanese). Cowan, D. P. 1991. Rabbit. Jn (Corbet, G. B. and S. Harris, eds.) The Handbook of British Mam- mals 3rd ed. pp. 146—154. Blackwell Scientific Publications, Oxford, London, Edinburgh, Boston, Melbourne, Paris, Berlin and Vienna. 40) Mammal Study 23: 1998 Goszczyfiski, J. 1989. Population dynamics of the red fox in central Poland. Acta Theriol. 34: Ady Harris, S. 1977. Distribution, habitat utilization and age structure of a suburban fox ( Vulpes vulpes) population. Mammal Rev. 7: 25—39. Harris, S. 1981. An estimation of the number of foxes ( Vulpes vulpes) in the city of Bristol, and some possible factors affecting their distribution. J. Appl. Ecol. 18: 455—465. Hokkaido National Agricultural Experiment Station. 1985. Classification and distribution of arable soils in Hokkaido. Sapporo, 95 pp. +1pl. Kondo, N., K. Takahashi and K. Yagi. 1986. Winter food of the red fox, Vulpes vulpes schrencki Kishida, in the endemic area of multilocular Echinococcosis. Report of the Preparative Office of Nemuro Municipal Museum. 1: 23-31. Lloyd, H.G. 1980. The Red Fox. Batsford, London, 320 pp. Macdonald, D. W. and M. T. Newdick. 1982. The distribution and ecology of foxes Vulpes vulpes (L.) in urban areas. Jn (Bornkamm, R., J. A. Lee and M. R. D. Seaward, eds.) Urban Ecology. pp. 123—135. Blackwell Scientific Publications, Oxford, London, Edinburgh, Boston and Mel- bourne. Meia, J.S. and J. M. Weber. 1992. Characteristics and distribution of breeding dens of the red fox (Vulpes vulpes) in a mountainous habitat. Z. Saugetierkunde 57 : 137-143. Nakazono, T. 1970. Researches of burrows of Vulpes vulpes japonica, in Kyushu, Japan 1. Exam- ples of the burrows and the distributions. J. Mammal. Soc. Japan 5:1—7. Nakazono, T. and Y. Ono. 1987. Den distribution and den use by the red fox Vulpes vulpes japonica in Kyushu. Ecol. Res. 2: 265—277. National Astronomical Observatory, ed. 1996. Chronological Scientific Tables. Maruzen, Tokyo, 1037 pp. Ortega, J.C. 1987. Den site selection by the red fox in southeastern Arizona. J. Mammal. 68 : 792— 798. Roman, G. 1984. The burrow construction strategy of foxes in the Biafowieza primeval forest. Acta Theriol. 29: 425—430. Roper, T.J. 1992. Badger Meles meles setts-architecture, internal environment and function. Mammal Rev. 22 : 43—53. Saitoh, T. and K. Takahashi. 1998. The role of vole populations in prevalence of the parasite (Echinococcus multilocularis) in foxes. Res. Popul. Ecol. 40:97—105. Sargeant, A. B. 1972. Red fox spatial characteristics in relation to waterfowl predation. J. Wildl. Manage. 36 : 225—236. Sargeant, A. B. 1975. A spring aerial census of red foxes in North Dakota. J. Wildl. Manage. 39: 3039) Scott, T.G. and L. F. Selko. 1939. A census of red foxes and striped skunks in Clay and Boone counties, lowa. J. Wildl. Manage. 3 :92—98. Sheldon, W.G. 1950. Denning habits and home range of red foxes in New York State. J. Wildl. Manage. 14 : 33—42. Sokal, R. R. and F. J. Rohlf. 1981. Biometry. 2nd ed. W. H. Freeman and Company, San Francisco, 859 pp. Storm, G. L., R. D. Andrews, R. L. Phillips, R. A. Bishop, D. B. Siniff and J. R. Tester. 1976. Morpho- logy, reproduction, dispersal and mortality of midwestern red fox populations. Wildl. Monogr. 49, 82 pp. Stubbe, M. 1980. Population ecology of the red fox (Vulpes vulpes L., 1758) in the G.D.R. In (Zimen, E., ed.) Biogeographica 18: The Red Fox. pp. 71—96. Dr. W. Junk bv Publishers, The Hague. Zhou, W., W. Wei and D.E. Biggins. 1995. Activity rhythms and distribution of natal dens for red foxes. Acta Theriologica Sinica 15: 267—272. (accepted 10 April 1998) Mammal Study 23: 41-48 (1998) © the Mammalogical Society of Japan Improvement of errors in radiotelemetry locations of brown bears, Ursus arctos, in Hokkaido, Japan Takahiro MURAKAMI and Tsutomu MANO? ‘Laboratory of Ecology, Department of Environmental Veterinary Science, Graduate School of Hokkaido University, North 18 West 9, Kita-ku, Sapporo O60-0818, Japan Fax. +81-11-706-5569, e-mail. ursus @ vetmed.hokudai.ac.jp ?Wildlife Section, Nature Conservation Department, Hokkaido Institute of Environmental Sciences, North 19 West 12, Kita-ku Sapporo O60-O819, Japan Abstract. The errors and the sources of errors made while fixing radiotelemetry locations were estimated in two brown bear, Ursus arctos yesoensis, study areas, in the Shiretoko and Oshima regions of Hokkaido. We measured the sampling error and the bias of test transmitters placed at various points in our study areas. The means of our sampling errors were approximately equal to those previously reported by Springer (1979), while the maxima of our sampling errors and the means of our biases were larger than those of Springer’s (1979). We also assessed the amount of error in estimating locations based on measuring three bearings. As the sizes of triangles were positively related to the degree of error in estimating their points, we excluded large (> 6.25 ha) triangles from the analysis. The maximum values of the 99% confidence intervals for normalized error distances were 321.4 m in the Shir- etoko area and 302.3 m in the Oshima area. These values were compared with Lenth’s (1981) Andrews estimators calculated from the original data sets of both study areas. The direct method for estimating radiotelemetry error which we used in this study is easy to calculate and proved not to be inferior to Lenth’s (1981) method. Key words: brown bear, error estimation, field test, radiotelemetry, triangle S1Ze. Radiotelemetry is often used to locate free-ranging wild animals. Numerous studies including those of home range, habitat use and movement have depend- ed on radiotelemetry (Samuel and Fuller 1994). Locations, which are esti- mated by radiotelemetry do, however, include a certain degree of error (Sprin- ger 1979, Zimmerman 1990). Because brown bears have much larger home ranges than most other terrestrial mammals, and because they are difficult animals to approach, the estimated locations of radio-collared bears may contain large degrees of error. Saltz (1994) indicated that many radiotelemetry studies did not describe their degree of error. Saltz (1994) further asserted that researchers should both measure and describe their degree of error on the basis that if a radiotelemetry study were conducted without error estimation, then it could lead to misunder- 42 Mammal Study 23: 1998 standings of animal movements or of their habitat utilization patterns. Various methods of estimating location error have been described (Heezen and Tester 1967, Springer 1979, Lenth 1981, Garrott et al. 1986), however, Zimmerman and Powell (1995) considered that these methods, over-estimate location errors when applied to field data. Furthermore, some of these methods have strict prerequisites and some require long calculation processes. In Japan, Maruyama eft al. (1978) measured the distances between the estimated and the actual locations of four Sika deer, Cervus, nippon fitted with transmitters. Maruyama et al’s (1978) study, however, described only the extent of error under special conditions, and neither indicated how to detect or decrease errors. Since Maruyama et al’s (1978) study, radiotelemetry studies reported in Japan have paid little or no attention to error. Improvement of the error estimation method in the field and the promotion of a greater awareness of it among researchers is necessary for the appropriate interpretation of large mammal behavior. Zimmerman and Powell (1995) introduced an original error indicator which was based on the statistics derived from the linear distance between the actual and the estimated locations of test transmitters. We also used test transmit- ters in the field in order to estimate the degree of error of the location method, a method often used in Japan, and compared it with Lenth’s (1981) Andrews estimator. By using our method, researchers who use radiotelemetry to study large mammals can easily estimate the area of error of their estimated loca- tions and can improve the precision of their estimation. STUDY AREA Our study was conducted in two brown bear radiotelemetry study areas, one of which was in the Shiretoko National Park in eastern Hokkaido, and the other of which was on the south-western part of the Oshima Peninsula in southwestern Hokkaido, Japan. In the first of these two areas, the Shiretoko-Renzan mountains, ranging in height from 700m to 1,600m, run along the center line of the Shiretoko Peninsula. The flanks of these mountains meet the coastline abruptly. Japanese stone pine, Pinus pumila, is dominant above 500-600 m, while at lower elevations mixed forest predominates. There are two paved roads which facilitate radio tracking inside the study area where the road density is 0.37 km/km?. The second study area, the south-western part of the Oshima Peninsula, is also mostly mountainous, but here the mountains range from just 200 to 600 m in altitude. The terrain is more rugged than in the Shiretoko study area because there are many steep streams. The most common vegetation here is deciduous forest. There are two paved roads and several forestry tracks inside the area which facilitate radio tracking. The road density here is 0.44 km/km‘?. Murakami and Mano, Telemetry error improvement 43 MATERIALS AND METHODS 1. Measurement of Bias and of Sampling Errors Radiotelemetry error is derived from a combination of bias and sampling error (Springer 1979), where bias is the angle between the measured value and the true direction of the transmitter, and where sampling error is the amount of variation in estimated values when repeatedly taking bearings off the same transmitter and when using the same apparatus. In order to quantify such bias and error, we set several 144-147 MHz radio transmitters (Telonics, Inc., Mesa, Arizona, or Loteck, Inc., Aurora, Ontario) within the study area. Someone who was unaware of the transmitter’s location was selected to measure sam- pling errors and biases from several points on one of the roads in the study area. Directions were determined using a 3-element Yagi-antenna and an F[290- mk II receiver (Yaesu Musen, Inc., Tokyo). The direction from each receiving point to each transmitter was measured 10 times. Following Springer (1979), we considered pooled standard deviations as the sampling error, and regarded the angles between the average bearings of measured values and the true directions as the biases. After one set of measurements was made, the trans- mitter was moved to another location, and the procedure was repeated. We included biases derived from the following tests in our analyses. A map of the study area was overlaid with a grid of 500 m square quadrats. Because topographical similarity affects results, it was decided to use only one transmitter set point within a single quadrat. Transmitters were set at 21 points in the Shiretoko study area, and at eight points in the Oshima area. The distances between the observers and the transmitters, ranged from 350m to 2,150 m (m= SD =1,156.2 +569.9 m) in the Shiretoko study area, and from 175 m to 3,750 m (m+ SD =1,770.6+£951.2 m) in the Oshima area. 2. Measurement of the Error of Estimated Locations Maruyama et al. (1978) described an original method which considered the centroid of the triangle, derived from three bearings as the location of the transmitter. Some researchers in Japan have used this method (Hokkaido Institute of Environmental Sciences. 1995), which we now call the Triangle Center Method or TCM. Transmitters were set at various points in the study areas, as described in the previous section ; 17 transmitter set points were used in Shiretoko and 30 in Oshima. We measured the bearings of the signals from three to nine receiving points for each transmitter set point and recorded each bearing and receiving point on 1: 25000 scale topographical maps. The location of each transmitter set point was calculated using the TCM by a researcher who did not know its location. We then gauged the distances between the true locations and the centers of triangles derived from any three bearings. Large triangles exceed- ing 6.25 ha, which is the size we use in our brown bear study, were excluded 44 Mammal Study 23: 1998 from location estimation in order to improve reliability. This method was used after confirmation of the positive correlation between triangle size and error distances. Lenth’s (1981) Andrews estimator was considered by White and Garrott (1990) to be the most reliable way to estimate location errors. We calculated Andrews estimator from our data (computed by TRIANG [Garrott e¢ al. 1986], provided by G. C. White), and compared this with the TCM error. The distances between observers and transmitters in our study ranged from 75 m to 4,063 m (m+SD =1,392+769.2 m) in the Shiretoko area, and from 100 m to 3,750 m (m+ SD =1,185+769.0 m) in Oshima. These values differed from those obtained in the previous section, because the transmitter set points were different from those used when measuring bias and sampling error. RESULTS 1. Bias and Sampling Error Mean sampling errors were 4.31.7 (SD)° in Shiretoko area, and 6.0+4.5 (SD)° in Oshima area. The maximum sampling errors recorded were 8.7° in Shiretoko area and 20.2° in Oshima area. Biases ranged from —172° to +61.5° in Shiretoko area, and from —108 to +140° in Oshima area. Biases aver- aged —2.3+27.7 (SD) in Shiretoko area, and —3.6+31.9 (SD)° in Oshima area (see Fig. 1 for the frequency distribution of biases in each study area). 2. Error of Estimated Location In Shiretoko area, 188 triangles were derived from triangulation of 17 transmitter set points. In Oshima area, we obtained 133 triangles from 30 transmitter set points. The means of estimation errors were 495.5 + 467.4 (SD) Shiretoko Oshima \) RR Frequency of errors on MH RYYYAAHAVBQH 77 ZZ -150 -100 -50 (£4 77 100 150 -150 -100 -50 0 50 100 150 Bias (° ) Fig.1. Frequency distributions of biases accompanied by bearings in the Shiretoko and Oshima study areas. Biases ranged from —172° to +61.5° in Shiretoko area and from — 108° to +140° in Oshima area. 50 (=) Murakami and Mano, Telemetry error improvement 45 m in Shiretoko area and 339.2+286.3 (SD) m in Oshima area. There was a positive correlation between triangle size and estimated location error when using the TCM (Fig. 2, Kendall’s 7=0.23, P<0.01 in Shir- etoko area and r=0.35, P<0.01 in Oshima area). When we excluded large triangles (those exceeding 6.25ha) from the analysis of location error, we obtained a frequency distribution of location errors (Fig. 3). As these distribu- tions were not parametric (Shapiro-wilk test for normality, P<0.01), we calcu- lated the cube root of each value to obtain a normal distribution. After transformation, the means of the TCM errors were 260.6+7.28 (SD) m in Shiretoko Oshima Error distance (m) Area of triangle (ha) Fig. 2. The relationships between the estimated location error of the TCM and the areas of triangles derived from three measured bearings. Estimated locations from larger triangles tend to have larger location errors. Shiretoko Oshima Y Y UY yy Gy; j yy. Gh LY, LY; Wh nU1 7, YG; ALLA 0 400 800 1200 1600 2000 0 400 800 1200 1600 Error distance by TCM (m) ] ] Y ¢ Y; Yy Y; Y Y; Yy Y; Yj Y; Yy Uy; Yy Y Yy Y Y Y Y Y Y Y Y Y Y Y Y G Y Y Y y Y y Y Y Y Y Z Y Y Y Y Uy Y y Y ] ] / / / Ly Y y YG Yy Uy; Y Yy Y Yy y Y Uy Yy ZZ Frequency of error distance o Fig. 3. Frequency distributions of error distances between locations estimated by TCM and true locations. 46 Mammal Study 23: 1998 Shiretoko area and 241.7+5.96 (SD) m in Oshima area. The maxima of the 99 % confidence intervals were 321.4 m in Shiretoko area and 302.3 m in Oshima area. In the same way (though using natural logarithms instead of cube roots for normalization of the Oshima data sets), the means of the location errors found by Andrews estimator for the same data sets were calculated to be 258.5+61.08 (SD) m in Shiretoko, and 297.7+7.53 (SD) m in Oshima. The maxima of the 99% confidence intervals in Shiretoko were 319.9m, and 381.6 m in Oshima. The means of TCM errors did not differ significantly from those of Andrews estimator in Shiretoko (Student’s t-test, £=0.37, p >0.05), while in Oshima, the mean of Andrews estimators was significantly larger than that of TCM errors (Student’s t-test, £=54.3, p<0.01). DISCUSSION Springer (1979) who measured biases and sampling errors in field trials reported that sampling errors ranged from 3.4° to 4.3° and biases ranged from —(0.4° to 1.7°. In our field tests, although the means of the sampling errors (4.3° and 6.0°) were nearly equal to Springer’s (1979) values, the maxima (8.7° and 20.2°) were much larger. The means of our biases, —2.3° and —3.6’, did not differ significantly from zero (Student’s f-test, Shiretoko: t=0.63, p>0.05; Oshima: t=1.00, p>0.05), however the ranges of our biases were much wider. These differences may be accounted for by differences in study conditions. Springer’s (1979) study area was comparatively flat, whereas our study area contained steep terrain. Sometimes we received radio signals from a very wide range of directions and as a result we experienced large sampling errors. Hilly terrain also generates large biases (Lee et al. 1985). Thus, when using radiotelemetry in mountainous areas such as the Shiretoko and Oshima Penin- sulas, we must take into consideration the likelihood of large sampling errors and biases. Large biases and large sampling errors cause large location errors. It appears that estimated TCM locations may include large errors. Maruyama et al. (1978) reported a TCM error of 123+11.8 (SD) m on Kinkazan Island, however, the maxima of the 99% confidence intervals of the TCM errors for our two study areas were even larger at over 300m. We consider that this difference may have been caused by differences in our experimental methods. Maruyama et al. (1978) did not describe the distance between their transmitters and receivers, which, on the basis of the figures that appear in their report, may have been under 800 m. In contrast, the mean distances between transmitters and receivers in our study was greater than 1,000m. Furthermore, the topo- graphy of Kinkazan Island is less rugged than that of either of our study areas. These factors, we believe, may well have affected the results. Zimmerman and Powell (1995) considered the arithmetic mean of the compass bearing intersec- tions, derived from three bearings, to be the estimated location, and reported the mean of the linear distances between their estimated and true locations as Murakami and Mano, Telemetry error improvement 47 279m. Our TCM error was very similar to this value, and our study conditions were also similar to theirs. Their tracking distances ranged from 300m to 6,020 m, while ours, ranged from 75m to 4,063 m and from 100 to 3,750 m. We consider that the long range locations of large mammals are ac- companied by degrees of error which can not be disregarded, however, when radiotelemetry is used for animal studies, there is rarely an opportunity to know the distance between an animal’s real, and its estimated, location. Salts (1994) recommended that those using radiotelemetry should assess their degree of error with an appropriate method and should describe their area of error. Andrews estimator was regarded as robust, particularly where reflected signals occurred frequently (Garrott ef al. 1986). It was concluded, however, that Andrews estimator suffers the same extent of error as that estimated by the TCM, or even a significantly larger error than the TCM. Andrews estimator maintained accuracy by failing to generate location estimates when bearings did not adequately converge (Garrott et al. 1986). In our field data, it may be impossible to eliminate bad locations sufficiently, as many bearings were biased. Zimmerman (1990) and Zimmerman and Powell (1995) showed that both the error polygon method (Heezen and Tester 1967) and Lenth’s (1981) maximum likelihood estimator which is the origin of Andrews estimator were poor indicators for estimating location errors and they recommended an approach using the location error method (LEM). Error areas using this approach were indicated by circles with 90% and 95% confidence distances between estimated locations and true locations as their radii (Zimmerman and Powell 1995). Our approach was essentially the same as the LEM, and our results confirmed the superiority of this approach. We were able to realize the extent of our TCM location errors by field testing. We urge that when researchers begin a radiotelemetry study, they measure their location precision in the field. They must then judge whether the degree of error that they record is acceptable or not. They should also describe their average location distances and the extent of errors in their reports. In this study, we did not consider possible increases of error resulting from animal movements. Shumutz and White (1990) calculated such errors by computer simulation. We should take these errors into account by adding error or by decreasing the time interval of measurement. Acknowledgments : We wish to thank Mr. K. Okada, Mr. T. Koizumi, Ms. M. Endo, Mr. Y. Kawamoto, Ms. A. Kinjo, Ms. T. Matsuhashi, Ms. Y. Matsuura, Mr. F. Nomura, Ms.H. Maeno, Mr.S.Waga, Mr. K. Suzumura, ‘Mr. N. Fu- jimoto, Mr. K. Hoshina, Mr. U.Goudo, Mr. H. Shinohara, Mr. H. Hamamoto, Mr. H. Hashimoto, Mr. M. Asano, Mr. A. Umejima and Ms. T. Sawaguchi, who devoted themselves to our field test. We are indebted to Mr. Y. Yamanaka, Mr. H. Okada and the staff of the Shiretoko Nature Center and members of Hokkaido University’s brown bear research group for supporting our research. Thanks are due also to: Dr. N. Ohtaishi, Dr. M.Ohmiya, Dr. Y. Ono, Dr. Y, 48 Mammal Study 23: 1998 Kurashige, Mr.S. Kameyama and Dr. H. Tsukada for helpful suggestions and to Dr. M. Masuda, and Mr. B. Albrecht, for their contributions to improving the manuscript. Dr. M. Brazil kindly improved the English of the final manuscript. This research was supported in part by PRONATURA FUND from the Nature Conservation Society of Japan, and the Wildlife Distribution and Abundance Research Project of the Hokkaido government. REFERENCES Garrott, R. A., G.C. White, R.M. Bartmann and D.L. Weybright. 1986. Reflected signal bias in telemetry triangulation systems. J. Wildl. Manage. 50: 747—752. Heezen, K.L., and Tester, J. R. 1967. Evaluation of radio-tracking by triangulation with special reference to deer movements. J. Wildl. Manage. 31: 124—141. Hokkaido Institute of Environmental Sciences. 1995. A report of ecological investigation of brown bears and deer 1, A report of distribution of wildlife in Hokkaido (1991-1993), 164 pp. (in Japanese). Lee, J. E., G.C. White, R. A. Garrott, R. M. Bartmann and A. W. Alldredge. 1985. Assessing accuracy of a radiotelemetry system for estimating animal locations. J. Wildl. Manage. 49 : 658—663. Lenth, R. V. 1981. On finding the source of a signal. Technometrics 23: 149—154. Maruyama, N., T. Ito, K. Tamura, M. Miyaki, M. Abe, S. Takatsuki and T. Naito. 1978. Application of radiotelemetry to Sika deer on Kinkazan Island. J. Mammal. Soc. Japan. 7: 189—198 (in Japanese with English abstract). Saltz, D. 1994. Reporting error measures in radio location by triangulation: a review. J. Wildl. Manage. 58: 181—184. Samuel, M.D. and M.R. Fuller. 1994. Wildlife radiotelemetry. Jn (Bookhout, T. A., ed.) Research and Management Techniques for Wildlife and Habitats. 5th ed. 370—418. The Wildlife Society, Bethesda, Md. Shumutz, J. A. and G.C. White. 1990. Error in telemetry studies: effects of animal movement on triangulation. J. Wildl. Manage. 54 :506—510. Springer, J. T. 1979. Some sources of bias and sampling error in radio triangulation. J. Wildl. Manage. 43 : 926—935. White, G.C. and R. A. Garrott. 1990. Analysis of Wildlife Radio-tracking Data. Academic Press, San Diego, 383 pp. Zimmerman, J. W.1990. 10 1 Mar Apr May June July Aug Sept Oct Nov Month Fig. 1. Seasonal changes in the numbers of R. cornutus (---A---), R. ferrumequinum (—*#—), M. macrodactylus (---C---), M. natterert (—@— ) and M. fuliginosus (---)---) at Katano-d6 Cave in 1994. 52, Mammal Study 23: 1998 males and subadult females. 2. Food habits Five orders of volant insects: Diptera, Lepidoptera, Coleoptera, Tricho- ptera and Ephemeroptera, as well as spiders (Araneae) were represented in the diet of M. nattereri (Fig. 2). The body lengths of the available prey were 5-13 mm (Table 1). Among the taxa commonly preyed on by M. nattereri were Sericania (Scarabaeidae, body length ca. 11 mm), Macrolagria rufobrunnea (Lagriidae, ca. 10 mm), Carabidae (ca. 10 mm), Tipulidae (8-13 mm), Araneidae (6-8 mm), Tetragnatha (Tetragnathidae, 8-10 mm) and Theridiidae (ca. 6 mm). The frequency of the occurrence of Diptera in M. nattereri feces fluctuated between 15 and 39% from April to November (see Fig. 2). The frequency of Lepidoptera was 15-26% from April to August, but increased to 33-50% in fall. The frequency of Coleoptera was 42% in April, but dropped to 8% in May before increasing to 18-27% in summer, and then falling to 7-21% in fall. The occurrence of Trichoptera and Ephemeroptera was less than 13% from April to November, while the Araneae varied from 3-48% from April to November, peaking 40-48% in May-June. The prey of R. ferrumequinum included Diptera, Lepidoptera, Coleoptera, Trichoptera and Plecoptera (Fig. 3), ranging in size from 8 to 45 mm (Table 1). Species or genera that were frequently found in the diet included: Tzpula coquilletti, other Tipulidae and Tabanus (Diptera, 14-30 mm in body length) ; Holotrichia picea, Anomala cuprea, A. geniculata, A. daimiana, A. albopilosa, Melolontha japonica, M. satsumaensis, Mimela splendens, M. costata, Maladera castanea, M. secreta, Hydaticus grammuicus, Melanotus legatus and Prionus insularis (Coleoptera, 10-45 mm long). The frequency occurrence of Diptera 100 -~ —wZvZ > 80 c iptera ® ; =) (50) \ Il UT phepisepiaie oy ee ee Oo °°» (|e eee YY ws: me Coleoptera bs CS BA Vad d ® 40 ME CLE [7] Trichoptera oO yy ey uu c Yee iy, ee iy g a | [] eEphemeroptera Vege EE 1 = 4 @® Yay : : Ble er 4 el] & = Uy a A ecelene) Be Araneae 20 a“ nN 58087 — = oy AL EL eens wee A S ae Oo Apr May June July Aug Sept Oct Nov Month Fig. 2. Seasonal changes in occurrence frequency of foods (order level of insects) in the feces of M. natterert in 1994-1995. Funakoshi and Takeda, Food habits of insectivorous bats Table 1. Body length for each order of insects found in fecal pellets of bats. Bat species Prey item Myotis nattereri Myotis macrodactylus Miniopterus fuliginosus Rhinolophus cornutus Rhinolophus ferrumequinum Coleoptera Lepidoptera Diptera Trichoptera Ephemeroptera Coleoptera Lepidoptera Diptera Trichoptera Ephemeroptera Coleoptera Lepidoptera Diptera Trichoptera Ephemeroptera Coleoptera Lepidoptera Diptera Trichoptera Coleoptera Lepidoptera Diptera Trichoptera SLPALE LE: | aA v7 “or | se see Pd a. \ ee | pee 1 & wee | f er. ts ft o, 7 z ae Occurrence frequency (%) June July Aug Sept Month ae - Body length Oct (mm) Osa liZ = 18} ie pil! oo IU) CHA oy — Ils} G=A15 8—20 UE Or il2 6—15 Ome (27 SA) NO IA Sa 2Z 8) i723 oe ld) 9—45 Wai NOS 30 ae I Sf BAO Diptera Lepidoptera Coleoptera Trichoptera Plecoptera 03 Fig. 3. Seasonal changes in occurrence frequency of foods (order level of insects) in the feces of R. ferrumequinum in 1994-1995. 54 Mammal Study 23: 1998 in R. ferrumequinum feces was 71% during March, but fluctuated between 30 and 48% from April to October (Fig. 3). The frequency of Coleoptera in the diet varied between 26 and 56% from March to September, and dropped to 4% in October, whereas the frequency of Lepidoptera gradually increased from April onwards reaching 43% in October. The frequency occurrence of both Trichoptera and Plecoptera was less than 11% from spring to fall. Most significant was that the combined frequency occurrence of both Diptera and Coleoptera was 80% or more from May to August. The diet of M. macrodactylus included Diptera, Lepidoptera, Coleoptera, Trichoptera, Plecoptera, Ephemeroptera and Araneae, ranging in size from 7 to 20 mm in body length (Table 1). These bats commonly took for example: Tipulidae (8-20 mm in body length), Tabanidae (ca. 18 mm), Scarabaeidae (A. geniculata ca. 12 mm, A. daimiana ca. 16 mm, and H. picea ca. 18 mm), and Araneidae (ca. 10 mm). The frequency occurrence of various prey from March to May as determined by analysis of M. macrodactylus feces were: Diptera 45 %, Trichoptera 18 %, Coleoptera 9 %, Plecoptera 9 %, Ephemeroptera 9 %, Lepidoptera 5% and Araneae 5%. In July these frequencies changed to: Diptera 36%, Trichoptera 16%, Coleoptera 16%, Lepidoptera 24% and Araneae 8 % (Fig. 4). The prey of M. fuliginosus in July, as measured by fecal analysis, included Diptera 23 %, Lepidoptera 44 %, Coleoptera 7 %, Trichoptera 14 %, Ephemero- ptera 7 % and Plecoptera 5 % (Fig. 4), ranging in size from 5 to 25 mm in body length (Table 1). For example, the Tipulidae (Diptera) that were eaten measured, ca.10 mm and A. geniculata (Coleoptera) ca. 12 mm. — 100 oS =v ~ o 80 [] Diptera 2 [1] Lepidoptera a 60 Coleoptera hes a es 4 | EF] Trichoptera ®o 40 LE oe IEEE | 2 YL , sun Ephemeroptera © a tee “ ee f pa é ‘—4 Plecoptera A HM Araneae Oo Oo oO M. n. M. m. M. f. Fic: Rts Thc Bat species Fig. 4. Occurrence frequency of foods (order level of insects) in the feces of M. natterent (M. n.), M. macrodactylus (M. m.), M. fuliginosus (M. f.), R. cornutus (R. c.) and R. ferrumequinum (R. f) in July of 1994. Funakoshi and Takeda, Food habits of insectivorous bats O09 A BC D E @ Coleoptera 4 Lepidoptera @ Diptera + Trichoptera Body length of insect prey (mm) 4 8 12 16 20 24 28 Body weight of bats (g) Fig.5. Correlation of mean body weight of bats and mean body length of insect prey. A: R. cornutus, B: M. nattereri,C: M. macrodactylus, D: M. fuliginosus, E: R. ferrumequinum. The diet of R. cornutus in July included Diptera 34 %, Lepidoptera 57 %, Coleoptera 6 % and Araneae 3 % (Fig. 4), ranging in size from 7 to 23 mm in body length (Table 1). In addition to these orders, Trichoptera was found in their feces in June. Typical examples were Tipulidae (Diptera) measuring 8- 23 mm, and M. castanea, A. geniculata and H. grammicus (Coleoptera), measur- ing 9-15 mm. A significant positive relationship was found between the mean body weight of the bats and the body length of their insect prey (Pearson’s correla- tion coefficient : ~=0.63, p<0.01, see Fig. 5). 3. Insect abundance Total insect numbers (collected at the night) reached a peak during July, whereas dry weights were heaviest during June (see Figs.6 and 7). In every month Diptera constituted a major portion of these samples (Fig. 6), but the ratio of the dry weight of Diptera to that of all insects trapped from April to September was less than 25 % (Fig.7). Trichoptera (4-25 %) and Ephemero- ptera (1-21 %) were the next most abundant groups from April to November (Fig. 6), although the ratios of their dry weight to those of all insects was less than 16 % for the Trichoptera, and less than 10 % for the Ephemeroptera (Fig. 7). Lepidoptera and Coleoptera were often collected, but constituted only a small percentage of the total fauna (Fig. 6), yet the two orders contributed a 56 Mammal Study 23: 1998 676 2045 1794 2286 632 5— 1352 26 136 O Diptera = Lepidoptera Coleoptera Trichoptera Ephemeroptera Hemiptera EI i) [4 | Hymenoptera Sy Plecoptera Percent by number Neuroptera Blattaria May June July Aug Sept Oct Nov Month Fig.6. Seasonal changes in percent number of insects of various orders collected by insect suction traps near Katano-do Cave in 1994. Monthly sample sizes are indicated above histograms. 100 [] Diptera = | | I] Lepidoptera 4 80 | —Yy Coleoptera > | Yy Trichoptera = 60 | Y Ephemeroptera > | Y FA Hemiptera < 0 | Yj BA Hymenoptera SW) UY Plecoptera ~~ 20 eZee os PT) | - ae i Ea Neuroptera ~ ISSA ey Be ; HM Blattaria Apr May June July Aug Sept Oct Nov Month Fig. 7. Seasonal changes in percent dry weight of insects of various orders collected by insect suction traps near Katano-do Cave in 1994. Monthly total dry weights (g) are indicat- ed above histograms. Funakoshi and Takeda, Food habits of insectivorous bats oil M. n. M. m. M. f. > B-.-@--20 Feale > Fae Percent by number in feces 0 10 2030 A050 60 0 Percent by number in trap Fig. 8. Percent representation of each of five groups of insects in the feces of bats and in insect suction traps. A: Lepidoptera, B: Coleoptera, C: Trichoptera, D: Ephemeroptera, E: Diptera; M. n.: M. natteren, M.m.: M. macrodactylus, M. f.: M. fuliginosus, R.f.: R. ferrumequinum, R. c.: R. cornutus. high proportion of the dry weight. The ratio of the dry weight of Lepidoptera to that of all insects varied from 2 to 61% from April to October, being particularly high (37-61 %) during April, May and October (Fig. 7). The ratio of dry weight of Coleoptera to that of all insects fluctuated even more widely between 4 and 73 % from April to September, being particularly high (60-73 %) from June to September (Fig. 7). When the rates of occurrence in bat feces of the five main insect groups were compared with the same groups occurring in traps during July, no correla- tion was found between the two values (Pearson’s correlation coefficient: = 0.30, p>0.1, see Fig. 8). The percentages of Diptera in the feces of both M. natterert and R. ferrumequinum were significantly lower than those in the trap samples (Tables 2 and 3), whereas the percentages of Lepidoptera or Coleoptera in the feces were significantly larger. In addition, spiders including Araneidae, Tetragnathidae and Theridiidae were frequently found along the edges of woodlands or brooks during May and June, however quantitative samples were not collected. DISCUSSION 1. Prey selection M. natterert was found to feed mainly on Lepidoptera, Coleoptera, Diptera 58 Mammal Study 23: 1998 Table 2. Proportions of five insect groups in insect suction traps and in the feces of M. nattereri for eight nights. Probability (p) refers to Wilcoxon signed-ranks tests applied to establish whether each insect group was consistently commoner or rarer in the trap samples than in the fecal ones. % trapped % in feces Orde: Mean+ SD Mean+ SD P Diptera 65) 4s 1987 S7e late ORS <0.01 Lepidoptera S5OLe Day) 30), 4ac lala <0.01 Coleoptera adlanns oe) De. Mae IL a qeyeequons Ee par ead NE gr" poo i = Iusy yy Ja1aqunyny / y ar a oSV miqeH z SS sitios Oo <3 z leq[V-IqoH xs ueYyyAeZq —* fmm oom, ‘N oée atk B" 3 Oe] JON san Poot wi cS) = a oOS | 424, | Sn. \ f ieese ysoy | eABYSUIANT VISsnd oS Cl oS II oS Ol 096 098 67 Jiang et al., Status and conservation of Mongolian gazelle o9 Cl 9s ar) ae a a W009 = Sar ! ' 4 ‘ ' i] ‘ i \ § ‘ ‘ ’ ‘ t] ' é ‘BI[OSUOJ] PUL CUIYD UI aI[9zZeS UeI[OSUOJ] JO UOTINCI1}SIpP oy} JO SasueYD [BOIOJsIy OY 7 “BI OSP o9 Cl 00€ OSI oS II oS LI @eeeesveceevees > itl oS OI oS Ol Juasaid pUe S,OR6T JOY TMNT S:0L61 Lissette SOG. Finieiii: S,006T ALIOg -------eennenne SQOLT cccerccrsecseeeees UOLNIIIIP ISCHULIYS eam em dem Gem Gem Gem 06 098 oOP oo F o0S 68 Mammal Study 23: 1998 far as the Yellow River (JlyxauwKxun 1927). As agriculture has spread and developed, however, the gazelle’s distribution has continuously shrunk. In the early decades of the 20th century, its range was still extensive (Figs. 1 and 2): it occurred in Inner Mongolia across the Great Xingan Ranges, southward to the Nenjiang River and to the Songhuajiang River area of Heilongjiang Province, and to Baicheng in Jilin Province. The easternmost point of its range was reached in the middle of the watershed of the Liaohe River. At present, its southeastern limit is to be found in the leagues of Hulunbeier, Xilinguole and Wulanchabu at the border between China and Mongolia (Zhang et al. 1995). It is extinct now in Heilongjiang Province. 2. Mongolia Most Mongolian gazelles are now to be found only in Mongolia. As recently as the 1950s, Mongolian gazelles were distributed widely across about two thirds amounting to about 780,000 km? of the country, though they were not to be found in northern forested areas or in southern desert areas, and the population still numbered about a million individuals (Bannikov 1954). During the 1950s, the northern limits of their range were reached in the Ubsa Nor lake basin (50°N, 91°E, Tentuep et al. 1961), however, during the second half of the 20th century, the range of the species in Mongolia has been shrinking. A survey conducted during the decade from 1975 to 1985 revealed that its distribu- tion had decreased dramatically to just one quarter or one fifth (about 170,000 km’) of its range during the 1950s. Over the same period, the population decreased by half to about 500,000 animals. The remaining population was confined to areas such as: Khentii, Dornod, Suchbaatar and East Gobi in eastern Mongolia (Lushchekina et al. 1983, 1985, 1986, and Lhagvasuren and Milner-Gulland 1997). Small scattered populations remain in other parts of western Mongolia (Fig. 2, Lhagvasuren and Milner Gulland 1997). The most recent information (IUCN 1993) shows that most gazelles are now confined to an even smaller area (10% in size) in the eastern part of Mongolia and that the population amounts to only about 300,000 animals, of which about 60% are migratory and the rest sedentary. 3. Russia Until the 1970s, Mongolian gazelles still occurred in small numbers in the southeastern Altai Mountains, southern Tuvinskaya and east Zabaykal of Russia (Figs. 1 and 2), though previously they had been common in some areas. In the 19th century, several thousand Mongolian gazelles were to be found in east Zabaykal during winter (Yepxacop 1867). During the winters of 1925- 1926 and 1944-1945, several thousand Mongolian gazelles lived in east Zabay- kal, while the number was fewer in west Zabaykal. During the winter of 1947- 1948 only groups of fewer than 100 animals were found (Jleontbes 1949). In the grasslands of the southeastern Altai Mountains, hundreds of Mongolian gazelles were often found and large groups sometimes immigrated from Mongolia, but by the end of the 1950s the gazelles had become rare there Jiang et al., Status and conservation of Mongolian gazelle 69 ((entHep et al. 1961). In 1935 there were still several hundred gazelles in Tuvinskaya, but by the winter of 1940 only a few individuals remained, and thereafter no gazelles have been seen there (Guyuiesuy u Baaropeusenckui 1952). At Kosh-Agach and in the border area between Russia and Mongolia (Fig.1), only 5-6 gazelles were found in the 1956-57 winter (Centuep et a/. 1961). In west Zabaykal there were not many Mongolian gazelles and some of them migrated from Mongolia during winter. Their last visit was in the winter of 1947-1948, when they numbered fewer than 100 animals (Jleoutbes 1949). In east Zabaykal the population was relatively stable until the 1940s, but during the 1950s the gazelles decreased and by the end of the 1950s only a few small groups were to be found in the border area of China, Mongolia and Russia (Tentuep et al. 1961). Sludskii and Shubin (1963), who conducted aerial censuses of the Kazakh- stan Desert area in the winter of 1960, reported 9,300 gazelles, about 60% of which were in the northern part of the Kyzyl-Kum Sands (at about 60-70°E), though was, however, contrary to lentuep et al. (1961) who defined the distribu- tion of Mongolian gazelles in Russia as limited to areas east of about 85°E. Whatever the original limits of their distribution were, since the 1970s no gazelles have been seen in Russia, and it is believed that they are now extinct. HABITAT Information on the Mongolian gazelle’s habitat in Mongolia and Russia is limited, and therefore information on the characteristics of their habitat is based on observations in China. Their main preference seems to be for flat or undulating steppes or dry grasslands. 1. Topography The Great Xingan Range extends from northeast to southwest in the central Hulunbeier League (Fig. 1). To the west of the range is the rolling Hulunbeier Plateau which lies above 600m. The highest point reached at 1,038 m is Bain Mountain, while the lowest place, the 2,200 km? Dalai Lake, is at 540m. The areas around the Dalai and Beier Lakes, and along the Wuersun River are lowlands where rich water systems such as the Erguna River and Dalai Lake develop (Pan ef al 1992). 2. Climate Because the Great Xingan Range blocks the movement of moist oceanic winds, the climate here is semi-arid. The average annual temperature is as low as -3 to 0°C, while the lowest temperature reached is -40°C, and the highest 35-40°C. Continuous snow-cover lasts from 120 to 180 days each winter, and the frostless summer period is of 80-120 days. The annual rainfall is of only 250-380 mm, of which 70% falls in summer, while annual evaporation amounts to 1,300-1,900 mm (Pan et al. 1992). The main natural calamities that the gazelle’s face in this region are snow, snowstorms and frostbite. 70 Mammal Study 23: 1998 3. Vegetation The vegetation which comprises typical gazelle habitat consists of cool temperate tall grassland (Hu ef al. 1992). Five types of such grasslands are recognized according to their species composition: 1) Stipa grandis/Aneuro- lepidium chinense type, 2) Stipa grandis/Cleistogenes squarrosa type, 3) Cleis- togenes squarrosa/Lespedeza spp. type, 4) Artemisia frigida type and 5) Aneuro- lepidium chinense/ Stipa grandis/Herbs type (Hu et al. 1992). 4. Other Animals About 200 species of birds and more than 20 species of mammals have been recorded in the area (Office of Local Chronicles in Hulunbeier 1986). Other mammals that are common in the area include bobak marmot, Marmota bobak, cape hare, Lepus capensis, steppe polecat, Mustela eversmanni, red fox, Vulpes vulpes, Corsac fox, V. corsac, the wolf, Canis lupus, and many species of mice. FooD HABITS The Mongolian gazelle eats a wide range of plant species, however the bulk of its diet consists of a very limited number of species. Bannikov (1954) identified just 21 plant species in the stomach contents of 22 gazelles from Mongolia. These included: Stipa capillata, S. gobica, Allium polyrrhyzum, Agropyrum pseudoagropyrum, Kochia prostrata and Koeleria gracilis. Interest- ingly, the gazelles avoid Diplachne spp. even though these are relatively abun- dant. Of the 21 plant species recorded, Stipa spp. accounted for 60% of the stomach contents collected in January. Bannikov (1954) found clear seasonal variation in diet with Gramineae, Avtemisia, Caragana, Allium and Leguminosae in stomach contents sampled in spring, while in August about 80% of the stomach contents consisted of onions, Allium spp. (Lhagvasuren and Milner-Gulland 1997). Fecal analyses of Mongolian gazelles in the Hulunbeier grasslands of Inner Mongolia, China during 1993-94 have revealed 38 plant genera in the diet with Stipa spp., Aneurolepidium chinense, Caragana microphylla and various Liliaceae and Compositae being of particular importance (Jin 1994, Gao ef al. 1995). In winter, the three main components of the diet were found to be Stipa spp. (38.6%), A. chinense (21.8%) and C. microphylla (7.5%). In winter, the diet of the Mongolian gazelle is very similar to that of domestic sheep, the diet of which consists of Stipa spp. (30.1%), A. chinense (28.4%) and C. microphylla (6.7%) (Gao et al. 1995). GENERAL HABITS AND ACTIVITY 1. Adaptation to Grasslands Like other grassland dwellers such as the saiga, the Tibetan antelope, Pantholops hodgsoni, and the North American pronghorn antelope, Antzlocapra americana, Mongolian gazelles can run very fast. They can reach speeds of Jiang et al., Status and conservation of Mongolian gazelle 71 60-65 km/hr, jump height up to two meters and lengths of 4-6m with a maximum of 13 m (JlyxauKun 1927). Mongolian gazelles find it difficult to run on ice or move in snow that is deeper than 20 cm (Bannikov 1954). Mongolian gazelles have keen eyesight but relatively poor senses of smell and hearing. In order to obtain sufficient food, Mongolian gazelles must graze all day long during autumn and winter, whereas during summer they graze only from dawn to 10: 00 or 11: 00, and then again from 19: 00 or 20: 00 to dusk (Tentuep et al. 1961). During summer, because sufficient water for their needs is contained in their green fodder, Mongolian gazelles are able to forage tens or even hundreds of kilometers away from open sources of freshwater. 2. Group Formation Mongolian gazelles usually live in groups all year round, but in larger groups in winter than in summer. Group size increases from September to April in Russia (Tentuep ef a/. 1961). During summer, the largest groups consist of fewer than 100 individuals, and usually groups number about 20-30 individ- uals. From late August or early September onwards, group size increases to 60-80, or even to several hundreds in some cases. During the rutting period from late November to early January, group size further increases to reach 100- 120 individuals. If snow falls, groups increase in size to several thousands or even 10,000 animals. These large groups begin to break apart during May and June (Bannikov 1954). During spring and autumn migrations, they form large groups, some as large as 80,000 animals (Lhagvasuren and Milner-Gulland 1997). In Inner Mongolia, mixed groups were most common during spring (63.1%), autumn (51.0%) and winter (56.2%), however in summer female groups were most common (60.7%), and solitary individuals were common in male groups (Guan 1996). Before the rutting season from September to November, the male/female ratio is about 1.3, and males often form bachelor groups. These groups join to form larger groups during late November, then separate again from the beginning of the rutting season (Zhao 1963). 3. Society and Behavior The social system of the Mongolian gazelle is not yet well understood, however it is known that they are polygynous with one male gathering on average 13 females into his harem (range 6-25, Lhagvasuren and Milner- Gulland 1997). In Russia, rutting begins in late November and continues until early January (lentuep ef al. 1961), whereas in Mongolia it begins during mid-November and continues until early February with the peak between mid-December and mid-January (Lhagvasuren and Milner-Gulland 1997). During the rutting season, males battle with each other though the fighting is not serious (Tentuep e¢ al. 1961). Pregnant females close to parturition in spring move to open rolling countryside where it is easy for them to avoid disturbance (Bannikov 1954). 72 Mammal Study 23: 1998 4, Migration Mongolian gazelles migrate during winter. In the northern part of their range, this migration is from south to north, whereas in the southern part of their range it is from north to south or east (Bannikov 1954). Part of the southern population migrates from Mongolia to Inner Mongolia, and before the 1970s some migrated from Mongolia into Russia. Since the 1970s, however, and since the population has been so reduced, migration into Russia has not been reported. These migrations may have occurred because of reduced food availability in the center of the range. During summer, gazelles travel widely over ranges of several hundred square kilometers, often moving more than 10 km in a day with distances increasing as forage deteriorates. During the parturition period, however, females stay in restricted areas (Tentuep et al. 1961). Gazelles do not migrate when food is abundant or when there is little snow, which indicates that their migrations may be adaptive to avoid food shortages and heavy snow (Bannikov 1954). POPULATION ECOLOGY During the 1940s, the population of Mongolian gazelles is estimated to have reached approximately 1.5 million, with one million in Mongolia and 500,000 in China. During the 1950s and 1960s in China, 200,000 gazelles were hunted each year (Xiao et al. 1982), and as a result of this over-hunting, combined with over-grazing and desertification, the population has decreased considerably during the last 40 years. 1. Age Estimation On the basis of tooth eruption and wear, Zhao (1982) categorized Mongolian gazelles into seven age groups. Jiang ef al. (1995) have determined the exact age of 224 gazelles by counting growth layers in teeth cementum and have shown that the accuracy of Zhao’s (1982) method is 72.3%. Of the remainder of the samples, 69.4% were over- or under-estimated but within just one year. Therefore, for practical purposes in the field, Zhao’s (1982) categories are useful. 2. Demography a. Natality Females become fertile at about 17-18 months of age (Ientuep ef al. 1961). The gestation period is about six months, and parturition occurs during May and June in Russia (Tentuep et a/. 1961), and from mid-June to mid-July in Mongolia (Lhagvasuren and Milner-Gulland 1997). The pregnancy rate of Inner Mongolian females older than 1.5 years is as high as 100% (m=122, Jiang et al. 1993), and over 90% in Russia (Bannikov 1954), although in two popula- tions in Mongolia, it has sometimes been lower at 40% and 60-85% (Lhagvasur- en and Milner-Gulland 1997). Fawns are usually born singly with twins only Jiang et al., Status and conservation of Mongolian gazelle 133 occurring rarely (2.5-8.2%) in both Mongolia and in Russia (Bannikov 1954, Lhagvasuren and Milner-Gulland 1997). The survival rate of fawns in their first summer reaches 80%. Because of the high rate of pregnancy and of fawn survival, the rate of increase of the population sometimes reaches 20-25% (Bannikov 1954). Zhao (1988) estimated that the annual rate of increase in Inner Mongolia was also considerable at about 27%. b. Mortality Predation, periodic epidemics and severe winters are the main causes of death of the Mongolian gazelle. The main predators are wolves, domestic dogs and steppe eagles, with manul, Felis manul, and red fox also able to catch newborn fawns. Wolves attack the gazelles during late winter and spring, particularly after rutting when males are exhausted and unable to run for long. In early summer, wolves attack pregnant females. According to Tentuep ef al. (1961), birds such as kites and vultures sometimes attack young fawns. Information on diseases contracted by Mongolian gazelles is limited, however, that diseases do seriously affect them is well documented. In 1974, for example, about 140,000 animals were killed in eastern Mongolia by an unknown disease, and since then similar outbreaks have occurred regularly, though fewer gazelles have died (Lhagvasuren and Milner-Gulland 1997). Captive Mongolian gazelles are known to suffer from “foot-and-mouth disease” (O.upKop and Hocospa 1940, Llperaepa 1941) and FPasteurvellosis (Yuan 1991). Rotshil’d et al. (1988) showed that the high level of molybdenum in their onion diet can be a cause of Pasteurella infections. Various parasites of the Mongolian gazelle have been found including : Przevalskiana aenigmatica, Pharyngomyia dzerenae, Melophagus spp. (Hippobos- cidae), Cysticercus tenuicollis, C. bovis, Eimeria spp. (Coccidia) and warble flies (Hypodermatidae and Oestridae) (Kosocos 1939, Mayyapcxuit 1941, Cpyaun 1950, Sugar 1981/1982, Minar et al. 1985). In Mongolia, severe winters, occurring about once every seven years since 1932, have killed thousands of gazelles (Lhagvasuren and Milner-Gulland 1997), and heavy snows and food shortages were recognized by Bannikov (1954) as sometimes causing losses of one third or half of Mongolian gazelle populations. c. Sex Ratio In Inner Mongolia, the sex ratio varies from year to year, but is slightly biased towards males (M/F=1.1 in 1979, Xiao et al. 1982, and 1.3 in 1988, Jiang et al. 1993), whereas in Russia, Bannikov (1954) found it to be slightly biased to females (M/F=0.92). Subsequently, Lhagvasuren and Milner-Gulland (1997) have found ratios in Mongolia strongly biased to females (M/F=0.1-0.14 in autumn, 0.08 in winter, and 0.05 in summer). d. Life Table Jiang et al. (1993) estimated the age structure of the Inner Mongolian 74 Mammal Study 23: 1998 gazelle population as consisting of fawns (0.5 year old, 39.7%), reproductive females (over 1.5 years old, 25.0%), and older animals (more than 4.5 years old, 12.7%). Three mortality peaks were noted among 0.5 year olds (39.7%), 3.5 year olds (57.4%) and among those over 6.5 years old (100%). This population was considered to be increasing because of the high proportion of young gazelles, the high rate of fecundity and the low mortality rate. The oldest known-age individuals in an Inner Mongolian population of 1,026 animals were 7.5 year old males and 9.5 year old females (Jiang et al. 1995), making them much younger than other related ungulates. For example, mountain goat, Oveamnos americanus, males reach 14 years of age and females 18 years (Cowan and McCrory 1970), chamois, Rupricapra rupricapra, have survived to about 22 years of age (Walker 1975) and male Japanese serow, Capricornis crispus, reach 20 years while females may live as long as 24 years (Miura and Tokida 1988). Jiang (1990) considered that Mongolian gazelles live short lives partly because of quick teeth wearing. The net reproductive rate (R,) of a population in Inner Mongolia was 1.134 in 1979 and 0.864 in 1988, while the finite rate of increase (£) was 1.043 in 1979 and 0.954 in 1988 (Jiang et al. 1993). The abrupt decrease in both Ro and E between these years may have resulted from habitat deterioration such as desertification, overgrazing by livestock, and particularly from over-hunting and poaching. As a result of over-hunting and poaching, gazelles have been exposed to shooting for longer periods. Poachers shoot more rutting males just after the rut, and more pregnant and lactating females after the legal hunting period because they are easier to shoot. As a consequence, the proportion of repro- ductive females in the total population dropped from 32.5% in 1979 to just 25.0% in 1988 (Jiang et al. 1993). The reduction of pregnant and lactating females would result in a decrease in fecundity, and the reduction of reproductive males would result in unhealthy sex ratios. CONSERVATION AND MANAGEMENT Mongolian gazelles seem to be the Asian ecological equivalent of the pronghorn which is a member of the grassland ecosystem of North America. Both gazelles and pronghorns are highly adapted to northern dry grassland ecosystems, however, they differ because the grasslands where Mongolian gazelles live are unique, in as much as they are not truly natural but have been utilized by humans as grazing lands for thousands of years. In the past, people maintained this ecosystem based on an understanding of suitable grazing levels from experience, and hence they avoided deterioration of the grasslands. In other words, these grasslands are the historical product of a system of “sus- tainable use”. The Mongolian gazelle has long been a representative member of this managed grassland ecosystem. The most significant natural mortality factors of the gazelles seem to be predation, periodic epidemics and severe weather, however, the factor causing Jiang et al., Status and conservation of Mongolian gazelle is Mongolian gazelles to be endangered is human activity. These activities include over-hunting, poaching and deterioration of their grassland habitat resulting from the over-extension of cultivated lands and by over-grazing. The impact of poaching is extremely biased towards males because of their large body size and their horns making them particularly valuable. This leads to a strongly biased sex ratio and, as a consequence, reduces the fecundity of females. Lhagvasuren and Milner-Gulland (1997) have calculated that Mon- golian poachers kill 80,000 animals each year, at least 80-85% of which are males. Poaching just after rutting and during the birth period reduces num- bers of reproductive males and females. Over-hunting is also responsible for the decline of populations. The heavy harvest (100,000 each year) for meat for soldiers during the Second World War, and during severe winters after the war, probably resulted in the rapid decline of populations during the 1950s and 1960s (Sokolov et al. 1982). Deterioration of grasslands results in the disappearance of suitable habitats which reduce the carrying capacity of the environment. One major factor contributing to the decline of the population in western Mongolia is thought to be the construction of the Ulaanbaatar-Beijing railway at the end of the 1950s. This obstructed the gazelles’ east-west migration routes (Lhagvasuren and Milner-Gulland 1997). In Inner Mongolia the extent of the grasslands has been declining. Compared to 1965, the grassland area has decreased by 62,000 km’, degraded grasslands have increased by 287,000 km’, and total grass production has dropped by 30% (National Research Council 1992). Asa result, the Mongolian gazelle is facing a dangerous situation. It was estimated that the Mongolian gazelle population before the 1940s was about 1,000,000 in Mongolia and 500,000 in China (Tenruep et al. 1961), but today just 300,000-500,000 remain in total. Taking this situation into consideration, the Chinese government listed the Mongolian gazelle under its 1989 wildlife protection law as a Class II species for conservation. Under this law, nature reserves are to be established in the species’ main distribution areas, and inspection of the condition of the habitat is to be made regularly. Construction projects that will degrade the habitat and trading of the gazelles and their parts are to be controlled. Hunting is prohibited and poaching may be prosecuted under criminal law. In the Russian Federation’s “Red Data Book”, the Mongolian gazelle was listed as a “disappearing species”. In Mongolia, hunting has been controlled since 1932, and in 1995 a new hunting law was introduced in order to control poaching (Lhagvasuren and Milner-Gulland 1997). Establishment of hunting controls based on population ecology is neces- sary. Zhao (1988), who has taken into consideration the current system of hunting in China together with the ecology of the Mongolian gazelle, has recommended that the open season for hunting gazelles should be limited to the period from early November to the middle of December because body weight is greatest and the meat quality is at its best during this period. On the basis that the Mongolian gazelle’s capacity for increase is high at about 25%, Zhao (1988) also recommended that hunting intensity should be limited to 19% of the total 76 Mammal Study 23: 1998 population. Because of its high reproductive capability, the Mongolian gazelle population would then be able to recover quite quickly despite continued hunting, once hunting and poaching are controlled. Besides control of legal hunting, a reduction of poaching is also vitally important. Both the Chinese and the Mongolian governments are trying to control poaching, but this is extremely difficult to carry it out in vast, remote steppe areas. Consequently, nature conservation education is seen as crucially important in such areas. Because of the rapid shrinkage of distribution and the reduction of popula- tion size, it is urgently necessary to establish reserves. A steppe plain in the Matad-Somon area of Mongolia (Fig. 1) is recommended as a reserve (Sokolov et al. 1982, Lushchekina e¢ al. 1985, 1986). The first national park of Mongolia, the Eastern Steppe National Park, was established in 1995 to conserve the Mongolian gazelle. More reserves are needed in China. The reintroductions have been done in 1978 and 1988-1990 in Mongolia and small populations survived in Dzavkhan, Gobi-Altai and Uverkhangai maybe because of the reintroductions. Trials of captive breeding in the reserves and transplantation should be considered. Studies on epidemics, migration routes, genetic struc- ture etc. are also needed. Since Mongolian gazelles migrate between Mongolia and China, consistent plans for management, conservation and cooperative activities between the countries are necessary. Grassland productivity should be improved based on both agricultural and ecological sciences. The tradi- tional grazing system of Mongolian people should be also reconsidered. Acknowledgments : We appreciate Mr. Xie Xuchang for translation of Russian literature and Mr. Guan Dongming for the permission of use unpublished data. REFERENCES (Russian references are listed below) Allen, G. M. 1940. The Mammals of China and Mongolia. Amer. Mus. Nat. Hist., New York. Bannikov, A.G. 1954. The Mammals of the Mongolian People’s Republic. Publishing Company of the Academy of Sciences of USSR, Moscow. Issue 53 (in Russian). Corbet, G.B. 1978. The Mammals of the Palaearctic Region: a Taxonomic Review. British Museum (Natural History). Cornell University Press. London and Ithaca. 314 pp. Cowan, I. M. and W. McCrory. 1970. Variation in the Oreamnos americanus (Blainville). J. Mam- jnoeily Ibs C0 Wor Ellerman, J. R. and T.C.S. Morrison-Scott. 1951. Checklist of Palaearctic and Indian Mammals 1758 to 1946. London (cited in Corbet 1978). Ellerman, J. R. and T.C.S. Morrison-Scott. 1966. Jbid 2nd ed. London (cited in Corbet 1978). Gao Zhongxin, Jin Kun, Ma Jianzhang and Chen Huahao. 1995. Winter food habits of Mongolian gazelle in Hulunbeier grassland. Acta Theriologica Sinica. 15: 203—208 (in Chinese with English summary). Guan Dongming. 1996. The study on the grouping behaviour of Mongolian gazelle. Master thesis of Northeast Forestry University. 53 p. (in Chinese with English summary). Hu Shingtsung, D. B. Hannaway and H. W. Youngberg. 1992. Forage Resources of China. Center for Agricultural Publishing and Documentation (Pudoc), Wageningen, Netherlands. 327 p. IUCN-The World Conservation Union. 1993. Species. Newsletter of the Species Survival Commis- sion. June. No. 20: 41—42. Jiang et al., Status and conservation of Mongolian gazelle he Jiang Zhaowen. 1990. A study on population structure and dynamic trend of Mongolian gazelle. Master thesis of Northeast Forestry University. 50 p. (in Chinese with English summary). Jiang Zhaowen, Xu Li and Zheng Hong. 1991. The comparative analyses on age identification indexes of Mongolian gazelle. Chinese Wildlife. 3: 25—28. (in Chinese). Jiang Zhaowen, Ma Yiging and Gao Zhongxin. 1993. A study on population structure and dynamic trend of Mongolian gazelle in China. Acta Theriologica Sinica. 13:16—20. (in Chinese with English summary). Jiang Zhaowen, Ma Yiqing, Gao Zhongxin, Wang Jun and Li Guangfu. 1995. A comparative study on two age identification techniques of Mongolian gazelle. Studies on Mammal Biology in China. 124—130. (in Chinese with English summary). Jin Kun. 1994. The study on food-habits of Mongolian gazelle in Hulunbeier grassland. Master thesis in Northeast Forestry University. 56 p. (in Chinese with English summary). Lhagvasuren, B. and E. J. Milner-Gulland. 1997. The status and management of the Mongolian gazelle, Procapra gutturosa, population. Oryx. 31:127—134. Lushchekina, A., V. Neronov, G. Ogureeva and A. Sokolova. 1985. Distribution, ecology and protec- tion of Procapra gutturosa. Arch. Naturschutz Landschaftsforsch. 25 : 57—69 (English abstract was cited). Lushchekina, A., V. Neronov and A. Shurkhal. 1983. The territorial structure, intraspecific varia- tion and questions of the rational use of the stock of Mongolian gazelles. In Applied Aspects in the Programme on Man and the Biosphere. Moscow, USSR (in Russian). Lushchekina, A., V. Neronov, G. Ogureeva and A. Sokolova. 1986. Distribution, ecology, protection and efficient use of the Mongolian gazelle in Mongolia. Byull Mosk O-Va Ispyt Prir Otd Biol.. 91: 73—82 (in Russian with English abstract). Minar, J., V.S.Lobachev, M. Kiefer and D.Bazardorzh. 1985. New findings of warble flies (Hypodermatidae, Oestridae) of wild animals in Mongolia. Folia Parasitol (Prague). 32 : 89— 91. Miura, S. and K. Tokida. 1988. Demographic parameters of Japanese serow population in Japan. pp. 111-118. lm (Y.Ono ed.) The Basic Study on Ecology and Conservation of Japanese Serow. National Research Council. 1992. Grasslands and Grassland Sciences in Northern China. National Academy Press. Washington, D.C. 214 p. Office of Local Chronicles in Hulunbeier. 1986. The Circumstances of Hulunbeier League. Inner Mongolia People Press (in Chinese). Pan Xueqing, Feng Guojun, Erdun and Feng Futang (eds). 1992. Hulunbeier Grassland in China. Jilin Sciences and Technology Press. 424 p (in Chinese with English summary). Rotshil’d, E. V., A. K.Evdokimova and Z. Amgalan. 1988. Abnormalities of the trace element composition on plants as a factor in the loss of the Mongolian gazelle in Mongolia. Byull Mosk O-Va Ispyt Prir Otd Biol. 93 : 35—42. Sludskii, A. A. and I. G. Shubin. 1963. Aerial visual counting of saigas, dzeren, Procapra gutturosa and their numbers in the Kazakhstan deserts. Akad. Nauk USSR: Moscow. 84-91. Sokolov, V., Ya. Dash, A. Lushchekina and V. Neronov. 1982. Current distribution and numbers of Mongolian gazelles in Mongolia. Jn Zoological Research in Mongolia. Nauka, Moscow (in Russian). Soma, H., H. Kada, K. Matayoshi, T. Kiyokawa, T. Ito, M. Miyashita and K. Nagase. 1980. Some chromosomal aspects of Naemorhedus goral and Procapra gutturosa. Proc. Jpn. Acad. Ser. B, Phys: Biol. Sci. 565273277. Soma, H., T. Kiyokawa, K. Matayoshi, I. Tarumoto, M. Miyashita and K. Nagase. 1979. The chro- mosomes of Procapra gutturosa, a rare species of antelopes. Proc. Jpn. Acad. Ser. B, Phys. BOL Sol, Say3 GOs Sugar, L. 1981/1982. Eimeria cagandzeeri, new species and Eimeria sp. (Coccidia) from the Mon- golian gazelle in Mongolia. Parasitol. Hung. 14:57—59. Walker, E. P. 1975. Mammals of the World. 3rd ed. by J. L. Paradiso. The Johns Hopkins University Press, Baltimore and London. 1500 p. Xiao Qianzhu, Gao Zhongxin and Wang Xuequan. 1982. The Study on population age structure and sex ratio of Mongolian gazelle in Hulunbeier grasslands. J. Northeast Forestry Coll. 6 :69— 78 Mammal Study 23: 1998 74 (in Chinese with English summary). Yuan Yuhai. 1991. The investigation on Pasteurellosis of Mongolian gazelle in Hulunbeier. Sci. Tech. Chinese Vet. 21:14—15 (in Chinese with English summary). Zhang Zixue, Sun Jingping, Bai Shaoli and Wang Zhongen. 1995. The distribution change and resource sustainable use of Mongolian gazelle. Biodiversity 3: 95—98. Zhao Kentang. 1963. The biology and hunting method of Mongolian gazelle. Bull. of Biology. 1: 19—20 (in Chinese). Zhao Kentang. 1982. The age identification of Mongolian gazelle. Chinese Wildlife. 2:40—44 (in Chinese). Zhao Kentang. 1988. The reasonable hunting of Mongolian gazelle. Proc. lst Conf. Int. Wildlife Protection : 328—329 (in Chinese with English summary). Tentuep, B.T., A. A. Hacumosuy uv A.T’. Bannuxos. 1961. Maexonutarouie Cosetckoro Corosa. TI ocyszapceTBeHHoe Vizgateapcetso. (Boicuaa Lko1a) 441—452. Dpynun, K. A. 1950. Oxoga asepena u3 Mouroabekoi Hapognoit Pecny6amuku. loka. AH CCCP, tr. 73, No. 4 (cited in Tentuep et al., 1961). Koaocos, A, M. 1939. S3sepu toropoctounoro Avirad MH CMexKHOH O6acTH Moxrosun. Yu. 3an. Mock. roc. ya, Boil. 20, 3001 (cited in Tentuep et al., 1961). Jleoutbes, A. H. 1949. Oxoruuunii npompicez. Tp. Ka xTHHcK. Kpaepegqueck. My3ea u KaxTuHck. oTg. Bcec. reorpad. o6pa, T. 16, Yaan-Yaa (cited in Tenru ep et al. 1961). Jlyxauikuy, A.C. 1927. MonrosbcxanctenHaa aHTwo na (Jisepen). Tp. O6sa usyy. Manbwxypex. Kpas, Soosorua, spin. 1. Xap6un (cited in Tentuep et al., 1961). Mauyapexuit, C.H. 1941. Teapmuntospi a3sepena. Tp. By pat-Monroubck 300TBer. vHTa, T. 2. Yaan-Yaa (cited in Tentuep et al., 1961). Ou.uBKos, B. M. u O. A Hocosa. 1940. Hexpo6ataie3 y MapHOKONbITHbIX W KeHrypy Mockoscxoro 300napKa. Tp. Mock. 30onapka, T. 1 (cited in Tentuep ef al., 1961). Tlasios, E.. 1949. Tpompicuiosbie 3Bepu Unrunckoli o 6lactu. Unra (cited in Tentuep et al. 1961). L[petaepa, H.11. 1941. Bo.wesun xxuBoTHbIx Mockosckoro 300napka. Tp. Mock. 30onapka, T. 2, Bbin. 2 (cited in Tentuep ef al., 1961). Uepxacos, A. 1867. S3anvckn oxorHuka Boctouxoit Cu6upu. 1-e u3a., CI16 (cited in Tenruep et al., 1961). Anywesuy, A. u MW. Baaropeuenckui. 1952. TIpompiciosbie 3Bepx HW MTHUbI SanagHol CuOupu. W3,. 2-e. Hoso-cu6upeKk (cited in Tantuep et al., 1961). (accepted 24 October 1997) Mammal Study 23: 79-82 (1998) © the Mammalogical Society of Japan Short Communication Seasonal change in the testis size of the Japanese giant flying squirrel, Petaurista leucogenys Takeo KAWAMICHI Department of Biology, Osaka City University, Sugimoto, Sumiyoshi-ku, Osaka, Japan 558-8585 Fax. +81-75-551-3936, e-mail, pika @sci.osaka-cu.ac.jp In seasonally breeding male mammals, the testes generally regress completely during the non-breeding season. This is followed by a “reawakening” of the regressive testes in a process known as recrudescence (Nalbandov 1976). For the accurate estimation of testis size throughout the year, many individuals have to be killed at different seasons (e.g., 116 male flying squirrels, Petaurista petaurista, by Lee et al. 1993), however, such study methods cannot be applied to protected animals such as the Japanese giant flying squirrel, P. leucogenys. | have adopted an alternative method which involves no harm to study animals. This involves, instead, estimating testis size during natural observations of squirrels above me in trees. Despite this being only a rough estimation, it is easy to perform, and the data obtained are useful in understanding the mating system and reproductive cycle of P. leucogenys. From my behavioral and ecological studies of P. leucogenys, I have already confirmed the existence of two mating seasons, the first from mid-November to mid-January, and the second from mid-May to mid-June (Kawamichi ef al. 1987). The two intervals between these mating seasons are in different sea- sons, winter and summer. There is no information, however, on the seasonal changes in the testis size of this species. In the genus Pefaurista, the details of seasonal change in testis weight are known only for P. petaurista in Taiwan (Lee et al. 1993). In this paper, therefore, I describe visual estimates of testis size of wild P. leucogenys, and discuss seasonal changes in testis size in relation to the species’ biannual mating seasons. MATERIALS AND METHODS The study area consists of 0.65 km? (65 ha) in a temperate mixed forest of deciduous and coniferous trees. It is situated at 34°41’N, 135°50’E, at an eleva- tion of 98-150 m, adjacent to Nara City in central Japan (see Kawamichi 1997a). Snowfalls occur occasionally in winter, but snow-cover lasts only a few days. Observations were conducted during 977 nights from 1983 to 1990. P. leucogenys were located by walking at random through the forest at night using a 9-volt searchlight. Nikon zoom binoculars (8-16, Tokyo) were used to identify all resident squirrels by the scars on their ears and by the details of 80 Mammal Study 23: 1998 their pelage. The testes of known individual males were observed, illustrated, and classified into four size categories: 1) full-size, 2) 2/3 to 3/4, 3) 1/3 to 1/2, and 4) complete regression. RESULTS A total of 667 estimates of testis size was made for 52 resident adult males. These males were observed for up to six years, and ten were observed continu- ously from before they became sexually mature. Testis condition was deter- mined bimonthly (see Fig. 1). During the two mating seasons, from mid-November to mid-January and from mid-May to mid-June (Kawamichi et al. 1987), more than 80% of adult male P. leucogenys had full-sized testes (Fig. 1). Each year testes regressed soon after the May/June mating season (Fig. 1), and by July no males had full-sized testes, and 55% already had fully regressed testes. Given that in the first half of June 81% of adult males still had full- sized testes, the speed of regression during late June was considerable, and the difference between the proportion of males with full-sized testes during the second half of June, and the first half of July was statistically significant (Fisher’s exact probability test, /=0.0007). During the first and second halves of July, testes assessed as “small” (1/3 to 3/4 size) included both those regressing and those already redeveloping. From the first half of August, however, all small testes were in the process of ui N © © O © Oo ~.© © OF 1OC) 1o =On ©. Oo gO o>) SS [> &— Js NOV_DEC JAN. FEB MAR APR MAY JUN JUL AUG SEP OCT MATING MATING Fig. 1. Bimonthly changes in the testis size (estimated visually) of wild, adult male Petaurista leucogenys. Figures on the top are sample sizes. The gradation from dark to white bars indicates testis size: full-size, 2/3 to 3/4, 1/3 to 1/2, and complete regression, in that order. Horizontal bars indicate the mating seasons. Kawamichi, Testis size of Petaurista leucogenys 81 redevelopment. The proportion of males with full-sized testes reached 80% again in the second half of October, one month before the next mating season. During the second half of February the proportion of males with full-sized testes decreased to 75%, and during the first half of March this further de- creased to 64%. The remaining males had 2/3 to 3/4 sized testes during these periods. In only one 19-month-old male, did the testes regress from March right through the May/June mating season. The complete process of testicular regression through to redevelopment was observed 34 times in 24 different males. The period from the beginning of regression to the early stage of redevelopment ranged from 42 to 57 days and averaged 47 days (42.6, SE ; n=5). There was, however, great individual variation. “The earliest case of regression was found on 4 June, while one male still had full-sized testes until 22 June. Redeveloped, full-sized testes were first observed on 8 September, although one male still had almost fully regressed testes on 14 September. Of 12 males observed on 24, 30, and 31 July, only three had testes which were beginning to redevelop, but within the first week of August, the early stages of testicular redevelopment were recognized in 10 out of the 12 males. Although there were not enough data in late June, the main period of regression was assumed to be from late June to late July, and the period of redevelopment was assumed to be from late July through October. DISCUSSION During summer, there was much variation in testis size in the male popula- tion. Some adult males still had regressive testes at the same time that others already had redeveloping testes. Yearling males born in the early spring of the previous year, begin to develop visible testes for the first time during summer (Kawamichi 1997b). Thus, only year-round observations of males from when they are still sexually immature onward will reveal the complexity of change in testis size in the male population during summer. | Lee et al. (1993) found that of 116 male P. petaurista collected in Taiwan, the weights of testes and epididymides showed the same two peaks, from March to June, and from October to November. Although these peak seasons were different from those of P. leucogenys, the presence of two active seasons, separated by an interval of a few months, is similar to that of the P. leucogenys described in this study. Lee et al. (1993) found that in P. petaurista, spermatogenesis degenerated during the periods from June to August and from December to March, that is, during the intervals separating the two active seasons. Complete regression of testes during summer has also been observed in a captive male P. leucogenys (Kawamichi per. obs.). Although anatomical analyses of testes during the period from February to March are required for confirmation, it appears that 64% of adult males had full-sized testes, and the remaining 36% had testes of 2/3 to 3/4 size in the first half of March (Fig. 1), whereas no adults had full-sized 82 Mammal Study 23: 1998 testes in July. This suggests that the small size of testes in 36% of adult males was due to the contraction of the scrotum at low temperature (mean minimum air temperatures obtained from Nara City Meteorological Station were —0.5°C in February and 1.6°C in March). Further study is required to clarify whether testicular regression really occurs in winter in all parts of the male population or not. The exact interval between matings during winter, that is, from the last mating on 29 January to the earliest one on 12 May, was 102 days. This period was 51 days shorter than the interval between the last mating on 16 June and the earliest one on 17 November (153 days) during summer (Kawamichi unpubl. data). During the summer non-mating period, the steady increase in the proportion of males with full-sized testes covered four months (Fig.1). The mean duration from the beginning of regression to the early stage of redevelop- ment, was 47 days, although there was a great deal of individual variation. These facts suggest that the interval of 102 days during winter may not be sufficient for functional testicular redevelopment in the male population. The testes regressed rapidly in June, during or soon after the May/June mating season. Therefore, if females failed to become pregnant, they could not mate again until the next mating season from mid-November onward. Testicular regression may be related to the fact that the May/June mating season is one month shorter than the November to January mating season. REFERENCES Kawamichi, T. 1997a. Seasonal changes in the diet of giant flying squirrels in relation to reproduc- tion. J. Mammal. 78 : 204—212. Kawamichi, T. 1997b. The age of sexual maturity in Japanese giant flying squirrels, Petaurista leucogenys. Mammal Study 22 : 81—87. Kawamichi, T., M. Kawamichi, and R. Kishimoto. 1987. Social organizations of solitary mammals. In: (Y.Ito, J. L. Brown, and J. Kikkawa eds.) Animal Societies: Theories and Facts. pp. 173— 188, Japan Scientific Societies Press, Tokyo. Lee, P., Y. Lin, and D. R. Proguiske. 1993. Reproductive biology of the red giant flying squirrel, Petaurista petaurista, in Taiwan. J. Mammal. 74 : 982—989. Nalbandov, A. V. 1976. Reproductive Physiology of Mammals and Birds. W.H. Freeman & Co., 334 pp., San Francisco. (accepted 2 February 1998) 83 Errata (Mammal Study, Vol. 22 [1/2]) Cover back page, line 5, Ryosuke Nakata should read Keisuke Nakata page 2, line 43, Taiveria should read Thezleria page 3, line 1, Tazveriosis should read Thezkeriosis page 3, line 4, paras-italogical should read paras-itological page 3, by the Australian government should read by the Australian-Japan Foundation, the Australian government page 3, line 9, Southerncross should read Southern Cross page 3, line 24, Mori should Mori page 4, line 10, Tzkusnema javaense n, gen. should read Tikusnema javenense n. gen page 4, line 13, Gene’s should read Gené’s. Mori should Mori page 4, line 14, 16: 63—275 should read 16: 263—275 page 4, line 22, Ohdachi, S., R. Masuda, H. Abe, J. Adachi, N. E. Dokuchaev, V. Hasegawa, H., S. Shiraishi and Rochman. 1992. Tztkusnema javaense n, gen., n.sp. (Nematoda: Acuarioidea) and other nematodes from Rattus argentiventer collected in West Java, Indonesia. J. Parasit. 78 : 800 —804. should read Ohdachi, S., R. Masuda, H. Abe, J. Adachi, N. E. Dokuchaev, V. Haukisalmi,and M. C. Yoshida. 1997. Phylogeny of Eurasian soricine shrews (Insectivora, Mammalia) inferred from the mitochondrial cyto- chrome b gene sequences. Zoological Science 14 : 527—532 page 4, line 32, Yoshinaga, Y.and Shiraishi should read Yoshinaga, Y., T. Okayama, W. Ohno and S. Shiraishi page 4, line 34, Mori should read Mori page 43, Ando, A. and S. Shiraishi. 1997. Eye lens weight for age determination in Smith’s red-backed vole, Eothenomys smithiz. Mammal Study 22: xx - xx. should read Ando, A.and S. Shiraishi: Eye lens weight for age determination in Smith’s red-backed vole, Eothenomys smithi : Mammal Study 22 45... 52 ¢ ‘¢ om ” ra a a, = ; : Es : ae = ee S- oie ‘ eet Re r . : ~* a 7 x = ie 7 q a sy a ns ¢ she ssunimets ronsnating et ‘ é ra ; iH eG f a. f x i eo ae a d ated et aon fe frp ne vexionlili al regression rai at Ss na i, —— - aa ian pha there wens ies obyheds i ae Ph shins whe: memes sony a ‘ert mont bari (silamaneNe stO¥ b ere Pree Wie ~The |b Peani2 lssigolgo: 2songupee Ss al T ? mpeoie't | bsoy bsltvorie ideigiite ‘has - > 5 Reiger 0 ay aan Blacaia 30. TAa, = enter wes a: Sr ee 2 geet PRLS AIOM beer'h . othe eal eat isin Saal & yet “NORE if istic be “aopbioybare dL ante beng Pee iglov beste C - tot Scheie): ona ( Hidlakid .2 bah qobeeks bier ge", aay haa Branston ato ¥ east bea i . “ ; is 3 t av my * 4 fe ae? S af : ris 2 hee aie ig) INSTRUCTIONS TO CONTRIBUTORS The Mammal Study (the continuation of the Journal of the Mammalogical Society of Japan) publishes original Articles and Short Communications, written in English, on all aspects of mammalogy. In principle, membership of the Society is a prerequisite for the submission of papers, but non-members may be co-authors. Manuscripts are submitted to qualified referees for critical scientific reviewing. Authors are notified, with referees’ comments, on acceptance, rejection or need for revision. The editor also customarily sends manuscripts to qualified reviewers for English editing. Manuscripts should be submitted typewritten on one side of the paper (use A4 21.0 cm X 29.7 cm paper), and double-spaced. An approximately 3 cm margin should be left on all sides. Do not hyphenate words at the right margin. Manu- scripts should be arranged in the following order: the title, name(s) of author(s) and affiliation, fax number and E-mail number if available, abstract (fewer than 200 words) and key words (five words or fewer), main text, acknowledgments, references, tables, figure legends, figures. Titles of papers must be accurate and concise, and (for abstraction services) include any relevant taxonomic name. A Japanese title and a Japanese abstract should be written on separate sheets. Text pages should be numbered through from title to references. Manuscripts should be line-numbered, every five lines, in the left margin. Short Communications do not exceed four printed pages. Abstracts and key words are omitted from Short communications. Tables and figures should be simple and self-explanatory, and their preferred locations should be indicated in the right margin of the text. The ratio of tables and figures to text pages cannot exceed 1:2 and they should be as few as possible. The author’s name and figure numbers should be written on the back of original figures and on the surface of copies. Scientific names should be underlined. All measurements should be in metric units. The following abbreviations should be used. Length : km, m, cm, mm, etc. ; edicts etce: volume: km, m°, kl, I mil etc.: weight: ke. & me, etc. ; MimeemiGminins Sec, etc,; others: cal, kcal, C, Hz, p (probability), SD) SE, etc. Arabic numerals should be used for numbers exceeding 10. References in the text should follow the forms: “Uchida and Shiraishi (1985) stated that ...” (Abe and Kawamichi 1990), and (Miura e¢ al. 1993). More than one reference within the same parentheses should be listed chronologically, alphabeti- cally if of the same year. Full references cited must be listed alphabetically by the first author according to the following examples: Abe, H., S. Shiraishi and S. Arai. 1991. A new mole from Uotsuri-jima, the Ryukyu Islands. J. Mamm. Soc. Japan 15: 47—60. Eisenberg, J. F. 1981. The Mammalian Radiations. Univ. of Chicago Press, Chicago, 610 pp. Geist, V. 1982. Adaptive behavioral strategies. In (J.W. Thomas and D.E. Toweill, eds.) Elk of North America. pp. 219—277. Stackpole, Harrisburg. Obara, Y. 1991. Karyosystematics of the mustelid carnivores of Japan. Honyurui Kagaku [Mammalian Science] 30: 197—220 (in Japanese with English abstract). Authors are recommended to refer to recent issues of the journal for details of style and layout. Manuscripts should be submitted in triplicate, with a separate sheet giving the title, author(s) name(s) and address(es) for editorial correspondence, a running head (fewer than 20 letters), the numbers of main text pages, tables and figures, and the number of copies of reprints requested. Galley proofs will be sent to the author. Reprints may be purchased in blocks of 50. — _ “omens > We. ~ ORIGINAL PAPERS aes | foo a Re Endo, pales I. Nishiumi, M. ‘ordaaes, ‘i. Nabhineee 7 © i. — i Nadees: Agungriyono and J. Yamada: ~The functional a Pat sinasticalony muscles of the Malayan pangolin, Manis J Ce ae : a ‘Sugasawa, kK and T. Mari: "Histochemical properties of the masticatory mus- ; ; “cles of FaITTGS eoeceseee OSE Ena CO cae _ Nakata, Kee Resulation of reproduction ina natural ‘popu | Pe Japanese field mouse, Apodemus SEA Pica eg = " Uraguchi, IK and he Takaneeni Den Gite eelceuion and utiliza or fox | in Hokkaido, Japan oa ABODDADOS SOUG COL ae aa iravakanye a. ‘and i. Mano : Improvement of errors in radio if tions of brown bears, Ursus arctos, in Piola al apan c Funakoshi, K and Y. Takeda: Food ite of sympatric insect i bs aa southern Kyushu, Japan ar eleevele eee. sees AROOOOOOUOG pecs an ee REVIEW ee ei iang Zhaowen, S. Takatsuki, on Zongzin and Jin Kun: ‘The r pre a — “Short COMMUNICATION Ane Poa ab ae The Mammalogical Society of Japan — ISSN 1343-4152 ion of the Journal of The Continuat | Society of Japan the Mammalogica y i © =o = ‘ ® Q ; Vol.23 | Society of Japan ogica The Mammal THE MAMMALOGICAL SOCIETY OF JAPAN OFFICERS AND COUNCIL MEMBERS FOR 1997 - 1998 President : Hisashi Abe Secretary General : Takashi Saitoh Executive Secretary : Keisuke Nakada Treasurers : Seiji Ohsumi, Toshiro Kamiya Council Members: Noriyuki Ohtaishi, Koichi Kaji, Yukibumi Kaneko, Takeo Kawamichi, Takashi Saitoh, Seiki Takatsuki, Teruo Doi, Kimitake Funakoshi, Kashio Maeda, Shingo Miura, Okimasa Murakami, Takanori Mori, Kazuo Wada The Mammalogical Society of Japan publishes original papers in two journals: the Mammal Study (the continuation of the Journal of the Mammalogical Society of Japan) for papers written in English, and Honyurui Kagaku {Mammalian Science] for those submitted in Japanese. Each jour- nal is published twice a year. Submissions are considered on the understand- ing that they are being offered solely for publication by the Mammalogical Society of Japan. In principle, authors submitting articles to the journals should be members of the Mammalogical Society of Japan. Both journals are distributed free of charge to the members of the Society. The following are the annual dues for the membership : Domestic members ¥7,000 (Student ¥6,000) Overseas members US $60.00 Institutional subscriptions ¥20,000 All correspondence regarding application for membership, subscription, address change, and other matters should be addressed to: The Mammalogical Society of Japan Business Center for Academic Societies of Japan, Academic Society Center C21, 16-9 Honkomagome, 5-chome, Bunkyo-Ku, Tokyo 113, Japan Mammal Study : the continuation of the Journal of Mammalogical Society of Japan Editor-in-Chief : Seiki Takatsuki Editorial Secretary : Yukihiko Hashimoto, Masamichi Kurohmaru Editorial Board: Mark A. Brazil, Hideki Endo, Hirofumi Hirakawa, Toshio Kasuya, Takeo Kawamichi, Shingo Miura, Takashi Saitoh, Hitoshi Suzuki, Hidetoshi Tamate All correspondence regarding manuscripts and editorial matters should be addressed to: Dr. Seiki Takatsuki The University Museum, The University of Tokyo, Hongo 7-3-1, Bunkyo-ku, Tokyo 113, Japan Fax. +81-3-3815-7053, e-mail. taka@um.u-tokyo.ac.jp (Set ee ee ee Mammal Study 23: 85-93 (1998) © the Mammalogical Society of Japan Postnatal development of the neuromuscular junction of the masseter muscles in the Japanese field vole, Microtus montebelli Katsumi SUGASAWA’, Koichi ANDO? and Takayuki MorI1’* * Zoological Laboratory, Faculty of Agriculture, Kyushu University 46-06, Fukuoka 812-0053, Japan 5 Biological Laboratory, Department of Regional Culture, Faculty of International Studies of Culture, Kyushu Sangyo University, Fukuoka 813-0004, Japan * To whom correspondence should be addressed Fax. +81-92-642-2804, e-mail: sugar @agr.kyushu-u.ac.jp Abstract. The developmental pattern of the neuromuscular junc- tion (NMJ) in masseter muscles of the Japanese field vole, Mz- crotus montebelli, was investigated using acetylcholinesterase (AChE) staining and electron microscopy. At birth, intense AChE activity limited to the site of the NMJ where many axon terminals with the cholinergic nature were converging was observed, indicat- ing that cholinergic neuronal activity in the vole masseter muscle begins at this stage. The major morphogenesis of the NMJ such as: AChE staining reaction, concentration of myonuclei at the subneural site, elimination of the axon terminals, formation of the myeline sheath in the intramuscular axons, and the appearance of numerous junctional folds in the postsynaptic membrane was accelerated after postnatal day five, and amended dramatically at day ten with the maturation time of these NMJ components at around day fifteen. From the combination of the present and previous studies, it is clear that both AChE reaction and neuronal structures alter considerably at a time when structural and func- tional improvements give rise dramatically to muscle fibers. This must be considered in relation to the critical role of the neuronal influence on the differentiation and maturation of the vole masseter muscles that are required for the accomplishment of its own characteristic herbivorous food habits. Key words: acetylcholinesterase, masseter muscle, neuromuscular junction, postnatal development, ultrastructure. Among the masticatory muscles of the rodents, the masseter muscle is the largest, and is hence regarded as the most functional muscle during biting. Our recent ontogenical study of a particularly successful herbivorous rodent, the Japanese field vole, Microtus montebelli (Sugasawa and Mori 1997), revealed that vole masseter muscles differentiate abruptly after birth and mature fully before weaning. This developmental pattern of the masseters is distinctly different from that of the masseters of either the rat, Rattus spp. or the mouse, Mus spp.,in which they remain immature even at postnatal day 86 Mammal Study 23: 1998 (PND)23, when the young are weaned from their mothers (Maeda et al. 1981, Hurov et al. 1992, Miyata et al. 1996). It is well established in both the rat and the mouse, that neuronal actions and factors are significantly involved in the differentiation of developing skeletal muscles in various parts of the body (Ridge 1989, Hall and Sanes 1993, Grinnell 1995). Nevertheless, little is known about the neuromuscular interac- tion in the ontogenical process of the masseter muscle. Therefore, as the first step towards an understanding of the neuronal influence on the development of the rodent masseter muscle, we examined the developmental pattern of the neuromuscular junction (NMJ) in the vole masseter muscles from birth to PND 15, using histochemistry for acetylcholinesterase (AChE), the enzyme hydrolyz- ing acetylcholine (ACh) and electron microscopy. MATERIALS AND METHODS The Japanese field voles used for this study were obtained from our laboratory colony which originated from wild voles live-trapped in Fukuoka Prefecture. They were kept in cages in an environment-controlled room (23+ 1°C, LD 14:10). All the animals were given a herbivorous diet (ZF, Oriental Yeast Co., Ltd., Tokyo), a commercial mouse diet (NMF, Oriental Yeast Co., Ltd., Tokyo) and water ad libitum. Twenty four newborn voles of both sexes, which were kept with their mothers in cages, were used in this study. The day of birth (day 21 or 22 of gestation) was regarded as postnatal day 0 (PND 0). The animals were divided by age into the following four groups: PND 0, PND 9, PND 10, and PND 15. For each of the four groups, three individuals were used for AChE histochemistry and electron microscopy. 1. Histochemistry for AChE The voles were anesthetized with ethyl ether then perfused through the left ventricle with Ringer’s solution, followed by 30 ml of ice-cold 4% buffered formaldehyde. The masseter muscles were carefully dissected from the jaws, then postfixed with the same fixative for one hour. They were washed thor- oughly with 0.1 M phosphate buffer (PB, pH 7.4), and then immersed sequential- ly in PB containing 10% and 20% sucrose for two days each at 4C. For sectioning, the materials were quickly frozen in isopentane chilled with dry ice and sectioned at a thickness of 20 wm ina cryostat. To detect AChE activity, sections were maintained in substrate (acetylcholine iodide, Sigma Chemical, USA), free Karnovsky’s medium (Karnovsky and Roots 1964) for 30 min at 4°C, and incubated in the complete medium containing 2<10°* M tetraisopropyl pyrophosphoramide (Sigma Chemical, USA) as an inhibitor of non-specific cholinesterase for one hour at 20°C. These procedures have been described in detail by Ando (1981). 2. Electron microscopy In order to avoid excessive muscular contraction during direct fixation, Sugasawa et al., Development of neuromuscular junction 87 once the voles were fully anesthetized they were decapitated, and the heads were first immersed for 20 min in 3% glutaraldehyde buffered with 0.1M sodium cacodylate (SC) at pH 7.2. Subsequently, the masseter muscles were dissected out from the jaw in the same fixative, and postfixed for two hours. The materials were washed briefly in 0.1 M SC, and fixed for a further two hours in 1% osmium tetroxide buffered with 0.1 M SC. The tissues were dehydrated in an ethanol series and embedded in Epon 812. Thin sections (~60 nm) were cut on a Porter-Blum MT-1 microtome using a glass knife, and doubly stained with lead and uranyl acetate before examination in an Hitachi- H600A electron microscope (75 kV). RESULTS 1. AChE-activity In all of the voles examined at birth, AChE activity was observed to be limited to the center of the muscle fibers where the NMJ is formed. The muscular areas stained specifically with AChE were shaped like a button with a diameter of about 3.5 4m, and showed a linear profile in the transverse direction (Fig. la). The staining reaction at this site did not change signifi- Fig. 1. AChE reaction of the masseter muscle in the vole at birth (a) and on PND 15 (b). Bar : 50 wm. 88 Mammal Study 23: 1998 cantly from PND 0 to PND 5, however, by PND 10, the AChE-positive area had increased to about three times the diameter observed at birth with a rise in the activity of this particular enzyme. The AChE-positive area enlarged further after PND 10, reaching approximately five times the area observed at birth on PND 15. The enzyme activity also became more prominent (Fig. 1b). No detectable difference in the AChE staining properties of the NMJ was observed between the neonates at PND 15 and maternal voles at six months of age. 2. Electron microscopic observations At birth, many axon terminals covered with Schwann’s cells converged at the site of the NMJ, (Fig. 2a). These axon terminals did not contain the cytoskeletal or membranous components indicative of growth cones, but ac- cumulated with small clear vesicles (about 50 nm in diameter) indicating their cholinergic nature (Fig. 2b). At this stage, although the myeline sheath was not yet formed, most of the intramuscular axons were already encircled by Schwann’s cells (Fig. 2c). The basal lamina extended over the synaptic cleft in the muscle fibers. On the one hand, no junctional folds or subneural nuclei were seen, nor was an accumulation of mitochondria noted in the soleplate region. On the other hand, the subneural muscle plasma membrane was undercoated with an electron-dense amorphous material, showing a profile similar to the postsynaptic membrane in adults (Fig. 2b). No appreciable difference in the number of axon terminals in the NMJ was observed between birth and PND 5, however each of the intramuscular axons was surrounded by a thin myeline sheath by PND 5 (Fig. 3a, b, c). After PND 5, some structural specializations in the muscle fibers were observed in the soleplate region. Numerous myonuclei were concentrated at the subneural site, forming the subneural nucleus (Fig. 3a). In parallel with this, the muscle plasma membrane began to invaginate and form junctional folds (Fig. 3c). By PND 10, the number of axon terminals had decreased markedly (Fig. 4a), and the myeline sheaths of the intramuscular axons became much thicker (Fig. 4b). At this stage, the junctional folds increased greatly in number and grew taller owing to the frequent occurrence of deep invaginations of the plasma membrane. The accumulation of mitochondria, though not so prom1- nent, was also observed in the soleplate regions (Fig. 4a). By PND 15, the NMJ had only one axon terminal that was filled with small clear vesicles and small mitochondria, which was also furnished with numer- ous, regularly arranged junctional folds that were very tall and showing structural properties similar to those seen in adult voles (Fig. 5a, b). DISCUSSION The present study has shown for the first time an age-related change in AChE-activity and in the neuronal elements in the NMJ of the vole masseter muscle. At birth, high AChE activity was localized specifically at the NMJ, where a number of axon terminals with small clear vesicles, typical of a Sugasawa et al., Development of neuromuscular junction 89 Fig. 2. Electron micrographs of the NMJ (a, b) and intramuscular axons (c) in the vole masseter muscle at birth. at: axon terminal, bl: basal lamina, im: intramuscular axon, mf: myofiber, ps: postsynaptic membrane, sc=Schwann’s cell, sv: small clear vesicle. bane wll poma(ay©)e 05 X,’, where X; is the 7th allele frequency of the locus in the population. An average of expected heterozygosity (He) was calculated using the formula He=She;/r, where he; is heterozygosity of the jth locus and ¢ is the number of analyzed loci. Microsatellites genotype frequencies were tested against the Hardy-Weinberg’s expectation for each locus in the population using the computer program Arlequin ver. 1.0 (Schneider et al. 1997). Genetic differentiation between populations was estimated with Weir and Cockerham’s (1984) Fst value. The significance of Fst value was tested using the permuta- tion procedure in Arlequin ver. 1.0. RESULTS At two microsatellite loci (OarFCB193 and BOVIRBP), clear bands of 100 -150 base-pairs (bp) were identified as alleles. The INRA040 locus provided prominent bands (188-240 bp) with a few weak bands (Table 2). Animals from the Hokkaido (n=93 for OarFCB193, ~=108 for BOVIRBP, and ~=100 for INRA040) and the Chiba (x=13 for all loci) populations were analyzed to estimate allele frequencies for each microsatellite locus. At OarFCB193 locus, two alleles in Hokkaido and four alleles in Chiba were found. At INRA040 locus, two alleles in Hokkaido and five alleles in Chiba were found (Table 2), Table 2. Microsatellite variation in the Hokkaido and Chiba popuiations. Locus Hokkaido Chiba OarFCB193 No. individuals 93 13 Allele* & frequency 130 0.87 0.08 128 0 0.08 23 0 0.08 109 18 0.78 ho 0.24 0.39 he 0.23 0739 BOVIRBP No. individuals 108 13 Allele* & frequency 144 IL 0.96 140 ) 0.04 ho 0 0.08 he 0 0.07 INRA040 No. individuals 100 13 Allele* & frequency 240 0 0.04 238 0 0.08 202 0637 0.81 190 0 0.04 188 0.68 0.04 ho 0.39 523 he 0.44 0.38 Average over No. individuals NOOBS SxS 13.00+0.00 > lense SIS A AGe=0F33 3.67+0.88 Ho 0) 2llseO Ii 0, 2322 0R09 He O77 a= NR 0228 = ORubt *Molecular sizes (bases) refer to allele name ho and Ho: observed heterozygosity. he and He: expected heterozygosity. Nagata et al., Sika deer microsatellite DNA 99 while the BOVIRBP locus showed monomorphism in the Hokkaido population and two alleles in the Chiba population (Table 2). Between Hokkaido and Chiba populations there were some common alleles: two alleles at OarFCB193, one allele at BOVIRBP and two alleles at INRA040. Observed heterozygosities (ho) of OarFCB193, BOVIRBP and INRA040 were ().24, 0 and 0.39, respectively, in the Hokkaido population, and 0.39, 0.08 and 0.23, respectively, in the Chiba population. The average observed hetero- zygosity (Ho) was 0.21+0.11 for the Hokkaido population and 0.23+0.09 for the Chiba population (Table 2). The microsatellite genotype frequency signifi- cantly agreed with the Hardy-Weinberg expectation in each locus in the population except at INRA040 in the Chiba population (p=0.06) (Table 3). The difference between Hokkaido and Chiba was statistically significant (Fst value=0.072, =0.03 in permutation tests). DISCUSSION Microsatellite analysis has more advantage than allozyme analysis and multilocus DNA fingerprinting, because of higher polymorphism and easier genotyping from a small amount of DNA. Nozawa ef al. (1985) analyzed 28 allozyme loci from 20 individuals in the Hokkaido sika deer population and reported only two polymorphic loci with low variability : the average hetero- zygosity was 0.0158. By contrast, our results of microsatellite analysis showed much higher values (Ho =0.21+0.11) than their allozyme data (Table 2). Abernethy (1994) indicated that the sika deer population introduced to Scotland showed monomorphism at the BOVIRBP locus and two alleles for OarFCB193. In the present study, the BOVIRBP locus of the Hokkaido popu- lation was also monomorphic and showed a low value (0.08) of heterozygosity in the Chiba population. These data suggest the BOVIRBP locus is not so hypervariable in the sika deer. Pépin et al. (1995) reported that the number of alleles for INRA040 were nine in the goat (x=60) and 44 in the cattle (7 > 36). Our results revealed that the sika deer in Japanese islands have at least four alleles for OarFCB193, five alleles for INRA040 and two alleles for BOVIRBP. In the present study, two other loci (INRA003 and INRA023) could not be PCR-amplified with primers reported by Pépin ef al. (1995). The genotype frequency significantly well agreed with Hardy-Weinberg expectations at all loci in both populations except for the INRA040 locus in the Chiba population (Table 3). The observed heterozygosities of OarFCB193 and BOVIRBP were same level as the expected heterozygosity, while the observed heterozygosity of INRA040 was lower than the expected heterozygosity (Table 2). Some heterozygotes such as null/normal genotypes, however, might have been counted as homozygotes of normal alleles, because it is difficult to distinguish homozygotes of normal alleles from null/normal genotypes with a single band of PCR product. Our results show that null allele may exist at INRA040 locus. Jarne and Lagoda (1996) suggested that null alleles may disturb population studies leading to underestimate of heterozygosity. The 100 Mammal Study 23: 1998 INRA040 locus in the present study is likely in that case. From this reason, we compared heterozygosities of OarFCB193 and BOVIRBP between Hokkaido and Chiba. At both loci, heterozygosities of the Hokkaido population were less than those of the Chiba population (Table 2). Besides that, allele numbers at each locus in the Hokkaido population were much smaller than those of the Chiba population (Table 2). These results suggest a higher degree of homoge- neity in the Hokkaido population. This supports a low genetic variety of mitochondrial DNA in the Hokkaido population, shown by our previous analy- sis (Nagata et al. 1998). Some bottlenecks of the sika deer recorded in Hokkaido history (Inukai 1952) could have induced such a low genetic diversity in the population. The present results provide invaluable information for understanding genetic variety and history of the Hokkaido sika deer population, leading to the range of application of molecular genetics to conservation biology of the sika deer in Japan. Acknowledgments : We would like to express our thanks to Dr Seigo Higashi for helpful comments. We are grateful to Mr Masami Yamanaka, Mr Hiroyu- ki Uno, Dr Tadayoshi Takeda and other scientists for helpful supports of sample collection. We are grateful to Nature Conservation Department of Hokkaido Government, Hokkaido Institute of Environmental Sciences, Onbe- tsu Town Office, Shintoku Town Office, Shibecha Town Office, Shiranuka Town Office, Hamanaka Town Office, Utanobori Town Office and hunters for providing the sika deer specimens. This study was supported in part by Grants-in-Aid for Scientific Research from the Ministry of Education, Science, Sports and Culture, Japan, and by the Global Environmental Research Fund (F-1) from the Japan Environment Agency. REFERENCES Abernethy, K. 1994. The establishment of a hybrid zone between red and sika deer (genus Cevvus). Mol Ecoly3& 5al562: Chakraborty, R. and M. Nei. 1977. Bottleneck effects on average heterozygosity and genetic dis- tances with the stepwise mutation model. Evolution 31 : 347-356. Hokkaido Government. 1986. Result of a Survey Related to Sika Deer and Brown Bear Sighting in Hokkaido. Hokkaido Nature Preservation Division, Sapporo (in Japanese). Hokkaido Government. 1994. Result of a Survey Related to Sika Deer and Brown Bear Sighting in Hokkaido. Hokkaido Institute of Environmental Sciences, Sapporo (in Japanese). Inukai, T. 1952. The sika deer of Hokkaido and its prosperity and decline. The Report of Northern Cultural Research 7: 1-45 (in Japanese). Jarne, P. and P. J. L. Lagoda 1996. Microsatellites from molecules to populations and back. TREE 12424-4729) Kaji, K.1995. Deer irruptions - A case study in Hokkaido, Japan. Honyurui Kagaku [Mammalian Science] 35: 35-43 (in Japanese). Kaji, K., T. Koizumi and N. Ohtaishi. 1988. Effects of resource limitation on the physical and reproductive condition of sika deer on Nakanoshima island, Hokkaido. Acta Theriol. 33 : 187 ~208. Nagata et al., Sika deer microsatellite DNA 101 Masuda, R. and M.C. Yoshida. 1994. Nucleotide sequence variation of cytochrome b genes in three species of weasels, Mustela itatst, Mustela sibirica and Mustela nivalis, detected by improved PCR product-direct sequencing technique. J. Mammal. Soc. Japan 19 : 33-43. Nagata, J., R. Masuda, K. Kaji, M. Kaneko and M.C. Yoshida. 1998. Genetic variation and popula- tion structure of the Japanese sika deer (Cervus nippon) in Hokkaido Island, based on mitochondrial D-loop sequences, Molecular Ecology 7 : 871-877. Nei, M., T. Maruyama and R. Chakraborty. 1975. The bottleneck effect and genetic variability in populations. Evolution 29: 1-10. Nozawa, K., T.Shotake, Y. Kawamoto and K. Hayasaka. 1985. Genetic variability in several mammalian species of Japan. The Report of Grant-in-Aid for Specific Research (Evolution- ary Mechanisms at Molecular Level) from the Ministry of Education, Science, and Culture of Japan 3: 220-221 (in Japanese). O’Brien, S. J. and J. F. Evermann. 1988. Interactive influence of infectious disease and genetic diver- sity in natural populations. TREE 3: 254-259. Ohtaishi, N. 1986. Preliminary memorandum of classification, distribution and geographic variation on Sika deer. Honyurui Kagaku [Mammalian Science] 53: 13-17 (in Japanese). Pépin, L., Y. Amigues, A. Lepingle, J. L. Berthier, A. Bensaid and D. Vaiman. 1995. Sequence conser- vation of microsatellites between Bos taurus (cattle), Capra hircus (goat) and related species. Examples of use in parentage testing and phylogeny analysis. Heredity 74 : 53-61. Queller, D. C., J. E. Strassmann and C. R. Hughes. 1993. Microsatellites and kinship. TREE 8: 285- 288. Sambrook, J., E. F. Fritsch and T. Maniatis. 1989. Molecular Cloning. Cold Spring Harbor Labora- tory, Cold Spring Harbor, New York. Schneider, S., J. M. Kueffer, D. Roessli and L. Excoffier. 1997. ARLEQUIN ver. 1.0: A software for population genetic data analysis. Univ. of Geneva, Switzerland. Takatsuki, S. 1994. Extinction of plants caused by herbivory. KAGAKU [Science Journal] 64 : 672 -674 (in Japanese). Vaiman, D., D. Mercier, K. Moazami-Goudarzi, A. Eggen, R. Ciapolini, A. Lépingle, R. Velmala, J. Kaukinen, S. L. Varvio, P. Martin, H. Léveziel and G. Guérin. 1994. A set of 99 cattle mi- crosatellites: characterization, synteny mapping and polymorphism. Mammalian Genomes eZ Oom2 Oil. Viard, F., P. Bremond, R. Labbo, F. Justy, B. Delay and P. Jarne. 1996. Microsatellites and the genetics of highly selfing populations in the freshwater snail Bulinus truncatus. Genetics 142: W824 7. Weir, B.S. and C. C. Cockerham. 1984. Estimating F-statistics for the analysis of population struc- ture. Evolution 38:1 358-1370. Whitehead, G. K. 1993. The Encyclopedia of Deer. Swann-Hill, Shrewsbury. 704pp. (accepted 14 October 1998) Mies) r eset ie cay ta. rit vet aes fuloe ARRON eras iat, y 4 imi , =F) a | vo s (eine iu Lae’ cS fant FE | gad A if he | | “+0 inl soe inlet th t 4 6 - yey = —~ ei 5 . eae ae oe i . : zB — ‘i oe + ayia grail 1 cerry h ig Se ahh ‘tia. pa hy ¢ eo ts Nad coe 7 hh eh Th aa ‘ . 7 ie . z NRA He! Pe ie aes eM deg "} be par, ~ ' , ce rams. COR pi? Ms ye PRT ie) ES than bate ae ¥' Mri 2] =, NeW Un diaare ten A AH inh ila inet ae the ate = oh > t a ; Ms ae ry =a | a ia : F si ‘ ole Sete bee = a: - ee / pil ae Poke, ‘ol it pete om ‘vali ah : war's a dddat: 5 he ey / Ris ° ' vs , ~ oe Dyan $5 “athe ches Oa tise ela eT ost at EA Teil earl bas . ' ; f ] . ; of <4 phavi N =i ‘: me ee e ee ‘ re es et Mi Wier .20) Say a g ae) 107 thai ee | ry, iT 3s i i _ Y 2 he n oh y a mr a ¥ | ; i STEEP A ER walhitvebis hdrizcpl a te = Ss pe Ae a if Sten Tie) =f ~ ee " a4 i H ' ie > { ‘ * = = Se ee mete z * 4 re , 5 % ~ el UP os a 4 Zz : a > at : = —— ~ a> At 7 5 = 3 ‘ ea ore Zz y i reve l F. , 4 : i s4 { An " = = hes i en cae af A ae 3 2 . ee bike Z 4 sy x “ i = < q is “a 3 mt “ 3 eX 2 . whe. , s ») n i a pS ; tf y \ a + 4 = Cae ( t # =f — Al oo : e : 7 ; ; EN Se Ta i : S > 5 3 fi Ai i “ . J ra f | Sear % E a 4 es e a \ Mammal Study 23: 103-107 (1998) © the Mammalogical Society of Japan The twinning rate of sika deer, Cervus nippon, on Mt. Goyo, northern Japan Seiki TAKATSUKI The University Museum, The University of Tokyo, Hongo 7-3-1, Bunkyo-ku, Tokyo 113-0033, Japan Fax. +81-3-3815-7053, e-mail: taka @um.u-tokyo.ac.jp Abstract. Knowing demographic parameters is important in order tounderstand the life history of mammals. As an example, the twinning rate of sika deer, Cervus nippon, on Mt. Goyo was determined based on 2,064 samples collected from 1981 to 1997. The sex ratio of single fetuses (7=1,946) was even (49.8% males and 50.2% females). Six pairs (0.29%) of twins were found. One pair was composed of male and female embryos, suggesting that at least some conceptions are dizygotic. It was concluded that twin- ning is rare in sika deer. This rate was similar to, or lower than, that found in red deer, C. elaphus. Key words: Cervus nippon, Japan, reproduction, sika deer, twinning. Many of the life history variables among mammals may be best explained on the basis of body size. The “Fast-slow continuum” theory (Eisenberg 1981, Stearns 1983, Martin and MacLarnon 1985), for example, has shown that smaller-bodied mammal species are not merely short-lived, but that they typi- cally produce large litters of rapidly developing young, whereas larger mam- mals produce fewer young which develop slowly and live longer. There are, however, exceptions. Sika deer, Cervus nippon, for example, the males of which weigh 80 kg and the females of which weigh 50 kg, usually produce single offspring, while similarly sized Odocoileus species (Wallmo 1978) and the very much larger moose, Alces alces, the largest extant species of deer, regularly carry twins (Franzmann 1978). These differences may be better explained in terms of variation in species-specific habitat quality than in terms of mere body size. The habitats of Odocozleus species and moose are dominated by browse, which prevents detection by predators (Geist 1981). In order to fully understand the life histories of mammals, a comprehensive range of parameters including body size, phylogenetic relations and habitat quality must be investigated (Wootton 1987, Harvey et al. 1989), and precise quantitative data is essential. Among the various life history variables, demo- graphic information is one of the most important (Millar and Zammuto 1983, Fowler 1987). Although the pregnancy rates and the age of weaning are fairly well known for sika deer (Koizumi 1992, Takatsuki 1992, Kaji 1995, Asada and Ochiai 1997), it was believed until recently that twinning did not occur in wild populations 104 Mammal Study 23: 1998 (Feldhamer and Marcus 1994). There have been, however, several reports of twinning both in captivity and in the wild. I have collected information on sika deer pregnancies since 1981 on Mt. Goyo, northern Japan, and have found several cases of twinning among more than 2,000 females. The objectives of this paper, therefore, are to report on twinning in this population and to review previous reports on twinning in sika deer and in the closely related red deer, C. elaphus. MATERIALS AND METHODS Sika deer were shot for pest control on Mt. Goyo in northern Honshu, Japan, between January and March each year from 1981 to 1997. The deer carcasses were brought to checking stations where whole body weights were determined to the nearest 0.5 kg using spring scales prior to dissection. As conception takes place during the autumn rut, fetuses were already well developed and generally weighed 100-900 g during the sampling period, thus it is believed that none were overlooked. The rate of twinning was examined among 2,064 culled females. The sex of the fetuses was determined by genital examination, though some fetuses (7 =124) were too badly injured as a result of the shooting of their mothers for their sexes to be determined (Table 1). The ages of the adults were determined by examination of the cementum annuli of the first incisors, or were estimated from the wear of the incisors (Ohtaishi 1976) according to known age-wear relationships (Takatsuki, unpublished). RESULTS AND DISCUSSION Since sample sizes were small during the 1980s, they were rounded (Table 1). Of the total of 2,058 single fetuses examined, 1,934 were sexed and among these the sex ratio was even (females 50.2%, males 49.8%, y?-test, p >0.05). If twins were added (7=1,946), the sex ratio was completely even (males and females=50.0%). Table 1. Number of pregnant females and sex of fetuses of sika deer on Mt. Goyo through 1981-1997. f: female, m: male. Sex Single Twin teat unknown female male f-f f-m m-m Ee 1981-89 5) 93 107 0) 1 1 207 1990 ) 38 52 0) 0) 0 90 1991 1 89 70 0) 0 0 160 1992 0) 87 96 0) 0) 1 184 1993 a 197 123 0 0) 0 Bl 1994 3 176 191 0) 0) 1 Sil 1995 28 102 102 0) 0) IL 233 1996 i 90 116 1 0) 0 214 1997 le 98 107 0) 0) 0 278 total 124 970 964 il 1 4 2,064 Takatsuki, twinning of stka deer 105 Table 2. Information of females carrying twins. *Figures in parentheses are estimated age from wear. No. Locality Date of sampling oan ee Wear class 83068 Ofunato Mar. 21,1983 = 5 II 87012 Ofunato Feb. 21,1987 49.5 ORS Ill, 92229 Kamaishi Feb. 29, 1992 52 C85) Ill, 94553 Sanriku Jan. 8,1994 45 OEs ) V 95186 Kamaishi Feb. 26,1995 50 (Gre?) ? 96220 Takada Feb. 1, 1996 45 ( 52) if Among the 2,064 pregnant females examined, six (0.29%) were carrying twins (Table 1), indicating that while twinning does occur, it is exceptional in this population. Records of twinning are very rare among wild sika deer. Suzuki (1995) reported one example (1.1%) among 89 pregnant females in one Hokkaido population, and Uno (personal communication) found two sets of twins (3.4%) among 58 pregnant females in another, though he considered that this rate might be high because of his small sample size. Feldhamer and Marcus (1994) reported that a set of healthy sika deer twins was carried by one female among 54 females introduced to Maryland, USA. Five sets of twins (4.6%) among 108 births (Zuckerman 1953) and one set (1.20%) among 83 births (Haensel 1980) have been reported from German zoos. The sample size of the present study (2,064 females) was very much greater than in any of these cases thus the results from this study may be more reliable. Among both Eurasian red deer and North American wapiti (elk) popula- tions, both close relatives (both Cervus elaphus) of sika deer, twinning is also very rare (see review in Mitchell ef al. 1977 and Sadleir 1987). Guiness and Fletcher (1971) recorded only one example among Scottish red deer, while other studies have indicated that twin embryos among red deer occur at rates ranging MmommlessstnamnO za to 20% (less tham 0.295 Mitehelll 1973 > 0295." 7— 1690; Kittams 1953; 0.2%, ~=1,186, Flook 1970; 0.6%, ~=1,106, Greer 1968; 1.2%, n=875, Korning and Vorreyer 1957), and 2.0% (~=97, Brna 1969). During the present study, the combinations of twins were: one female- female set, one female-male set, and four male-male sets (see Table 1). Male and female twins were also reported among Hokkaido sika deer by Suzuki (1993), further indicating that at least some conceptions are dizygotic. The data collected during the present study of the Mt. Goyo population provides no evidence for any particular tendency towards twinning in any particular locality, period, body weight, or age (Table 2). Since pregnancy among red deer is known to be affected by nutritional conditions (Mitchell et al. 1977), further studies of other populations are required to clarify what factors affect twinning in sika deer. Acknowledgements : | thank the hunters of Ofunato, Kamaishi, and Rikuzen- 106 Mammal Study 23: 1998 Takada cities, and Sanriku, and Sumita towns for their co-operation. Stu- dents of both Tohoku and Iwate Universities kindly assisted with fieldwork, while S$. Miura, H. Takahashi, H. Uno and S. Tatsuzawa provided valuable information on twinning. The Iwate Prefectural Government supported this study. REFERENCES Asada M. and K. Ochiai. 1997. Analysis of captured sika deer. Jn Report on Conservation of Sika Deer on Boso Peninsula of Chiba Prefecture. pp. 21—50. Chiba (in Japanese). * Brna, J. 1969. Fertility of hinds and post natal mortality of young red deer Cervus elaphus in Belje. Jelen 8: 69—72. Eisenberg, J. F. 1981. The Mammalian Radiation. Athlone Press, London. Feldhamer, G. A. and M. A. Marcus. 1994. Reproductive performance of female sika deer in Mary- land. J. Wildl. Manage. 58 : 670—673. Flook, D. R. 1970. Causes and implications of an observed sex differential in the survival of Wapiti. Can. Wildl. Service Rep. Ser. 11, 71 pp. * Fowler, C. W. 1987. A review of density dependence in populations of large mammals. Jn (Gas- aways, H.ed.) Current Mammalogy. pp. 401—441. Plenum Press, NY. Franzmann, A. W.1978. Moose. Jn (Schmidt, J. L.and D.L. Gilbert, eds.) Big Game of North America. pp.67—81. Stackpole, Harrisburg. Geist, V. 1981. On the reproductive strategies in ungulates and some problems of adaptation. Jn (Scudder, G.G.E.and J. L. Reveal, eds.) Evolution Today. pp.111—132. Proc. Int. Congr. Syst. Evol. Biol., 2, Univ. Brit. Col., Vancouver. * Greer, K.R.1968. Special Collections Yellowsotne Elk Study 1967—1968. Job Completion Report, Federal Aid Project No. W-83-R-11, 26p. Guiness, F. E. and J. Fletcher. 1971. First ever recorded incidence of twins born to a red deer hind in Britain. Deer 2: 680—682. Haensel, J. 1980. Zur Biologie der Vietnam-Sikas (Cervus nippon pseudoaxis Eydoux & Souleyet, 1938) Untersuchungen an der Zuchtgruppe im Tierpark Berlin. Milu, Berlin, 5 :69—99. * Harvey, P. H., A. F. Read and D.E. L. Promislow. 1989. Life history variation in placental mam- mals: unifying the data with theory. Oxf. Surv. Evol. Biol. 6:13—31. Kaji, K. 1995. Analysis of captured sika deer. Ju Report on Brown Bear and Sika Deer, I. pp. 85— 103. Sapporo (in Japanese). Kittams, W. H. 1953. Reproduction of Yellowstone elk. J. Wildl. Manage. 17: 177—184. Koizumi, T.1992. Reproductive characteristics of female sika deer, Cervus nippon, in Hyogo Prefecture, Japan. Jn (Spitz, F., G. Janeau, G. Gonzalez and S. Aulagnier, eds.) Proceedings of the International Symposium “Ongulés/Ungulates 91”. pp.561—563. S.F.E.P.M.and [.R. G. M., France, 661 pp. Korning, F. and F. Vorreyer. 1957. Untersuchunger tiber Vermehrungsraten und k6rpergewichte beim weiblichen Rotwild. Z. Jagdwiss 3: 145—153. Martin, R. D. and A. M. MacLarnon. 1985. Gestation length, neonatal size and maternal investment in placental mammals. Nature 51 :81—117. Millar, J.S.and R.M.Zammuto. 1983. Life histories of mammals: an analysis of life tables. Ecology 64 : 631—635. Mitchell, B. 1973. The reproductive performance of wild Scottish red deer, Cervus elaphus. J. Reprod. Fert., Suppl. 19 : 271—285. Mitchell, B., B. W. Staines and D. Welch. 1977. Ecology of Red Deer: a research review relevant to their management in Scotland. Institute of Terrestrial Ecology, Banchory ; 74 pp. Ohtaishi, N. 1976. Wear on insiform teeth as an index to the age of Japanese deer at Nara Park. In Report on Nara Sika Deer for 1975. pp.71—82. Kasuga Kenshokai (in Japanese with English Summary). Takatsuki, twinning of stka deer 107 Sadleir, R. M. F. 1987. Reproduction of female cervids. Juz (Wemmer, C.M., ed.) Biology and Management of the Cervidae. pp. 123—144. Smithsonian Inst. Press, WA. Stearns, S.C. 1983. The influence of size and phylogeny on life history patterns. Oikos 41 :173— 187. Suzuki, M. 1993. Reproduction of female sika deer (Cervus nippon Heude, 1881) in Ashoro District, Hokkaido. J. Vet. Med. Sci. 55 : 833—836. Suzuki, M. 1995. Fetal growth and estimation of copulation date. Ju Report on Brown Bear and Sika Deer, I. pp.111—125. Sapporo (in Japanese). Takatsuki, S. 1992. A Sika Deer Herd Living in the North. Dobutsusha Publ. Co., Tokyo, 262 pp (in Japanese). Wallmo, O. C. 1978. Mule and black-tailed deer. Ju (Schmidt, J. L. and D. L. Gilbert, eds.) Big Game of North America. pp.31—41. Stackpole, Harrisburg. Wootton, J. T. 1987. The effects of body mass, phylogeny, habitat, and trophic level on mammalian age at first reproduction. Evolution 41 : 732—749. Zuckerman, S. 1953. The breeding seasons of mammals in captivity. Proc. Zool. Soc. London 122: 827 — 950. * Cited in Sadleir (1987). (Accepted 16 September 1998) a 4 rake i} . Key : aoe ee, ein = eis 3:4 a ae srl a o BEBE pitta , moe Pritt) oq, v E 6 ‘ ig From Te Te ag Me ‘Ste a ie Bia ic PSE ear opie ers” oan Fil ie oi peR LAN § e i Y ; ih thd 5 m9 ; . . Ec. = ia wa i . r vs = a. ‘ ; ¥ co f Cereal 1 ape ee eee yO i a a a ; ot SS Ua! * he ee ave ag ae F — r) ae A Stl eae Oy ' , , ae ee Serie ; if rh aa) ‘ ae oe vs éj " Se ve ; = ‘ i) fl ‘ } H a = ! _ - a } ne cana ae ; A = ) oa. | ® mee Ses . ( F > v Z| Ma; i \ Poe = vs os a) , f j ; q Es ie aye ¥, e 3 oes r i cy £ a 4 ' ‘ ny pot 4 4 o = « ag Qe , Ms Zs =~ — 7 os 2 % ae Pen el ‘ ~ nes = — + = ~ Safi r t Ay ‘ is oo x p 3 hh 4 eh 3 le er 4 =a : bs ae = r vi , # ES i oe a ge Laer 4 i ~ ca | tear = ay f a i > -*, 1: os = 4 me OTS = S 1 Pris ; » - a / Mo y a ; + 5G) “A ~ AN o) { | + 2 Noe . pe ; aa / é ip Y, = s 1 ‘Z £ ’ 7 ¥ ya Es , 1 . _ i ¥ F if “) j se a j ia Z 7 Eee = x — at = as, _— 7 “4 rh & c ~ B me ‘i 1 i i . 2 ates i a 4 netie tt \ os ‘ ' 4 fete ; BG : f Mammal Study 23: 109-118 (1998) © the Mammalogical Society of Japan The “Trace Recorder”, a new device for surveying mammal home ranges, and its application to raccoon dog research Yayoi KANEKO!, Takeyoshi SUZUKI*?, Naoki MARUYAMA, Oichi ATODA%*, Nobuo KANZAKI and Masaki TOMISAWA*? Wildlife Conservation, Department of Ecoregion Science, Faculty of Agriculture, Tokyo Noko Univer- sity, 3-5-8 Saiwaicho, Fuchu, Tokyo 183-0054, Japan * Graduate School of Bio-Applications and Systems Engineering, Tokyo Noko University, 2-24-16 Nakamachi, Koganeit, Tokyo 184-O012, Japan 1 Present address: Landscape and Ecology Division, Environment Department, Public Works Research Institute, Ministry of Construction, 1 Asahi, Tsukuba City, Ibaraki 305-0804, Japan 2 Present address: Yokogawa Electric Corporation, 2-9-32, Nakamachi, Musashino, Tokyo 18O-O006, Japan 3 Present address: Department of Information Engineering, Maebashi Institute of Technology, 460-1 Kamisatorit, Maebashi, Gunma 371-0816, Japan Abstract. A new telemetric system known as the “Trace Recorder” was developed in order to reduce labor costs and to avoid radio-tracking location errors. It was first tested during studies of habitat utilization by raccoon dog, WNyctereutes procyonoides viverrinus, in Japan. The Trace Recorder (TR) consists of four separate units: beacons, recording units (RU), an automatic collar release system (ACRS) and a personal computer for processing data. The beacons emit 8kHz magnetic signals periodically. A total of 600 different magnetic codes can be used in order to identify locations. The collar-based RU intercepts and records signals when the study animal is within 3m of a beacon. The ACRS installed on the collar alongside the RU allows the collar to be released by a special code and recovered so as to facilitate the retrieval of stored data. In order of evaluate the capabilities of the trace recorder system, we used the TR in the analysis of the habitat use of a raccoon dog for 25 days between 16 November and 10 December 1996 in Hinode Town, suburb of Tokyo. Twenty-four beacons were set at along paths, at a gar- bage site, and at badger setts and animal latrines. The RU recorded 91 time units and durations of visits to trails and to some cores sites were collected. The TR system is capable of recording census data 24 hours every day for three months. The new TR system proved to be more accurate than current radio-telemetry equipment for recording frequency, duration and times of visits to target sites by the study animal. Key words: automatic collar release system, home range, raccoon dog, telemetry system, trace recorder . 110 Mammal Study 23: 1998 The wireless radio-telemetry system currently used in the study of free-ranging wildlife was first developed in the 1960s (Amlaner 1991). It has been widely used in relocating individuals and in measuring physical conditions of wildlife species (Mech 1983, Kenward 1987). Radio telemetry quickly proved a popular technique for tracking and studying small nocturnal, forest-living carnivores in Japan (Nakazono 1989, Ito 1992, Sasaki 1994, Tatara 1994, Yamamoto 1995). Locating animals is, however, usually quite laborious because of rugged terrain (Mech 1983, Ikeda 1985). In order to save on labor costs for relocating study animals, an automatic tracking system was devised (Doi 1985, Yoneda e al. 1988), however its use has been restricted by topographic condition and by access to electric power. Continuous location recording over-long periods of time is impractical by this method, especially of active, wide ranging species. Further, a triangular location technique of this current system could not avoid big errors because of users and terrain (Mech 1983). Because of the high labor costs incurred while radio-tracking free-ranging animals, other methods have long been required by field researchers. In response to this need, the authors devised a new telemetric system known as the Trace Recorder or TR. The concept and the details of the circuitry involved in the TR have been submitted elsewhere (Suzuki ef al. in press), hence in this paper, we introduce the systems practical capabilities and describe its applica- tion in a field study of the home range of a medium-size mammal, the raccoon dog, Nyctereutes procyonoides viverrinus. THE TRACE RECORDER SYSTEM Devised in 1996, the TR system consists of beacons, recording units (RU), automatic collar release system (ACRS) and a personal computer (Fig. 1). The fundamental unit of this system is composed of beacons and the RUs. Each beacon, set within a study area, emits 8 kHz magnetic field modulated by 14- bit unique serial codes and covers a range of 3m radius. When six UM-1 batteries are connected in series, a beacon can emit signals for up to six months. At present, 600 beacon codes are distinguishable. Collars weighing 130 g, including an RU are attached around the necks of animals. The RU is composed of a circuit board and two CR123A lithium batteries, which are connected in series and give the RU a working life of at least three months. Each collar’s RU is capable of receiving 0.25 sec long magnetic signals from a beacon at 15 sec intervals, the RU records each signal along with the time in the unit’s static random-access memory (SRAM). The SRAM provides a capacity of 16,000 time units. A time unit is defined as the duration of an RU’s recording of the same signals emitted by a certain beacon ; this is the elapsed time between an RU-fitted animal arrival within the range of a certain beacon, and the time when it leaves the beacon’s range. RU data recorded in the format of the following example “120 970915072015- 970915185045” indicate that a study animal remained at beacon number 120 on 15th September 1997 from 07:20:15 (hours : minutes : seconds) to 18:50: 45. Kaneko et al., Trace Recorder for raccoon dog study 111 BADGER'S BEACON LATRINE RECORDING UNIT (RU) AOCELLISLI (LILLIA EELS 3 MAGNETIC FIELD Fig. 1. Schematic outlining of the Trace Recorder system. When an animal equipped with a Recording Unit (RU) enters a beacon’s 6 m in diameter magnetic field, the RU records its time and location. These are recorded using the beacon’s unique ID number. At the operator’s discretion, a special code will be sent via a beacon and the RU to the Automatic Collar Release System (ACRS) thereby releasing the collar immediately for recovery. By using a computer system, the accumulated information is downloaded from the RU. The time unit are accurate to within 15 sec. After recovery of the RU, the memory is transferred to a personal computer and converted using the C language software for MS-DOS. The real time records of an animal’s stay within the range of each beacon can then be reconstructed. The ACRS is installed on collars along with RUs in order to be able to recover the stored data. When the RU receives a special code from a beacon, it transfers a special signal to the ACRS which then releases the collar immedi- ately. The ACRS also triggers automatically releasing the collar when bat- tery voltage falls so as to reduce any stress involved in carrying a collar toa minimum. 1. Animals weight Collars with RUs attached weigh approximately 130g, varying slightly depending on battery weight. If an acceptable upper limit to collar weight is 5% of the weight of a study animal (Kenward 1987), then this system is of use on any animal weighing more than 2.6 kg. 2. Applicability in home range research When this system is applied to record home ranges, it is recommended to 112 Mammal Study 23: 1998 use a method to the repeated-capture-in-traps (Jewell 1966), rather than the usual radio-tracking method. ‘That is, many beacons should be deployed in order to cover the home range of the animal to be examined. The number of beacons required accuracy of the study. The larger accuracy required, the more beacons are necessary. Using this method, the primary issue is establish- ing where best to place beacons so that an area is thoroughly covered. If plenty of beacons are available, this problem is easily resolved, however using many beacons is costly more than traditional radio-telemetry. At the begin- ning of a research project, a home range should be roughly mapped based on detection using may be set out at core sites within the presumed home range such as at feeding sites, setts, latrines and animal paths in order to track the study animal(s) in detail. APPLICATION TO HOME RANGE UTILIZATION OF A RACCOON DOG STUDY AREA The study area was located in Hinode Town, about 50 km west of the center of Metropolitan Tokyo. Situated within the Pacific Ocean climate zone, the area has a mean annual temperature of 13.2°C, and a mean precipita- tion of 1,500mm most of which falls in summer. The area has a gentle topography of low hills covered with plantations of Japanese cedar, Cryptomer- 1a japonica and Japanese cypress, Camaecyparis obtusa. In the shallow valley bottoms, there are residential areas and cropland. Other similar-sized mam- mals occurring in the study area include the badger, Meles meles anakuma, red fox, Vulpes vulpes japonica, and masked palm civets, Paguma larvata. Some difficulties are experienced when using current radio-telemetry tech- nique to track animals in such areas because of the reflection of radio waves by the mountainous topography and because of interference from amateur ham- radio communication systems. METHODS A young female raccoon dog, weighed 3.5 kg, was captured with a box trap and immobilized by ketamin hydrochloride. A collar with both an RU anda radio-transmitter was attached to her and she was released on 16 November 1996. From two to six radio-fixes were obtained each day using standard radio-telemetry techniques. By 28 November, a total of 18 radio-fixes had been obtained. Using the radio-fixes and the convex polygon method, the animal’s home range was estimated to be of about 5.9ha. On 28 November 24 beacons were installed in and around this estimated home range at a feeding site (a garbage site) at badger setts (badger setts and resting sites of may be sometimes used by raccoon dogs), raccoon dog latrines and along animal paths (aie. 2), The authors interviewed local residents about frequency of waste disposal Kaneko et al., Trace Recorder for raccoon dog study eles; at the garbage site in order to assess its potential significance to raccoon dogs. Since the tracking period by current radio-telemetry techniques was short and because the study animal was first caught outside her estimated home range, it was presumed that she might occasionally reappear outside the estimated range. Therefore, beacons were set at several possible sites outside the mapped range and she was also tracked using radio-telemetry techniques. The animal was recaptured on 23 December 1996, and data were downloaded onto a personal computer for analysis. The daily activity period was defined as the period between the first and last recording beacon signals recorded each night. The non-active period was defined as the resting period. U and f-tests were used to compare the various activity patterns of this individual. RESULTS AND DISCUSSION 1. Trace recorder data The RU attached to this female raccoon dog recorded 91 time units from nine beacons over 12 days between 28 November and 10 December 1996. Six @ Path A Garbage site O Raccoon dog's latrine — m@ Badger's sett QO Badger's resting site A Capture site C) Raccoon dog's range = Road -. River Fig. 2. The location of 24 beacons (with their IDs) in the range of a raccoon dog as defined by radio-telemetry between 16 and 28 Nov. 1996 in Hinode Town, Tokyo. Figures represent beacon IDs. 114 Mammal Study 23: 1998 Table 1. Locations and lengths of stay of a raccoon dog fitted with a recording unit in Hinode Town, Tokyo, between November 28 and 10 December 1996. : Duration of sta Number of Beacon site (hr : min: aye time unit Beacon ID Pail Os 10s 15 4 i Path Os 04500 3 2 Path Qes O24 5 8 4 Path OR00R 30 3 if Path Os OO 2 15 1 3 Path Os Os 5 IL 8 Badger’s sett 12 WD 5 aS 8 6 Raccoon dog’s latrine 0.5 0 6 BO Z, is Garbage site ae, Cee kG) 61 9 Total Qe 30 beacons which were not recorded by RU badger’s resting site: 5, 19, badger’s sett: 20, 23, path: 10, 11, 12, 14, 15, 16, 17, 18, 21, 22, 24 Ne} my of these beacons were located along the paths, and the others were at a garbage site, a badger’s sett and a raccoon dog’s latrine (Table 1). Eight of the nine beacons registered by the RU were from within the home range polygon determined by 36 radio-fixes obtained during the same period, only one beacon outside the range polygon was registered (Fig. 3). The new home range poly- gon obtained during the TR study slightly north of that obtained prior to the use of the TR (see Fig. 2). The 91 time units recorded were converted to a total of nine hours, 58 min and 30 sec. The earliest RU time was at 17:03 on a day when sunset was at 16 : 28, and the latest was 06:24 on a day when sunrise was at 06:31. During the nights of 7/8 December 1996, for example, her RU recorded 11 time units from three differrent beacons (Fig. 4). On that night the study animal first appeared walking a path at 17:09 on 7 December, she then appeared at a garbage site, which she visited eight times between 17:12 on 7 December and 05:14 on 8 December. She stayed there 15 sec to 42 min. She made no visits other beacons while visiting the garbage site. Finally, she appeared a badger’ s sett between 05:35 and 05: 45 on 8 December. The TR system clearly provided a very accurate method for recording the presence or absence at a target site. 2. Activity pattern This raccoon dog proved to be active at night from immediately after sunset and just before sunrise throughout the 12-day study period. She was active for 43.3487 (SD)% (range : 33:6-73.2%, n=12) of a 24 hour pemod, and the rested for 56.4+8.4 (SD)% (range : 46.9-72.9%, m=12). The active period was significantly shorter than the rest period (f-test, p<0.01). The duration of time spent at the garbage site was 6.1+7.9 (SD) % (range: 0.1-23.7%, n=12) of the activity period, and the time spent at the badger’ s sett Was WU GaAs Ceara: 05-402, w=). Kaneko et al., Trace Recorder for raccoon dog study NS) =. @ Beacon which was recorded by RU ©) Raccoon dog's range O Raccoon dog's resting site determined by radio telemetory = Road “w River Fig. 3. The location of the nine Beacons recorded by a raccoon dog’s RU and her home range drawn by 36 fixes with ten resting sites obtained by the radio-telemetry between 28 Nov. and 10 Dec. 1996 in Hinode Town, Tokyo. Figures represent beacon IDs. Activity patterns varied at each of the sites where she was recorded (Fig. 9). Analyzing the data asa percentage of the total time spent at the badger’s sett was divided into hourly intervals at the garbage site, the first peak in activity was from 18: 00-19: 00, and again 22:00 and 02:00. Inthe earlymorn- ing, she made fewer visits to the garbage site. The percentage of time spent on paths reached a plateau between 21: 00 and 03:00 with two troughs. The time spent at the badger’s sett peaked between 05:00 and 07:00. Thus, it seems that this female raccoon dog first visited the garbage site, then walked through paths and visiting the garbage site again, and finally visited a badger’s sett. The TR system allows the collection of 24 hour-census data of target sites. Whereas when we used the radio-telemetry in Hinode Town, we had to watch and check the activity record on the recorder chart continuously because of noise from amateur ham-radio communication. Thus, the TR system saves considerable labor cost. Beacon Site |Beacon ID Time of Day (hours) 17 22 23 ) Path Garbage site Badger's sett Fig. 4. An example of time units from the RU on the night of 7/8 Dec. 1996 in Hinode Town, Tokyo. Beacon ID 1, 2, 3, 7, 8 (path) and 13 (latrine) were not recorded. 116 Mammal Study 23: 1998 60 BADGER'S SETT 50 40 30 GARBAGE SITE 20 PERCENTAGE OF TOTAL DURATION OF STAY 15 18 21 24 3 6 9 TIME OF DAY (HOURS) Fig. 5. Activity pattern of a female raccoon dog at target sites based on data from the Trace Recorder system in Hinode Town, Tokyo between 28 Nov. and 10 Dec. 1996. 3. Target site usage patterns Visits to the garbage site were made intermittently, but every day between 28 November and 10 December 1996 (Fig. 6) with an average of 4.7+3.9 (SD) visits per day (range: 1-14, n=12), lasting on average §.3+12.1 (SD) min per visit (range: 15-54 min, ~=61). Three peaks were found at intervals of a few days during 12-day study period coinciding with when kitchen waste was disposed of at the site. ~The animal seemed to stay at the garbage site in order to search for food for significantly longer total periods on waste disposal days (112.9+ 47.5 (SD) min, ~=4), than on non waste days (6.65.6 (SD) min, 7=8, U-test, p<0.01). If she found no food, she left the garbage site after a short stay of 15 sec to just a few minutes. At the end of her period of nocturnal activity, she visited the same badger’s sett eight times on 8 of the 12 days (Fig. 7). She did not visit the sett on four mornings (3, 4,5 and 9 December). Her visits to the badger’s sett were usually short (8.5+4.3 (SD) min, range: 3.0-16.5 min, ~=8). She was presumed to be looking for an opportunity to use the badger’s sett as a resting site, but was unable to do because the sett was in use year-round by an adult female badger (Kaneko unpubl.). For recording frequency, duration and time of the visit of an animal to target sites and places within a core area, the new TR system is more accurate than the current radio-telemetry systems. In particular, it is very useful in the study of short-term activity. Using the TR system in this study revealed that a female raccoon dog frequently checked the resources available to her such as a garbage site and a badger’s sett. In the study area, an interval of radio- fixing may be around 15 min may be shortest, which is impossible for the current radio-telemetry to obtain the same accuracy. Furthermore, the new TR system greatly reduces the number of participants required to obtain data. Kaneko et al., Trace Recorder for raccoon dog study Hl min. average range 60 DURATION OF STAY w .o) 28 29 30 #1 2 3 4 5 6 7 8 SO November —k— December DATE Fig.6. The length of visits to the garbage site each night between 17:00 to 05:00 by a raccoon dog in Hinode Town, Tokyo between 28 Nov. and 10 Dec. 1996. Each figure on the vertical bar indicates the number of visits. 4. Detection of the opportunistic resting site Radio-telemetry revealed that the study animal used ten resting sites in the rough proximity of badger’s sett (Fig. 3). A careful search of the areas indicat- ed by radio-telemetry, however, revealed no dens, and suggested that the study animal slept directly on the ground with or without cover. Eight of the ten resting sites were situated among bushes, one was located under a huge rock, and one was on a footpath on the shoulder of a mountain. In conclusion, in this preliminary trial of the applicability of the TR system to wild animal studies, neither the number nor the density of beacons were taken into consideration. For the future development of this system and the methodology of its use, a spatial approach will be taken. It will be best to DURATION OF STAY 0) ZO Tee 30). cli: 529 OS a D6 i. = birt ager 10 November —pid-— December DATE Fig. 7. Visits to a badger’s sett by female raccoon dog in Hinode Town, Tokyo between 28 Nov. and 10 Dec. 1996. (Only one visit was made per day.) 118 Mammal Study 23: 1998 devise a grid system that will effectively cover the suspected home range of the study animals. The working period of the RU needs to be decided as does the best distance between the points of the grid in relation to animal home range size. In addition to its advantages over current radio-telemetry techniques, a further advantage of the TR system over the grid trapping system is that it is less stressful to the study animals because they need only be trapped once. Acknowledgment : We thank Mr Satoshi Ohori and Ms Sachiko Saito of the Natural Environmental Research Laboratory, Waseda University and Ms Yuko Fukue at Tokyo Noko University for their great help in preliminary experiments of the Trace Recorder. We also appreciate Mr Eiji Kanda of Tokyo Wildlife Research Center for his assistance with field work in Hinode Town. We gratefully acknowledge the support of the Tokyu Foundation which funded the Trace Recorder system, and the Toyota Foundation for the field materials. REFERENCES Amlaner Jr, C. J.1991. Wildlife biotelemetry and radio tracking after several decades of electronics evolution.Jn (Uchiyama, A and C. J. Amlaner Jr. eds.) Biotelemetry XI. 9-16, Waseda Univer- sity Press. Tokyo. Doi, A. 1985. Present status and future of the telemetry. Report of the Society of the Japan Population Ecology. 40 : 35-41. Ikeda, H.1985. Radio tracking on mammals in Japan. Jv (Kawamichi, T. ed.) Contemporary Mammalogy in China and Japan. Pp. 191-194. Mammalogical Society in Japan. Ito, Y. 1992. Social structure and habitat utilization of the Japanese badger in HinodeTown, Tokyo. Master Thesis of Tokyo Noko University. 79pp (in Japanese). Jewell, P. A. 1966. The concept of home range in mammals. Symposium of Zoological Society of London. 18 : 85-109. Kenward, R. 1987. Wildlife Radio Tagging. Academic Press, London. 222pp. Mech, L. D. 1983. Handbook of Animal Radio-tracking. University of Minnesota Press, USA. 107pp. Nakazono, T.1989. The habitat utilization pattern of Japanese red fox, Vulpes vulpes japonica, in Kyusyu. Honyurui Kagaku (Mammalian Science) 29:51-62. (in Japanese with English abstract) Sasaki, H. 1994, Ecological Study of the Siberian weasel Mustera sibirica coreana related to habitat preference and spacing pattern. Ph.D Thesis of the Kyushu University, 5lpp. Suzuki, T., Y. Kaneko, O. Atoda, N. Maruyama, M. Tomisawa and N. Kanzaki. (in press) Existence detection by on-off code of magnetic dipole field and its use in recording small wild animal’s behavior. Transactions of the Society of Instrumental and Control Engineers, Tokyo (in Japanese with English abstract). Tatara, M.1994. Social System and Habitat Ecology of the Japanese Marten Martes melampus tsuensis on the Islands of Tsushima. Ph.D Thesis of the Kyushu University, 79pp. Yamamoto, Y. 1995, Home range and dispersal of the raccoon dog (Nyctereutes procyonotdes viverrinus) in Mt. Nyugasa, Nagano prefecture. Japan. Nat. Envir. Sci. Res.7:53-61 (in Japanese with English abstract). Yoneda, M. and T. Iwano. 1988. A wildlife tracking system using the digital-code transmitter and the auto azimuth finder. Honyurui Kagaku (Mammalian Science) 28 : 23-37 (in Japanese with English abstract). (accepted 27 November 1998) Mammal Study 23: 119-122 (1998) © the Mammalogical Society of Japan Short Communication Measurements of the nasal sacs of individual common dolphin, Delphinus delphis, and Dall’s porpoise, Phocoenoides dalli, by means of silicon reconstruction Koji NAKAMURA!, Tadasu K. YAMADA? and Kenji SHIMAZAKI' 1 Division of Marine Ecology, Research Institute of North Pacific Fisheries, Faculty of Fisheries, Hokkaido University, 1-1, Minatocho 3-chome, Hakodate, Hokkaido 041-8861, Japan Fax: +81-138-40-8860, e-mail: porpoise @ pop. fish. hokudai. ac. jp 2 Division of Mammals and Birds, Department of Zoology, National Science Museum, 3-23-1 Hyakunin-cho, Shinjuku-ku, Tokyo 169-0073, Japan The toothed whales produce a wide range of species specific sounds with great differences between certain families. The acoustic characteristics of the echolocation sounds produced by the Phocoenidae and the Delphinidae are especially different (Kamminga ef al. 1996). That of the delphinid common dolphin, Delphinus delphis, for example, is a broad-band, high-frequency sound of short duration; the peak frequency range is 20-100 kHz, and the signal duration range is 50-150 ws (Evans 1973). In contrast, the echolocation signal of the phocoenid Dall’s porpoise, Phocoenoides dalli, is a narrow-band, high- frequency sound of long duration; the peak frequency range is 120-160 kHz, and the signal duration range is 180-400 ws (Awbrey et al.1979, Hatakeyama and Soeda 1990). The physical properties of the sounds produced by toothed whales are directly affected by the morphological characteristics of the air space in the head and by the sound-production mechanism (Aroyan eft al. 1992). In order to understand how sounds are produced, and why there are such different acoustic characteristics between families, detailed information about the shape and volume of the air spaces is needed. In this paper, we describe a new experimen- tal technique making it possible to obtain this information. We used a silicon injection technique in order to determine the shape and dimensions of the air spaces in the nasal sacs of individual common dolphin and Dall’s porpoise. Two specimens, one common dolphin (male, B. L.=157 cm, M30116, National Science Museum, Tokyo) and one Dall’s porpoise (sex and B. L. unknown, collected at Otsuchi, Japan) were examined. The heads of both Specimens were frozen before examination. Prior to injecting silicon, the larynx and the surrounding muscle complex of each animal was removed and the head was turned upside down. We then poured 200 ml of KE12 silicon (Shin-etsukagaku Kogyo Co., Tokyo, Japan) into the bony nares and kept the heads in position for eight hours. KE12 silicon is relatively tough, polymerises 120 Mammal Study 23: 1998 at room temperature when mixed with one or more catalysts and solidifies after approximately eight hours at 25°C. The silicon is prevented from entering the air space between the external nares and the blowhole by the nasal plug muscle. This muscle originates chiefly on the premaxilla anterior to the premaxillary sac with a few fibers arising in the connective tissue band along the margin of the premaxilla lateral to the sac (Lawrence and Schevill 1956). Following solidification of the silicon, the heads were returned to their natural position with the blowhole pointing upwards in order to reconstruct the air space between the external nares and the blowhole. This was done by injecting 100 ml of silicon into the blowhole using a 200-ml plastic syringe with a surgical tube inserted 2-3 cm into the nasal passage. Air in the deep nasal sac was ejected by the pressure of the fluid silicon passing through the blow- hole. ‘This second injection of silicon was also allowed to harden for eight hours at room temperature. The hardened silicon was finally removed by dissecting the heads. Examination of the silicon cast of the nasal sacs of the common dolphin specimen (see Fig. 1) revealed that the left vestibular sac measured 3.5 cm along the anterior-posterior axis, and 2.9cm transversely, whereas the right ves- tibular sac measured 4.0cm by 3.5cm. The anterior nasofrontal sac was 4.0 cm long, and the posterior nasofrontal sac 3.8cmlong. Eight small diverticula were found between the anterior and posterior nasofrontal sacs. The right accessory sac was 2.2cm long. The premaxillary sacs were measured 6.3 cm by 2.5 cm (left), and 8.0 cm by 4.7 cm (right). Silicon was not injected into the left nasofrontal sac. The total volume of the nasal air space of this individual common dolphin was found to be 33.3 cm‘. Examination of the silicon cast of the nasal sacs of the Dall’s porpoise specimen (see Fig. 2) revealed that the left vestibular sac measured 4.5 cm along the anterior-posterior axis and 4.2 cm transversely, and that the right vestibular sac measured 7.5cm by 5.2cm. The left premaxillary sac measured 4.5cm along the anterior-posterior axis and 2.4cm transversely, whereas the right premaxillary sac measured 3.5cm by 2.3cm. Silicon was not injected into the nasofrontal sac or the posterior nasal sac. The volume of the nasal air space of this individual Dall’s porpoise was found to be 61.5cm*. The silicon injec- tion technique proved an effective way of examining the nasal air spaces in two different species of odontocetes, and revealed that the Dall’s porpoise has almost twice the volume of nasal air space, and larger vestibular sacs than the common dolphin. The results from two-dimensional computer modelling suggest that the source of echolocation signals may be the dorsal burse below the vestibular sacs (Aroyan et al. 1992). Furthermore, in order to understand why different toothed whale families produce sounds with different physical characteristics, detailed measurements of the air spaces in their heads are needed. Reconstruc- tion of the air spaces in the heads of odontocetes using silicon facilitates the detailed measurement of both the shape and volume of spaces such as the small Nakamura et al., Nasal sac of common dolphin Wl Left vestibular sac ht nee eontal sac == ramaxillary sac Fig. 1. Silicon reconstruction on the nasal sacs on a common dolphin skull. Skull width (Zygomatic width)=16.9cm. Skull length (Condylobasal length) = 41.3 cm. Right vestiluenikyle \Kaimuentibular sac Fig. 2. Silicon reconstruction on the nasal sacs on a Dall’s porpoise skull. Skull width (Zygomatic width)=18.6 cm. Skull length (Condylobasal length) =33.5 cm. 22 Mammal Study 23: 1998 nasofrontal diverticula, and this technique may prove valuable in studies of sound production. In recent years, new medical imaging techniques such as x-ray computed tomography (CT) and magnetic resonance imaging (MRI) have been used to describe the internal details of the foreheads of toothed whales (Cranford 1988, Amundin and Cranford 1990, Amundin 1991, Cranford ef al. 1996). Future research into the sound production mechanisms of odontocetes may benefit from incorporating both silicon reconstruction of nasal regions and CT and MRI medical imaging techniques along with three-dimensional com- puter modelling. Acknowledgments : We thank Dr Toshiro Kamiya of the Medical Section, The University Museum, The University of Tokyo, and Dr Yutaka Yoshida of the Medical Museum Medical Department, The University of Tokyo, for their advice and co-operation. We are obliged to Dr Masao Amano of the Otsuchi Marine Research Center, Ocean Research Institute, The University of Tokyo, and Ms Azusa Amano of the Department of Zoology, Faculty of Science, Kyoto University, for their kind help in acquiring the Dall’s porpoise head. Dr John R. Bower of the Division of Marine Ecology, Research Institute of North Pacific Fisheries, Hokkaido University, kindly reviewed the manuscript. REFERENCES Amundin, M.1991. Sound production in odontocetes with emphasis on The harbour porpoise Phocoena phocoena. Ph.D. dissertation, University of Stockholm, 128 pp. Amundin, M. and T. W. Cranford. 1990. Forehead anatomy of Phocoena phocoena and Cephalorhyn- chus commersoni : 3-dimensional computer reconstruction with emphasis on the nasal diver- ticula. Jn (Thomas, J. A. and R. A. Kastelein, eds.) Sensory Abilities of Cetaceans : Labora- tory and Field Evidence. pp. 1—18. Plenum Press, N. Y. Aroyan, J.L., T. W. Cranford, J. Kent, K.S. Norris. 1992. Computer modelling of acoustic beam formation in Delphinus delphis. J. Acoust. Soc. Am. 92, 5: 2539—2545. Awbrey, F. T., J.C. Norris, A. B. Hubbard, and W.E. Evans. 1979. The bioacoustics of the Dall’s porpoise-salmon net interaction. Hubbs Sea World Research Institute Technical Report, 79— 1,0) Cranford, T. W. 1988. The anatomy of acoustic structures in the spinner dolphin forehead as shown by x-ray computed tomography and computer graphics. Ju (Nachigall, P.E.and P. W.B. Moore, eds.) Animal Sonar: Processes and Performance. pp.67—77. Plenum Press, N.Y. Cranford, T. W., M. Amundin, and K.S. Norris. 1996. Functional morphology and homology in the odontocete nasal complex : Implications for sound generation. J. Morphology 228 : 223—285. Evans, W. E. 1973. Echolocation by marine delphinids and one species of fresh-water dolphin. J. Acoust. Soc. Am. 54, 1: 191—199. Hatakeyama, Y. and H. Soeda. 1990. Studies on echolocation of porpoises taken in salmon gillnet fisheries. Jn (J. A. Thomas and R. A. Kastelein,eds.) Sensory Abilities of Cetaceans: Labora- tory and Field Evidence. pp. 269—282. Plenum Press, N. Y. Kamminga, C., A.C. Stuart, and G. K. Silber. 1996. Investigations on cetacean sonar XI: Intrinsic comparison of the wave shapes of some members of the Phocoenidae family. Aquatic MEIC ZZ, je 4555. Lawrence, B., and Schevill, W. E. 1956. The functional anatomy of the delphinid nose. Bull. Mus. Comp) ZoolmiAal0 Se alea ile (accepted 26 May 1998) Mammal Study 23: 123-127 (1998) © the Mammalogical Society of Japan Short Communication Bark-stripping of tankan orange, Citrus tankan, by the roof rat, Rattus rattus, on Amami Oshima Island, southern Japan Tatsuo YABE Kanagawa Prefectural Public Health Laboratories, Asahi-ku, Yokohama, 241-0815, Japan MAX Ole At 0s= LUST In 1997, roof rats, Rattus rattus, damaged the bark of cultivated tankan orange, Citrus tankan Hayata, trees over a wide area of the central part of Amami Oshima, an island in the Nansei Shoto archipelago of southern Japan. ‘This was the first time that tankan farmers had experienced such damage in more than 30 years of cultivation of the fruit. At first, it was believed that the introduced mongoose, Herpestes sp., had damaged the trees, but later, from the appearance of the tooth marks on the trees, it was surmised that the rats were responsible. The damage which occurred from early April until early October 1997 was found in an area where other potential mammalian culprits such as R. norvegicus, Tokudaia osimensis and Diplothrix legata were known to be absent. Bark-stripping by FR. vattus has been reported elsewhere (e. g., Maeda 1982, 1985, Santini 1987), but has not previously involved the tankan orange, making the damage caused on Amami Oshima Island notable. In this paper the bark-stripping activity of the roof rat is described, and the data on their movements around a tankan orchard, their food habits and their age composi- tion are examined. STUDY AREA AND MOTHODS Amami Oshima Island is a 712 km? island situated at 28°10-30’ N, 129°10-45’ E (Fig.1). It is situated in the sub-tropical zone, and has a warm, humid climate with mean monthly temperatures ranging from a low of 14.2°C in January to a high of 28.4°C in July and an annual mean temperature of 21.3°C. Rainfall amounts to 2,871 mm a year. In mid-September 1997, I carried out a study in a tankan orchard where severe damage occurred (Fig.1). The orchard situated in the Naze City administrative district had a total area of about 1.2 ha, which was divided into several plots by woods composed of evergreens such as Castanopsis cuspidata, Symplocos spp., Melia azedarach and Pinus luchuensis. Rats were studied by trapping and tracking. They were captured in 29 live traps set for one night at 3-5m intervals along the edge of a wood that faced an orchard plot of about 400m’. They were tracked using fluorescent 124 Mammal Study 23: 1998 (y / Kyushu 325mg é a ( 23° KR ¥ 2 129° 130°E Fig. 1. Amami Oshima Island, showing the study site (asterisk) and the approximate area including Naze City, Yamato Village and Sumiyo Village, where bark-stripping by rats occurred (shaded). pigments following the method described by Lemen and Freeman (1985). Trapped rats were put into bags containing fluorescent pigments, gently shaken and released in the morning. During the following night, from circa 23: 00 onwards, their trails were detected with a 4W UV-lantern. Ninety snap traps were also set for one night at 3-5 m intervals along the same woodland/orchard boundary near where the live traps had been set. Snap traps were baited with sweet potatoes covered with peanut butter and honey. Specimens were dissected in the laboratory, and their stomachs were removed for closer examination under a stereoscopic microscope following the method by Yabe (1979). The volume that different food items contributed to each stomach’s contents (excluding bait) was estimated, and the mean volume of each food item was calculated for all stomachs examined. Rats were aged on the basis of their eye-lens weights using Tanikawa’s formula (Tanikawa 1993), and individuals three months of age or older were defined as adults. RESULTS AND DISCUSSION Bark-stripping by rats has previously been reported from both Europe and Yabe, Bark-stripping by roof rat 125 Southeast Asia. In Central Italy, the roof rat was considered to be responsible for heavy bark-stripping activity on Pittosporum tobira shrubs in urban parks (Santini 1987), although the reason for the activity remained uncertain. Maeda (1982, 1985) reported bark-stripping of ipil-ipil, Lewcaena leucocephala, trees by R. vattus mindanensis, although in my opinion the species was identified errone- ously given that the specimens collected had white tipped tails and weighed 250 -400 g, characteristics typical of R. everetti, not R. rattus. In Amami Oshima Island, I confirmed that the species de-barking tankan trees was the roof rat by finding their tooth marks on trees, their hairs in feces found below trees as well as by direct trapping. The rats stripped bark mainly from near the bases of the trunks of young trees less than five years old and from the branches of older trees. Most of the damaged trees were completely girdled (Fig.2A). The damage extended to all parts of the orchard surveyed, even to trees at the center, some 20 m from the nearest forest edge. Tracking of two rats dusted with fluorescent pigments revealed that they had moved about 15-20 m through the woods along the edge of the tankan orchard before turning into the orchard and attacking the tankan trees about 5-8m inside. The tankan orchard apparently provided the rats with little shelters because there were no ground cover, whereas the surrounding woods probably provided shelter, preferred runways, as well as foods such as acorns. A total of 21 rats (18 females and 3 males) were collected over 90 trap- nights around the tankan orchard. Seventeen of the 18 females were adult, but Fig. 2. Bark-stripping of tankan orange, Citrus tankan, trees (A), and tooth marks on the inside of fallen bark chips (B). 126 Mammal Study 23: 1998 Table 1. Age composition of roof rats trapped around a tankan orchard. No. of individuals Ee auever gly Males Females Total 2 0 1 1 3 0 0 0 4 0 2 Z 5 0) 1 if 6 1 0) 1 7 0) 4 4 8 if 3 4 9 0 3 3 10 0) 0 0 11 0 1 1 S17 I 3 4 Total 8 18 val none were pregnant. The majority of individuals (52%, 11 of 21) were 7-9 months old (see Table 1) indicating that a major breeding season had lasted from December 1996 to February 1997. S. Hattori (pers.comm.) was of the opinion that the roof rat population had exploded during the previous winter owing to a heavy crop of acorns. Tankan phloem, which was identified by the characteristic sieve areas of the tissue, was found in two (11%) out of 18 stomachs examined, however, no trace of outer bark was found in those stomachs. Tooth marks left on the inside of the bark chips clearly indicated that rats chewed the phloem contained in the bark chips as well as on the tree surface (Fig. 2B). The fact that rat feces were filled with phloem fibers indicated that they digested phloem incom- pletely, and presumably absorbed only the sap. Seeds and fruits accounted for 30.1% of the stomach contents in volume, and phloem accounted for 8.9% (Fig. 3): Seeds and Fruits 30.1 % and Stalks 9.7 % Unknown 7.2 °, Tankan Phioem 89 ‘%% Fig. 3. The stomach contents of roof rats in Amami Oshima Island. Yabe, Bark-stripping by roof rat Mail The preferred diet of the roof rat has been shown to consist of seeds and fruits in general (Yabe 1979), although it will switch to more succulent foods such as herb stems in order to obtain moisture (Yabe 1982). Stomach analysis of specimens trapped during this study confirmed that seeds and fruits were primary food source of the roof rats, and showed that phloem was at most a supplementary, not a substitute food source. I conclude that roof rats stripped the bark of the tankan orange trees to obtain the sap in the phloem. The reason for this activity remains uncertain, though they may have involved accessing extra moisture and/or extra nutrients. Acknowledgments : | am indebted to members of the Kagoshima Prefectural Government, the Naze Municipal Government, and the Yamato Village Munici- pal Government for their kind help during the field work. REFERENCES Lemen, C. A. and P. W. Freeman. 1985. Tracking mammals with fluorescent pigments: a new tech- nique. J. Mammal. 66: 134—136. Maeda, M. 1982. Tree damage by the roof rat (Rattus vattus mindanensis) in the northern area of Mindanao. Monthly Bull. Overseas Agric. Dev. News 82: 15—27 (in Japanese). Maeda, M. 1985. Rat control in an ipil-ipil plantation in Mindanao, the Philippines. Monthly Bull. Overseas Agric. Dev. News 107: 12—17 (in Japanese). Santini, L. A. 1987. Rodent debarking activity in urban and natural parks of central Italy : progress towards integrated control strategies. Ju (Richards , C.G.J and T. Y. Ku, eds.) Control of Mammal Pests. pp.55—64. Taylor & Francis, London. Tanikawa, T. 1993. An eye lens weight curve for determining age in black rats, Rattus rattus. J. Mammal. Soc. Japan 18: 49—51. Yabe, T. 1979. The relation of food habits to the ecological distributions of the Norway rat (Rattus norvegicus) and the roof rat (RF. vattus). Jpn. J. Ecol. 29: 235—244. Yabe, T. 1982. Habitats and habits of the roof rat Rattus rattus on Torishima, the Izu Islands. J. Mammal. Soc. Japan 9 : 20—24. (accepted 10 August 1998) A hi Be sy . ) is at MD ast 7 ae OF Pas erg = - a - n - pn fa _ Y as } 5 oe noe v —— a 5 4 ‘ — =) 5 e 4 oes f5 § ay Ba D) my Do = x Sey ~ $y ee 1 ie . 3 2 i ) ; Z eh; 4 > ] ie r i i v > p= \ 4 co) J e Ai sad Menttiaciiah “pitt % i ' in 3 ata? en. & . were Haye : inion hi. 1s ryaeate) E aah geiko dee doula nil one a. i wee oe ) incu apallt vette ¢ welt Bets, ‘ f | niieee tei ne eee OW bisa fly sian gee Ye piece ain J hem tita ion ni hae i foal ” t coe Ba bar pens i a, Fay ahi viawig 7 ‘4. tees ZA 2 sf ng ay. i ne \; eiehe ' Gain drat it My Olea rie dative dase, onntacen < Be tives NGC HLT MIT? Vt (Be atc =i Ois wR a watt shgé posucs hit har pence wiitete nahi ts orn eae ny Oates aan acs Lh Et aie oe Mr 18g sie rae a at vive a os | = £ > ". rire lanai: } ie 6 ‘ahretts Ais) Ny ; ty pe y SNS Ls NOUR ERB way wd S61 belie seni 2 ic evita . nea AN u > jee : yi ey ies i 4 bs i ete a ‘aa iar alk es ey ee aes | LEP ees oa Bay iW wees oi oe te hte Tae (ay eae cies . i + AS ae Ant age ae e , ne \ ae ¢ Vs Pony | Bt a ; ah ane ior. « Aod of oy ee fe: sli. 3 ie, a 4 1 * 4 ( - rite E , “454.2 aA { ie 7 eat 5d | 5 Rat TEL TG 2 Ly USI. ewes k Ps i / pe i ns : Uae ; a ” ‘f } : ~ ~ c 4 my — (ere ; a s 1 I ( er Lies = ia (Wien l j “het F e i tanh Faby with Vi) ee rig Fi aie ee % y NK ’ hits ~ ls ae ay { rs i sd 4 i ) ~ 5 iy AuPty i 5 Tiss ~ =A oad a, — 7 s eal . = =, ia os 7 . > } ‘ ¥ i ne SY z uf aes ¥ Ye ‘<_ oe Nr ee Ke j f, ; ~ a 3 > % Ss % i : . ee ; i. i 5 ~ = =ae ec F ‘ ho y i fe 62 } ne a \ 4 7 s ‘ s a - n . f i = 4 j 5 No ¢ A J — < “ly 4% ” j . a BS ee s ’ < See i 4 a ; - (les ul 3 Fa ~ x ic i) t a Mammal Study 23: 129-132 (1998) © the Mammalogical Society of Japan Short Communication The structure of the pawpad lamellae of four Rattus species Tatsuo YABE', Puangtong BOONSONG? and Sermsakdi HONGNARK*’ 1 Kanagawa Prefectural Public Health Laboratories, Asahi-ku, Yokohama 241-0815, Japan Dake wols45=309 1037 2 Entomology and Zoology Division, Department of Agriculture, P.O. Box 9-34, Bangkok 10900, Thailand The structure and function of the pawpad lamellae of Rattus species relate directly to their behavior (Brooks and Rowe 1987). Thus the pawpads of climbing species such as the roof rat, R. vattus, have evolved numerous lamellae to provide better gripping and clinging power, whereas digging species such as the Norway rat, R. norvegicus, have smooth pawpads. Pawpads have only been described previously, however, as either finely lamellated or nearly smooth (Musser 1973, Marshall 1977, Corbet and Hill 1992), and no detailed studies of the structure of the lamellae have been carried out. In this paper, we describe the histological features of the lamellae and relate them to the differ- ing behaviors of two climbing Rattus species (R. vattus and the Polynesian rat, Rk. exulans) and two digging species (the ricefield rat, R. avgentiventer and R. norvegicus). MATERIALS AND METHODS Specimens of FR. vattus and R. norvegicus from Japan, and of R. exulans and R. argentiventer from Indonesia and Thailand were used in this study. The majority of these specimens were laboratory reared in Miyazaki Medical College and Ikari Corporation with the remainder killed just after capture in fields or buildings. The largest pawpads were those of the outer metatarsals so these were removed for lamellar analysis. Pawpads were surgically excised, fixed in 10% formalin, washed in tap water and dehydrated in a graded series of ethanol. Specimens were then immersed in isoamy] acetate and dried with liquid CO, in a critical point dryer. They were mounted on a scanning peg using a piece of conductive tape coated to 30 nm with gold-palladium in a DC sputtering appara- tus, and observed at 10kV in a JSM 5400LV scanning electron microscope (SEM). Microscopic photographs were taken at a magnification of 100. Histological preparations were made from pads fixed in 10% formalin. The fixed pads were removed from the hind feet and embedded in paraffin using standard histological procedures. The pads were cut into serial sections 130 Mammal Study 23: 1998 vertical to the lamellae at 8-10 um intervals and stained with hematoxylin- eosin. One serial section from the middle part of the pad was selected for detailed examination and measurements. The height and width of the lamel- lae were measured with an ocular micrometer. The image was then projected onto a screen and the angle of the lamellae was measured with a protractor. The maximum height of the stratum corneum was defined as Ch, the maximum width of lamellae as Lw, and the average angle of 10 pits on corneous, lucid or granular layers as @ in radians (Fig. 1). Because the pits on the corneous layer were often split, those on the lucid or granular layers were more suitable for measuring angles from. The lamellae on the front of the pawpads were excluded from these measurements because they often had irregular pit angles, width and height. Values of Ch, Lw and 6 from 10 specimens were averaged for each species. Statistical analyses of these values were made by using the Kruskal-Wallis analysis of variance of ranks followed by the Tukey test. RESULTS AND DISCUSSION Among mammals, the pattern of the peculiar outer surface of the corneous layer is generally affected by the lower epidermal layers and the dermis (So- kolov 1982). The four species of Rattus also have lamellae consisting of a Superior corneous layer (stratum corneum) parallel to the underlying lucid (stratum lucidum) and the granular (stratum granulosum) layers (Fig. 1). Pit angles from the lucid or granular layers could therefore be substituted for those from the corneous layer. Keratin plates of the corneous layer were found to be arranged in columns as was suggested by Sokolov (1982), and each lamella was distinguishable in the columns. Both histological sections and SEM photographs showed that whereas RK. vattus and R. exulans had extemely-developed lamellae, R. avgentiventer had moderately-developed lamellae and R. norvegicus had only poorly-developed lamellae (Figs. 1 and 2, Table 1). The Kruskal-Wallis analysis of the four species revealed significant differences among them in Ch (d.f.=3, corrected H =11.0, corrected p<0.05), Lw (ad.f.=3, corrected H =18.5, corrected p<0.01), and 6 (d.f.=3, corrected H =31.6, corrected p<0.01). The Tukey tests showed that FR. vattus had significantly greater Ch’s than the three other species (Studentized range Q=3.80, d.f.=36, number of treatments a@=4, p=0.05, significant difference D=81.4), while R. norvegicus had significantly greater Lw’s than those of the other species (Q=3.80, d.f. = 36, a=4, p=0.05, D =30.5). The mean pit angles (@) were in the order: R. vattus=R. exulans> R. ar- gentiventer > R. norvegicus (Q=3.80, d.f.=36, a=4, p=—0.05, D=0.32), which confirmed the observations made with the SEM. Musser (1973) had noted that the pawpads of digging Rattus species were flush, whereas those of good climbers such as FR. vattus protruded from the sole. This study has confirmed that the prominent pawpads of R. vattus are due to the thick corneous layer. It appears therefore that among Rattus spp. good climbers have prominent pawpads or a thick corneous layer as well as finely 131 Structure of pawpad lamellae (100) of (A) Rattus rattus, (B) R. exulans, (C) R. Yabe et al., Rattus pawpad lamellae Fig. 1. cus, showing measurements taken. . norvegicus argentiventer and (D) R The scale indicates 100 height of stratum lucidum, Ch angle of pit on lucid or granular layers. stratum corneum, SG: stratum granulosum, SL: SC corneous layer, Lw yum. dth of lamella, @ wi The scale indicates 100 um. SEM photographs (x 100) of pawpad lamellae of (A) Rattus vattus, (B) R. exulans, (C) . norvegicus. R. argentiventer and (D) R Fig. 2. 32 Mammal Study 23: 1998 Table 1. Maximum height of corneous layer (Ch), maximum width of lamellae (Lw), and average pit angle between lamellae (6) of the pawpads of four Rattus species. (laae SID) Lw+SD Dae So, Species ue (um) (um) (radian) R. rattus 10 S03 26 13" Sifae ZI I OGae0). 17 R. exulans 10 200 +67 ABE Zl 1.08+0.16 R. argentiventer 10 20345 1534 20 Ee sae). 35° R. norvegicus 10 216 == 69 IS az 32" Za Oo== OMe * Significantly larger than the others except “b” in the same column; ° significantly larger than “a” (Tukey test, =0.05). lamellated pawpads. These finely lamellated pawpads have steep lamellar pits and narrow lamellae: the steeper the lamellar pits and the narrower the lamellae, the more grip they provide for clinging or climbing. In conclusion, our examination of the histological features of Rattus pawpad lamellae has shown that they differ in structure corresponding with the behavior of the species. The pawpads of digging species such as Rk. norvegicus are characterized by a thin corneous layer, shallow lamellar pits and broad lamellae. In contrast, the pawpads of climbing species such as R. vattus are characterized by a thick corneous layer, steep lamellar pits and narrow lamel- lae. Acknowledgments : We are particularly grateful to: Dr Kimiyuki Tsuchiya of Miyazaki Medical College, Mr Mongkol Chenchittikul of the Department of Medical Sciences of Thailand, Ms Piyanee Nookarn of the Department of Agriculture of Thailand and Dr Tsutomu Tanikawa of the Ikari Corporation for supplying us with rodent specimens, Mr Shin-ichi Ishiwata of Kanagawa Environmental Research Center for helping us with the operation of the SEM. REFERENCES Brooks, J.E.and F. P. Rowe. 1987. Commensal Rodent Control. World Health Organization, Vector Biology Control Division, Geneva, 107 pp. Corbet, G. B. and J. E. Hill. 1992. The Mammals of the Indomalayan Region: A Systematic Review. Natural History Museum Publications, Oxford University Press, Oxford, 488 pp. Marshall, J. T., Jr. 1977. Family Muridae. Jn (Lekagul, B. and J. A. McNeely, eds.) Mammals of Thailand. pp.397—487. Association for the Conservation of Wildlife, Bangkok. Musser, G.G.1973. Zoogeographical significance of the ricefield rat, Rattus argentiventer, on Celebes and New Guinea and the identity of Rattus pesticulus. Amer. Mus. Novitates 2511: 1— 30. Sokolov, V. E. 1982. Mammal Skin. University of California Press, Berkeley, 695 pp. (accepted 3 September 1998) Mammal Study 23 © the Mammalogical Society of Japan 133 Editor’s Acknowledgments The current editorial board has been responsible for editing Mammal Study volumes 21-23. I, and the other members of the board, would like to thank those people listed below who have reviewed manuscripts between January 1996 and December 1998. Special thanks are due to Dr Mark Brazil who has contributed enthusiastically by improving the readability of the journal. We also appreciate the efforts of Mr Yukihiko Hashimoto, the editorial secretary, who assisted with various aspects of editing. Seiki Takatsuki, Editor in Chief Abe, Hisashi Agetsuma, Naoki Akamatsu, Tomonari Amano, Masao Ando, Akiro Doi, Teruo Endo, Hideki Funakoshi, Kimitake Ikeda, Hiroshi Ishii, Nobuo Iwasaki, Shinichi Kaji, Koichi Kaneko, Yukibumi Kawamichi, Takeo Kawamichi, Mieko Kawamoto, Yoshi Kasuya, Toshio Kimura, Tadanao Kishimoto, Mayumi Kita, Isao Kitahara, Eiji Koizumi, Toru Kurohmaru, Masamichi Koganezawa, Masaaki Maeda, Kishio Masuda, Ryuichi Matsumura, Sumiko Manabe, Noboru Maruhashi, Tamaki Minami, Masato Miura, Shingo Miyazaki, Nobuyuki Murakami, Okimasa Mori, Takanori Nagata, Junko Obara, Yoshitaka Ohdachi, Satoshi Oishi, Takao Sagara, Naohiko Saito, Takashi Sekijima, Tsuneo Shioya, Katsunori Shimada, Takuya Shiraishi, Satoshi Suzuki, Hitoshi Suzuki, Masatsugu Takada, Yasushi Takatsuki, Seiki Tamate, Hidetoshi Tatsuszawa, Shirow Tsubota, Toshio Tsukada, Hideharu Yamada, Fumio Yokohata, Yasushi Yoshiyuki, Mizuko Wada, Kazuo 134 Index Mammal Study 23: 1998 This index covers Mammal Study Vol. 21 (1996) to Vol. 23 (1998). Subject Abe, H. acetylcholinesterase acquisition 22, 1 23, 85 22, 71 age at sexual maturity 23, 19 age determination age estimation age variation Amami Oshima Aneurolepidium chinense Apodemus Apodemus agrarius Apodemus argenteus Apodemus speciosus Arvicola Arvicola sikimensis Arvicolidae Asahikawa automatic collar release system bark-stripping begging behavior Boso Peninsula bottle neck breeding season brown bear cardiac musculature cardiac myocyte Cervus nippon Cheju Island Chiba China Citrus tankan Clethrionomys 22, 49 22, 39 21,1 23, 123 23, 63 22, 27 21,125 22, 21, 23, 19 21,59, 22, 27 21, 161 21, 161 21, 89 22, 27 23, 109 23, 123 74) es 74) DS) 23, 99 23, 19 23, 41 21, 37 21, 37 alls Alle Ideas 23, 95, 103 ZAG ZS 2M, 1935235190 21, 89, 23, 63 Za wkZ3 22, 27 Clethrionomys glareolus21, 1 montanus VCX 21,15 21, 15 rufocanus rutilus —— sikotanensis coexistence conception date condylobasal length Daikoku Islet Delphinus delphis den digastric muscle distribution dolphin, common dynamic interaction enamel pattern Eothenomys Eothenomys andersont ——= = Chimensts =a GUSUOS ae UD == OZ == _ OaOw ———= | VOONIOW —— vegulus —— shanseius —— smithii ——— a0 ane DVOGHON ermine error estimation eye lens fecal analysis ferret fiber types field test PATRAS JUS; 22, 95 27 21, 15, ZOLA Geoe 21, 15 22, 11 Zl, Loe 21,1 21,15 23, 119 23, 31 23, | 21, 89 23, 119 21,27 21,1 22,9 21,1 21, 1,89 21, 1,39 21,1 21, 1 21, 89 Zileul alle Ike IS 21,1 21, 1, 22, 45 2M A389 21, 89 21, 37 23, 41 22, 39 23, 49 alle Sil 23, 9 23, 41 index flying squirrel Japense giant 22,81, 23, 79 food begging behavior 22, 71 food habits foraging behavior forest structure forestry gait analysis geographic variation Geoje Island golden hamster Gompertz equation Goto Archipelago growth curve habitat factor habitat preference habitat selection haplotype heterozygosity histochemistry Hokkaido home range Honshu identification Inner Mongolia insectivorous bat interference competition Japan Jindo Island joint angle Kanto kinematic gait analysis Korea Kyushu 21, 137, 23,9, 49 21,137 22, 21 22, 27 21, 43 21,71 7) Mey ZS) 235 9 22,09 alls ail 22,93 21,71 21,27 23, 31 21,15 235 99 2359 Zales MSs OD5 JOS AAS (Ale 23, dl, 41, 95 21, 27, 23, 109 21,71 21, 89 23, 63 23, 49 225 Ul alls WSs Allg MS 22, 11, 71 23, 31, 41 21,125 21, 43 2559 21, 43 21,15 21, 71, 23, 49 laboratory mouse laboratory rat limitation of reproduction locomotion longevity Malayan pangolin mammal mandible Manis javanica masseter muscle masticatory muscle Mesocricetus auratus microsatellite DNA Microtinae Microtus Microtus montebelli —— pennsylvanicus —— sikimensis Miniopterus fuliginosus mink, American mitochondrial DNA Mogera Mogera imaizumit =a MEMON ——— OMe ——— WOeia molar mole, Japanese Mongolia Mongolian gazelle morphological variation 21, 43 23, | 23, | 23, 1, 85 23, 1,9 235 9 22, 9, 2a, 99 22, 45 22,9 21,59 ey D3) O's 23, 9, 89 21,1 21, 161 23, 49 21,37 21,15, 125 ali (Lg UMS: 2M, lS ZS 21, 71 Jal (les SUS) 21, 1 Zale (ks ILD 23, 63 23, 63 21, 89 mouse, Japanese field 23, 19 mouse, Japanese wood 21, 59 mouse, striped field Mt. Goyo mtDNA murids Mus musculus Musculi digastricus Se NOSSO —— mylohyoideus 21, 125 23, 105 ZS M5 ZS) 23,9 2359 23, | 23, | 23, | 136 —— temporalis Mustela Myotis macrodactylus = ONC AD Nara Nara River nasal sac Nemuro Peninsula Neodon sikimensis neuromuscular junction niche shift Nozaki Island Nyctereutes procyonotdes optic lens orange, tankan Oshima pangolin pawpad lamillae PCR primer Petaurista leucogenys Phocoenoides dalli Pitymys stkimensis polymorphism population density porpoise, Dall’s 235 | 21, 37 23, 49 23, 49 23, 19 ZN DS) 23, 119 23, 31 21, 161 23, 89 22, 11 21, 27 23, 109 22, 45 23, 123 23, 41 23, 1 23, 129 22,9 22, 81, 23, 79 23, 119 21, 161 Zl M5 WAS) 23, 19 23, 119 postnatal development 22, 53, 23, 85 prey selection Procapra gutturosa provisions pulmonary vein raccoon dog radio-tracking radiotelemetry ANE, SOO Rattus argentiventer exulans eerame LOMUCOICUS rattus rDNA red fox 23, 49 23, 63 21, 137 21, 37 23, 109 ‘all 23, 41 23, 123 23, 129 23, 129 23, 9, 129 23, 123, 129 21,15 Falls Mog 25 (lls 23, 31 Mammal Study 23: 1998 reproduction resource partitioning restoration Rhinolophus cornutus Serrumequinnum ribosomal DNA Rishiri Island Russia scrotum sexual dimorphism sexual maturity Shikoku Sacansian. S. Shiretoko shrew Sichuan sika deer Sikkim silicon reconstruction Sorex caecutiens gracillimus ram LL UCUALUS South Korea spatial segregation species diversity Stipa surface activity Sympatric Szechwan Talpidae taxonomic revision taxonomy telemetry system temperature temporal muscle testis trace recorder triangle test twin twinning rate 23, 19 23, 49 21, 43 23, 49 JANE VB, WZ) 21, 15 23, 63 22, 81 22, 93 225 Olly Zag 21,71 22, 1 2A, 37522571, 23, 41 21, 65, 22, 11 21, 89 ZAG, Naas 235 99, 105 21, 161 23, 119 21, 65 21, 65 21, 65 21,125 21,59 22, 21 23, 63 Taj Mh 23, 49 21, 89 21,115 21,115 21, 89 23, 109 23, 19 23, 1 22, 81, 23, 79 23, 109 23, 41 23, 105 23, 105 index ultrasonic vocalization 22, 53 ultrastructure 23, 85 undergroud activity 22,11 Ursus arctos 23, 41 vole, gray-sided Zon , Japanese field 21, 59, 22, 53, DIB (OD mma LOLLMerml red-backed ARS) ——, red-backed MAL 55 22> AS Sy cean 21, 161 aE outils red- backed 22545 Vulpes vulpes 7) bs SUBS es Paras, (Nl Zaonl wildlife conservation 23,63 Yunnan 21, 89 Ladi 138 Author Abe, H. Abe, S. Agungriyono, S. Ando, A. Ando, K. Asada, M. Asakawa, M. Atoda, O. Boonsong, P. Chancardr a: Don, 1. Endo, A. Endo, H. Cao, ZG llann, S, Jal Hayashi, Y. lala, Se. IOmenmnaigkens: Inuzuka, N. Ishibashi, Y. Jiang, Z.W. Jibay, IK, Kay, IK, ISBITEKO, SC Kanzaki, N. Kanvanoiclon di: Kurohmaru, M. Milzun©, IP, Maruyama, N. Masudameke lore, IC. Motokawa, M. Nititealkcanaaied Nadee, N. Nacaitanule Nakamura, K. Nakatar ke Nakatsu, A. Nishiumi, I. Nonaka, N. Ochiai, K. Nabhitabhaita: J Al ea 7A) ALES) 22,9 23, 1 22, 49 23, 89 21, 153, 23, 95 ZA 23, 113 ZadyZ9 23, 1 21, 27 “alle Ad 74) ky Sig rag Il 23, 63 7a) ey Je J) 21,27 ZV 25 23, 129 21, 43 22,9 23, 63 23, 63 23, 99 Zale Mh Sl OIL aps MALS 23, 13 23, 79 21, 27, 23, 1 23, 41 “ape WLS) 23, 95 23, 9, 2, 89 21, 115 23, 41 23, L Za, 23, 95 23, 119 74) Ve MGi5 72055, JUS) 22, 27 23, 1 ZAMS) ZAG MS 5 73%) 9D Ohdachi, S. Ohno, W. Saucon, I, Sakaizumi, M. Salone ke Shimazaki, K. SJaregisian. S: Smeenk, C. Sugasawa, K. Suzulay Ee Suulletdle: Rakalnashiahke akatsuki S: Tomisawa, M. suclanyay 1 Tsukada, H. Uraguchi, K. Urayamia, ke NWialxainiay oS: Yale, a: VWannadae Vamadary wake Yamagiwa, D. Voshidam Wier: Yoshinaga, Y. Mammal Study 23 21, 65, 22, 11 22, 99 Jay Dt 21,15 22, 39 2a, 119 225 49; 09 21, 161 23, 9, 89 2A las lias 23, 113 22, 39, 235 31 2998 22, 1, 23, 63, 105 Mass IS alle N55 ZS Zale 23, 31 21, 59 PME MS, UZS 28, 123, 129 2a, | 23, 119 21, 27 22, D5 205 90 22, 93 INSTRUCTIONS TO CONTRIBUTORS The Mammal Study (the continuation of the Journal of the Mammalogical Society of Japan) publishes original Articles and Short Communications, written in English, on all aspects of mammalogy. In principle, membership of the Society is a prerequisite for the submission of papers, but non-members may be co-authors. Manuscripts are submitted to qualified referees for critical scientific reviewing. Authors are notified, with referees’ comments, on acceptance, rejection or need for revision. The editor also customarily sends manuscripts to qualified reviewers for English editing. Manuscripts should be submitted typewritten on one side of the paper (use A4 21.0 cm X 29.7 cm paper), and double-spaced. An approximately 3 cm margin should be left on all sides. Do not hyphenate words at the right margin. Manu- scripts should be arranged in the following order: the title, name(s) of author(s) and affiliation, fax number and E-mail number if available, abstract (fewer than 200 words) and key words (five words or fewer), main text, acknowledgments, references, tables, figure legends, figures. Titles of papers must be accurate and concise, and (for abstraction services) include any relevant taxonomic name. A Japanese title and a Japanese abstract should be written on separate sheets. Text pages should be numbered through from title to references. Manuscripts should be line-numbered, every five lines, in the left margin. Short Communications do not exceed four printed pages. Abstracts and key words are omitted from Short communications. Tables and figures should be simple and self-explanatory, and their preferred locations should be indicated in the right margin of the text. The ratio of tables and figures to text pages cannot exceed 1:2 and they should be as few as possible. The author’s name and figure numbers should be written on the back of original figures and on the surface of copies. Scientific names should be underlined. All measurements should be in metric units. The following abbreviations should be used. Length: km, m, cm, mm, etc. ; area: km’, m’, etc.; volume: km’, m’, kl, 1, ml, etc.; weight: kg, g, mg, etc. ; time: hr, min, sec, etc.; others: cal, kcal, C, Hz, p (probability), SD, SE, etc. Arabic numerals should be used for numbers exceeding 10. References in the text should follow the forms: “Uchida and Shiraishi (1985) stated that ...” (Abe and Kawamichi 1990), and (Miura et al. 1993). More than one reference within the same parentheses should be listed chronologically, alphabeti- cally if of the same year. Full references cited must be listed alphabetically by the first author according to the following examples: Abe, H., S. Shiraishi and S. Arai. 1991. A new mole from Uotsuri-jima, the Ryukyu Islands. J. Mamm. Soc. Japan 15: 47—60. Eisenberg, J. F. 1981. The Mammalian Radiations. Univ. of Chicago Press, Chicago, 610 pp. Geist, V. 1982. Adaptive behavioral strategies. Jn (J.W. Thomas and D.E. Toweill, eds.) Elk of North America. pp. 219—277. Stackpole, Harrisburg. Obara, Y. 1991. Karyosystematics of the mustelid carnivores of Japan. Honyurui Kagaku [Mammalian Science] 30: 197—220 (in Japanese with English abstract). Authors are recommended to refer to recent issues of the journal for details of style and layout. Manuscripts should be submitted in triplicate, with a separate sheet giving the title, author(s) name(s) and address(es) for editorial correspondence, a running head (fewer than 20 letters), the numbers of main text pages, tables and figures, and the number of copies of reprints requested. Galley proofs will be sent to the author. Reprints may be purchased in blocks of 50. Mammal Study Vol. 23, No. 2 December 1998 CONTENTS ORIGINAL PAPERS : | i: | Sugasawa, K., K. Ando- and T. Mori: Postnatal development of the neuromus- cular junction of the masseter muscles in the Japanese field vole, Microtus — LOG | vette 5 Nagataz’ Je. R Masuda, Ke Kaji ok Ochiai, M. Adal and M. C. Yoshidae™ Microsatellite DNA variations of the sika deer, Cervus nippon, in Hokkaido isaM and Chiba ie laierels/e/oj clea eselerevelalanelejeveterel ciciie elec alevefeteleloralsistetererctel stele varetererererclolstereisiercteieielotereteklenteterieteients ja) sis \o\'se loforerehetotatetenene 95 . Takatsuki, S: The twinning rate of sika deer, Cervus nippon, on Mt. pee? aa northern Japan 5S DOC COOOD ODD DO CED DCO bo DODD DDD OO DONO ODODDUDD DODO ONEODONONGS. -oonbooes5 ooo00ddcoonGCC0sS -103 Kaneko, Y., T. Suzuki, N. Maruyama, O. Atoda, N. Kanzaki and M. Tomisawa : | The “Trace Recorder”, a new device for surveying mammal home ranges, and its application to raccoon dog research eect cle cece cece cece e sce nsseereas we ccecce seers 19 ; _ SHORT COMMUNICATIONS Nakamura, K., T. K. Yamada and K. Shimazaki: Measurements of the nasal sacs . of individual common dolphin, Delphinus delphis, and Dall’s porpoise, f Phocoenoides dalli, by means of silicon reconstruction veseedeesauedeeceensnesensum 119 Yabe, T: Bark-stripping of tankan orange, Citrus tankan, by the roof rat, Rattus rattus , in Amami Oshima Island, southern Japan chenetecees Levens 3 le Gti tia ia ieee Yabe, -T., P. Boonsong and S. Hongnark: The structure of the pawpad lamellae of four Rattus species alolielel s\iollelele/e/e|ejele) +, alelelele eles 0.9 for each comparison). In contrast, body weights increased rapidly during November and December (68.4+4.7 kg, n=5), and December body weights were significantly heavier than in November (P< 0.05). Table 1. Body weight and the rate of weight increase (7,,) of seven captive female Japanese black bears. May Jun. Jul. Aug. Sept. Oct. Nov. Dec. Average (kg)* 46.23 50.42» S332 57/3 S732 58.8° 59.4¢ 68.44 SD 4.4 4.2 3.6 3.5 3355) 3.8 4.3 4.7 ime (ei a 9.2 5.8 Tes =(0)5) DI) 0.9 15 eZ i» = Phase I Sf = Phase II = <— Phase III — y * Values in the same row followed by different letters are significantly different (P<0.05). mean body weight — mean body weight of last month mean body weight of last month ** Rate of Weight Increase = x 100 4 Mammal Study 24 (1999) Discussion The body weights of seven captive female Japanese black bears increased gradually dur- ing spring (Phase I), were stable during summer (Phase II) and increased rapidly in autumn (Phase III). These changes were presumed to be related to annual changes in growth and to seasonal changes in nutritional conditions. Because the body weights of the bears did not differ between years, they were assumed to have been old enough to cease growing. We conclude, therefore, that the weight changes of the bears examined were seasonal. Seasonal changes in the nutritional conditions of animals are closely related to their physiology. Nelson et al. (1983) defined four seasonal physiological stages in American black bears and grizzly bears, U. arctos: hibernation, walking hibernation, normal activity and hyperphagia. In our study of the Japanese black bears, we have shown that body weights change during the stages of normal activity and hyperphagia. Phases I and II appear to correspond to Nelson et al.’s (1983) stage of normal activity, and our Phase III to their hyperphagia stage. The fact that the normal activity stage may be divided into two phases was first recognized in the present study. Further study is required to elucidate the physio- logical mechanisms separating Phases I and II. : It is impossible to undertake the same kind of continuous study of the nutritional conditions of wild bears as can be done in captivity. Nevertheless, some data on seasonal changes in nutritional conditions of wild Japanese black bears from the post denning period to the active period have been collected (Hazumi et al. 1985; Gifu Prefecture 1995). These data, though not presented statistically, showed that nutritional condition as measured by levels of marrow fat (Hazumi et al. 1985) and of kidney fat (Gifu Prefecture 1995) declined from the post denning period (April to June) to the active period (July to September). These results were opposite to those of the present study that revealed a gradual increase in the body weights from May to August. Also in contrast to our study are the results of Hellgren et al. (1989) who found that in Virginia and North Carolina where environmental conditions such as day length, temperature and vegetation are similar to those in Japan, the body weights of wild American black bears decreased from early summer (mid June to July) to late summer (August to September). In the wild, poor nutritional condition may result from food shortages from early to late summer, whereas the body weights of captive bears increase because of the availability of sufficient food and because of their lower energy expenditure during this season. During the pre-denning period, the nutritional condition of wild Japanese black bears seems to improve (Gifu Prefecture 1995). In this study, body weight increased rapidly during Phase III. During the period of hyperphagia, the American black bears increase both their food intake (Nelson et al. 1983) and digestion (Brody and Pelton 1988), both of which are thought to be adaptive for storing energy prior to denning. In our study, both factors might have contributed to the increases in body weight. Although body weights tended to increase during a single year (Fig. 1), when the same months were compared between different years, they did not differ. This indicates that body weight decreases during winter. Body weight loss during hibernation has been reported for captive American black bears (Watts et al. 1981; Watts and Cuyler 1988; Farley and Robbins 1995). Thus, it is probable that captive adult female bears lose weights during winter, and it is plausible that bears repeat an annual cycle characterized by spring recovery, autumn Hashimoto and Yasutake, Body weight of Asiatic black bears 5 increase and winter weight loss while denning. Two methodological issues have been raised by this study, which require further study. Firstly, in order to obtain weight data, we immobilized the bears. This is, however, not good for their health, and it is also costly. In future, therefore, it is recommended that a method not requiring immobilization be used. Secondly, as we did not measure the amount of food, we were unable to relate food availability to changes in body weight. Studies under controlled conditions are needed for a better understanding of the food-body weight rela- tionship in the Asiatic back bear. Acknowledgements: We thank M. Suzuki, Y. Uozumi and S. Takahashi for helping with preparations and measurements, and H. Igota, K. Naganawa, S. Seki, Y. Suzuki and K. Yamamoto for helping handle bears. We thank Professors T. Tsubota of Gifu University and T. Komatsu of the Institute of Japanese Black Bear in Ani, Japan, who gave much useful advice, and we also thank Associate Professor S. Takatsuki of Tokyo University for kindly reading and giving comments on an early draft of the manuscript. This work was partly supported by Ani Town and the Sasakawa Scientific Research Grant from the Japan Science Society. References Brody, A. J. and Pelton, M. R. 1988. Seasonal change in digestion in black bears. Canadian Journal of Zoology 66: 1482-1484. Farley, S. D. and Robbins, C. T. 1995. Lactation, hibernation, and mass dynamics of American black bears and grizzly bears. Canadian Journal of Zoology 73: 2216-2222. Gifu Prefecture. 1995. Research report on population index of Japanese black bears. Gifu. 35 pp. (in Japanese). Hashimoto, Y. and Takatsuki, S. 1997. Food habits of Japanese black bears: A review. Honyurui Kagaku (Mam- malian Science) 37: 1-19 (in Japanese with English abstract). Hazumi, T., Maruyama, N., Mizuno, A., Torii, H. and Maita, K. 1985. Nutrient examination of Japanese black bear. In (Environmental Agency, ed.) A Report on the Change of Forest and Large Mammal Ecology: pp. 80— 84. Tokyo (in Japanese). Hellgren, E. C., Rogers, L. L. and Seal, U.S. 1993. Serum chemistry and hematology of black bears: physiology indices of habitat quality or seasonal patterns. Journal of Mammalogy 74: 304-315. Hellgren, E.C., Vaughan, M.R. and Kirkpatrick, R. L. 1989. Seasonal patterns in physiology and nutrition of black bears in Great Dismal Swamp, Virginia-North Carolina. Canadian Journal of Zoology 67: 1837-1850. Jonkel, C. J. and Cowan, I. M. 1971. The black bear in the spruce-fir forest. Wildlife Monograph 27: 1-55. Mautz, W. W. 1978. Nutrition and carrying capacity. In (Schmidt, J. L. and Gilbert, D. L. eds.) Big Game of North America, Ecology and Management. Pp.321—348. Stackpole Books, Harrisburg. Nelson, R. A., Folk, G. E. Jr., Pfeiffer, E. W., Craighead, J. J., Jonkel, C. J. and Steiger, D. L. 1983. Behavior, biochemistry, and hibernation in black, grizzly, and polar bears. Fifth International Conference on Bear Research and Management: 284—290. Robbins, C. T. 1993. Wildlife Feeding and Nutrition, 2nd edn. Academic Press, Sandiego, 352 pp. Servheen, C. 1990. The Status and Conservation of the Bears of the World. International Conference on Bear Research and Management Monograph Series. No. 2. 32 pp. Tsubota, T. 1998. Biology of Mammals 3: Physiclogy. University of Tokyo Press, Tokyo, 125 pp. (in Japanese). Watts, P. D. and Cuyler, C. 1988. Metabolism of the black bear under simulated denning conditions. Acta Physio- logica Scandinavica 134: 149-152. Watts, P. D., Oritsland, N. A. and Ronald, K. 1981. Mammalian hibernation and the oxygen consumption of a denning black bear (Ursus americanus). Comparative Biochemistry and Physiology 69: 121-123. Received I August 1998. Accepted 10 January 1999. Mammal Study 24 (1999) Appendix 1. Body weights (kg) of seven captive female Japanese black bears. 1994 1995 Bear Oct. May Jun. Jul. Aug. Sept. Oct. Nov. Dec. W31 44.0 53.0 57.0 61.0 60.5 59.0 = 70:5 W32 S720 = 45.0 48.0 52.0 Silsd Soll) 58.0 60.0 W33 64.0 49.0 52.0 56.0 = 59.0 63.0 == 71.0 W34 54.0 41.0 47.0 50.0 55.0 54.0 56.0 54.0 — W35 65.0 50.0 55.0 = 61.0 60.0 62.0 = 70.0 Y45 59.0* 42.0 as 54.0 58.0 60.0 = 62.0 a= Y48 51.0 = 55.0 57.0 56.0 60.0 63.5 70.5 Mean 60.5 46.2 50.4 53.3 S763) 57.3 58.8 59.4 68.4 SD Sell 4.4 4.2 3.6 3D eM) 3.8 4.3 4.7 * weighed in September. Mammal Study 24: 7-15 (1999) © the Mammalogical Society of Japan The distribution and habitat use of the Eurasian red squirrel Sciurus vulgaris L. during summer, in Nopporo Forest Park, Hokkaido Tsung Hung Lee! and Hiromi Fukuda? 1,2Graduate School of Environment Earth Science, Hokkaido University, North 10 West 5, Sapporo 060-0808, Japan Abstract. The distribution and habitat use of the Eurasian red squirrel Sciurus vulgaris L. was studied in Nopporo Forest Park (43°20'N, 141°30 E), Hokkaido, Japan where a study area consisting of a total of 401, 200m by 200m, grid squares was established. Observa- tions were made of individuals, their dreys, their feeding signs, and their footprints (after dusting with wheat flour). Squirrels were found to be widely distributed throughout the study area, and to inhabit 45 of the 401 squares (11.2%). Squirrels occurred at high fre- quencies in three areas within the forest. The percentages of squares in which squirrels lived, differed significantly between different forest types, with 28.2% of squares in evergreen coniferous forest used, 5.3% in deciduous coniferous forest; 5.2% in mixed forest; 3.9% in deciduous broad-leaved forest, and 0% in other areas. We concluded that dusting with flour was a useful method for revealing footprints, and that this facilitated the ease study of squirrel distribution. The distribution of the red squirrel clearly depends on the forest type. Coniferous forest areas were selected as habitat by squirrels during summer because they provided good sources of food and ideal sites for building dreys. Key words: distribution pattern, footprints revealed with flour, forest type, habitat use, Sciurus vulgaris. The Eurasian red squirrel, Sciurus vulgaris L., is widespread throughout Hokkaido, Japan (Environment Agency 1983; Takaragawa 1996). Significant changes to the landscape, as a result of human activities such as deforestation for agriculture and/or urbanization, have, over the last century, cause a drastic reduction in the area of suitable forest habitat, which has led to the isolation of squirrel populations. Such isolated populations are at risk from the negative effects of isolation such as inbreeding depression (Wildt et al. 1987; Brewer et al. 1990) which may lead to the extinction of populations or even species. In England, where the distribution range of the red squirrel has reduced and fragmented in this century, areas of forest of more than 2,000 ha are now deemed necessary if they are to serve effectively as red squirrel reserves (Gurnell and Pepper 1993). Information on the local distribution and abundance of animal population is an im- portant aspect of management-oriented investigations of wildlife. To that end, several cen- 'Present address: Rm. 2, 3rd Fl., 25, Lane 238, Szeping R., Taichung 406, Taiwan; E-mail: tsunghun@ms29.hinet.net 8 Mammal Study 24 (1999) sus techniques have been evaluated for the red squirrel, including elaborate capture-recapture programs (Moller 1986; Wauters and Dhondt 1990b); drey counts (Tittensor 1970; Wauters and Dhondt 1988, 1990a; Van Apeldoorn et al. 1994); and counting tracks and food remains (Andrén and Lemmell 1992; Kadosaki 1995). For this study we used a combination of direct observations of individuals, and observations of dreys, feeding signs, and footprints dusted with wheat flour, in order to study the distribution and habitat use of the Eurasian red squirrel in Nopporo Forest Park during the summer from June to September 1996. Study area Research was conducted in Nopporo Forest Park (43°20 N, 141°30 E), which is situated in west Hokkaido, 11-15 km east of central Sapporo. Nopporo Forest Park has an area of 2,051 ha, and stretches over parts of Sapporo, Ebetsu and Kitahiroshima administrative areas. The forest is designated as a natural recreational forest, and the whole area lies within a wildlife protection area. Nopporo forest has become completely isolated from other areas of lowland forest as a result of the spread of both agriculture and urbanization. The forest now consists mainly of natural deciduous forest, but has some areas of planted conifers within it. The total area of our study, after excluding bogs, lakes, and buildings, amounted to about 1,611 ha. Materials and methods This study was processed in three stages from 1 June to 15 September 1996. During Stage I, from 1 June to 20 June 1996, a study area of 16 ha was established and searched for squirrels, their dreys and their feeding signs, in order to obtain basic habitat utilization information. During Stage II, from 25 June to 15 July 1996, the following program was followed in order to evaluate a method for studying squirrel distribution and habitat use. 1) A square covering about 1 ha (100 m x 100m) was establish. 2) In the center of this area, a feeding station with a radius of 60cm was establish on the ground. Approximately 300 g of wheat flour was spread in the middle of the feeding station covering an area with a radius of 25 cm. In addition, one walnut, one acorn, one peanut, one pistachio and ten sunflower seeds were put on the feeding station for a whole day in order to attract squirrels to the area covered with flour. 3) When squirrel, or other animals, visited the feeding station they picked up flour on their feet, and left trails of footprints as they left. The species leaving footprints could be identified on the basis of the shape of the hind foot and on the stride length. 4) In order to distinguish between the individuals leaving footprints, we observed them with binoculars (<7) at a distance of 20m from the feeding station. We were able to identify three squirrels individually on the basis of their coat color, their size, the cuts of their ears, and by the size of the footprints. 5) The day-range of the three known individuals was es- tablished by setting eight new feeding stations to the north, south, east, and west of the main feeding station and at distances of 100 m and 200 m away, in order to see whether the same individual also visited there or not. All three squirrels visited the new feeding stations set 100 m away from the original site, but none visited feeders set 200m away. Therefore, the home ranges of these squirrels were equal to or less than the size of the grid (200 m X 200 m). Lee and Fukuda, Eurasian Red Squirrel Habitat Use 9 During Stage III, from 16 July to 15 September 1996, we investigated the distribution of squirrels and their habitat use throughout the whole forest area. First we established 401, 200 m by 200m (4ha), grid squares in the study area. Each square was investigated every two days. On the first day the feeding station was provisioned, and on the second day footprints were followed. We also looked for nests, recording nesting tree details, searched for feeding signs, and watched for individuals within a 50m radius of the feeding station. The dominant tree species within a 50m radius of the feeding station were also noted. We also investigated the distribution of squirrels (using the methods described in stage III above) in four areas adjoining the main study area. These areas were: the Hokkaido Forest Tree Breeding Institute (including the gene reservation region); Nopporo Prefectural General Sports Park; the Historical Village of Hokkaido, and the campus of Rakuno Gakuen University (Fig. 1). Results Distribution pattern Eurasian red squirrels were found (on the basis of direct observation, or of finding their footprints, their dreys or their feeding signs) in 45 (11.2%) of the 401 study squares. Occu- pied squares were scattered around the study area. When the shortest distance between squares being used by squirrels was equal to or less than 400m, we drew minimum convex polygons and so were able to recognize three areas (A, B, and C) where squirrels were con- centrated. Area A consisted of 18 squares (18/45; 40%); Area B consisted of 13 squares (29%), and area C consisted of six squares (13%; see Fig. 1). In area A, squirrels were scattered throughout a large area, and in area C they were scattered over a smaller area, whereas in area B they were highly concentrated. From additional research outside the main study area, in the Hokkaido Forest Tree Breeding Institute, squirrels were found in four squares, and their distribution was concen- trated in the gene reservation section (the distribution of squirrels in the three other areas can be seen in Fig. 1). A total of 25 individual squirrels was observed, in the 401 squares of the study area; 11 individuals were identified in area A; nine in area B; three in area C; and two in other areas. We are confident that observations were of different individual squirrels because either different squirrels were seen in the same squares simultaneously or they were seen in squares separated by more than 400m. We concluded, therefore, that the squirrels in Nopporo Forest Park were mainly distributed in area A, B and C during summer. Squirrels were more often found in some tree species than in others, so for example, twelve were seen on Abies sachalinensis; six on Pinus strobus; four on Larix leptolepis; two on Picea glehnii, and one on Quercus mongolica. A total of 28 dreys was found in just 15 squares, although in one square with a drey we were unable to find either footprints, feeding signs or individuals, suggesting that the drey may have been disused. Feeding signs were found in 24 squares, and in a further square we found feeding signs but were unable to locate individuals, dreys, or footprints. Distinctive feeding signs were recognize on walnuts, chestnuts, acorns and the cones of A. sachalinensis, Pinus Koraiensis and P. strobus. Among the total of 45 squares showing signs of squirrels, activity in 43 (95.6%) of them was detected using the floured footprint method. 10 Mammal Study 24 (1999) II. Forest types I. Distribution Gene reservation region Hokkaido Forest Tree Breeding Institute Evergreen coniferous forest Deciduous broad-leaved roceeeines Dotted line: Concentrated forest region (A, B and C) Mixed forest Direct sbservati s avon Deciduous coniferous Solid line: study area forest Dreys : aa I Others Broken line: adjoining area peed nggsons a] Forest fragementation or campus with many trees Fig. 1. The distribution pattern of the red squirrel in the Nopporo Forest Park with 200 m grid squares (I. Dis- tribution) and the vegetation of the Nopporo Forest Park and the adjoining areas (II. Forest types). Lee and Fukuda, Eurasian Red Squirrel Habitat Use 11 Habitat use According to the investigation of the dominant trees near the feeding stations, and on the basis of published vegetation maps (Environment Agency 1981; Sapporo District Forestry Office 1992), the forest vegetation could be divided into five broad types: 1) mixed forest, consisting of a natural community of Picea jezoensis, A. sachalinensis, QO. mongolica, Tilia japonica and Acer mono; 2) deciduous broad-leaved forest, consisting of a natural com- munity of A. mono and T. japonica; 3) evergreen coniferous forest, consisting of a plan- tation community of A. sachalinensis, P. glehnii and various exotic trees; 4) deciduous coniferous forest, consisting of a plantation of Larix leptolepis; and 5) others vegetation types including cultivated meadow, fields and young plantations (see Fig. 1). On the basis of squirrels presence and on the forest community within each square, we were able to examine habitat use in different forest types. Among squares where evergreen coniferous forest pre- dominated 28.2% of squares were occupied by squirrels. Where deciduous coniferous forest was dominant 5.3% of squares were occupied. In mixed forest 5.2% of squares were occu- pied by squirrels, and in deciduous broad-leaved forest 3.9% of squares were occupied. In the fifth category of vegetation, no squares (0%) were occupied. The differences in forest use were statistically significant (P<0.001; Table 1). Squirrels were present in just 4.4% of natural vegetation units, but were found in 25.7% of the squares where the forest consisted of plantations. The difference in the rate of habitat use between natural vegetation and plantations was also significant (y?=38.4, df=1, n=387, P<0.001). In the three areas where squirrels were concentrated, area A region consisted of ever- green coniferous forest, deciduous broad-leaved forest, mixed forest. Area B consisted mainly of evergreen coniferous forest, with some deciduous broad-leaved forest. Area C region consisted mainly of evergreen coniferous plantation, deciduous broad-leaved forest and some planted deciduous conifers. Among these three areas, however, squirrels were mainly distributed in areas with evergreen coniferous forest. Squirrels were less commonly found in areas of deciduous broad-leaved forest, mixed forest, deciduous coniferous forest or Others vegetation types. In terms of the total number of squares occupied by squirrels (45), 33 (73.3%) were in evergreen coniferous forest, and 12 (26.7%) were in deciduous coniferous, mixed and deciduous broad-leaved forests. Similarly, in the Hokkaido Forest Tree Breeding Institute, adjoining the study area to the North, squirrels were mainly dis- tributed in the gene reservation region, which consisted of various types of coniferous plan- tation. More feeding signs (on 13 species) were found here than in other areas. Further analysis of the distribution of dreys in relation to tree species, indicated that Table 1. The number of grids with squirrel in different forest types. Forest type Grids of presence(%) Total of grids Evergreen coniferous forest 33(28.2) LIU Deciduous coniferous forest 1(5.3) 19 Mixed forest 5(5.2) 97 Deciduous broad-leaved forest 6(3.9) 154 Others 0(0) 14 Total 45 401 72=50.689, n=401, df=4, P<0.001 12 Mammal Study 24 (1999) Table 2. The numbers of the dreys built in different type of trees. Hokkaido Forest Tree N i i opporo Forest Park Breeding Institute Type of trees AB C Others Gene reservation region Total (%) Evergreen coniferous trees 10 yD 4 8 33(89.2%) Deciduous coniferous trees 0 eX) 0 1 3(8.1%) Deciduous broad-leaved trees 1 0 O 0 0 1(2.7%) Total Ul LI y, 4 9 31) most dreys (89.2%) were built in evergreen coniferous trees, although some were built in deciduous coniferous trees and some in deciduous broad-leaved trees (Table 2). Discussion Tracking footprints is a well-established means of confirming the presence of mammals. Footprints are not always conspicuous, however Kadosaki and Inukai (1995) showed that it was possible to use lime flour to make the footprints of brown bear Ursus arctos more con- spicuous, and also to aid in their individual identification. In this study we used a similar method, imprinting the footprints of Eurasian red squirrels with wheat flour, in order to facilitate tracking and censussing them. This method enabled us to confirm that as squir- rels will visit feeding stations up to 100m apart, but not 200m apart (see stage II above), then 200 mx 200m grid squares can be used to study the distribution of the squirrels in Hokkaido. Seasonal and annual changes in habitat condition are known to affect the distribution (Gurnell 1983), and the home ranges of males are known to be larger during the breeding season (Wauters and Dhondt 1992). We conducted our study therefore during the three months of summer when squirrels density was likely to be highest (Takaragawa 1980; Gurnell 1983), and used direct observation, flour print tracking, observations of dreys, and feeding signs, in order to investigate the distribution pattern and habitat use of squirrels. During this study, the presence of the footprints (in 43 squares) proved to be the best evidence of the presence of squirrels in a given area, with direct observation of squirrels (in 11 squares) being a somewhat less effective method of study them. The presence of footprints reflects activity well, and as squirrels came to each feeding station voluntarily and without being disturbed, their subsequent movements were considered to be natural. Although red squirrels use two types of nests, spherical shaped nests built amongst tree branches, and dens in tree-holes lined with nest material (Tittensor 1970; Wauters and Dhondt 1990a), dreys are generally the commonest form of nest in both coniferous and deciduous woodlands (Wauters and Dhondt 1990a). After the breeding season, and hence during summer, dens are less important (Tittensor 1970), therefore, although we used dreys as one means of confirming the distribution pattern of squirrels, we disregarded misshapen dreys as it was unlikely that they were still in use. The use of four different types of field signs enabled us to study the distribution pattern of squirrels, though different method had widely differing degrees of success. The number of grid squares where squirrels were detected on the basis of these different field signs was: 43 Lee and Fukuda, Eurasian Red Squirrel Habitat Use 13 for footprints > 24 for feeding signs > 15 for dreys > 11 for direct observation of individuals. Squirrels were detected in 17 squares purely on the basis of tracing their foot- prints. Their presence in one square was confirmed only by the finding of a drey, and in another by the finding of feeding signs. Sightings of individuals were only made in con- junction with other signs, and their presence was not confirmed in any squares by direct observation alone. We suggest, therefore, that tracking footprints dusted in flour is a very effective method for the study of the distribution and movements of the red squirrels. As in Europe, many woodlands in Japan have become fragmented, so that where large red squirrel populations used to occur, they have now been reduced to small populations in isolated parts of their old range (Celada et al. 1994; Van Apeldoorn et al. 1994; Wauters et al. 1994). Habitat fragmentation has been shown to have impacts on both the distribution and probability of occurrence of this species (Van Apeldoorn et al. 1994), and it has been recommended that forests larger than 2,000 ha are necessary as red squirrel reserves (Gurnell and Pepper 1993). In this study, the widespread distribution, with some areas of concentration, indicate that squirrels are actively selecting their habitat. Additional research using radio-telemetry showed that during the mating season, from February to June, males living in area A also temporarily visited the Hokkaido Forest Tree Breeding Institute, while males from the ad- joining areas (Hokkaido Forest Tree Breeding Institute, Nopporo Prefectural General Sports Park, the Historic Village of Hokkaido and the campus of Rakuno Gakuen University) also sometimes visited area A (Lee and Fukuda unpublished data). Thus the squirrels living in these adjacent areas are also considered to belong to the same population as in Nopporo Forest Park. In this area, totalling more than 2,000 ha of forest, red squirrels were con- sidered to be actively selecting their habitat and concentrating in three high density areas. During the mating season, however, males travel to other areas in order to mate, and hence avoid the negative effects of reduced genetic variation (Wauters et al. 1994), and habitat loss by the forest fragmentation (Andrén and Delin 1994). Whereas red squirrels were found readily in the larger area of forest in Nopporo, none were found in small isolated urban habitats such as on the Hokkaido University campus (182 ha) or in the Botanical Garden (20 ha), despite there being plentiful food resources in the form of walnut, acorns, and pine cones. Their absence may have been because the areas of habitat were too small for them, or because of the presence of too many predators such as cats and/or crows. The coniferous community of the Nopporo Forest Park, produced by frequent cuttings and by wind damage, has been maintained by planting A. sachalinensis, and P. jezoensis, L. leptolepis and exotic trees such as Pinus koraiensis, and P. strobus. The natural mixed forest community consisted mainly of Picea jezoensis, A. sachalinensis, T. japonica and Acer mono, while the broad-leaved forest consisted mainly of A. mono and T. japonica. Although, Juglans ailanthifolia was also present, it was scarce (Tatewaki and Igarashi 1973). Eurasian red squirrels feed on a wide range of different food types, however tree seeds form the most important part of their diet (Moller 1983; Gurnell 1987; Wauters et al. 1992), and coniferous tree seeds can provide food year round (Wauters et al. 1992). Stomach contents analysis has also shown that pine seeds are the most important component of their diet (Gronwall and Pehrson 1984). In our study, red squirrels occurred more commonly in evergreen coniferous forest than in either broad-leaved forest or mixed forest. Moreover, red squirrels were also abundant in the part of the gene reservation region of the Hokkaido 14 Mammal Study 24 (1999) Forest Tree Breeding Institute where a wide range of coniferous tree species occur, suggesting that habitat selection may be made on the basis of the availability of good food resources. The concentration of squirrels in three regions of Nopporo Forest Park is probably due to habitat selection on the basis of good food resources and good locations for building dreys. Furthermore, habitat selection may be one aspect of an adaptive breeding strategy, if more squirrels can live in the same area, then perhaps their chances of finding a partner are increased. In conclude, tracking red squirrel footprints using flour is a very helpful method for studying their distribution and their habits. Observations made on these basis indicate that the red squirrel in Hokkaido selects coniferous forest habitats in summer because they pro- vide good sources of food and good sites to build dreys. From the standpoints of conser- vation of this species, maintaining large areas of forest which include or are connected to areas of coniferous forests are very important. Further studies on impact of environmental factors on squirrels, such as seasonal changes in habitat quality, predator distribution, and the significance of forest floor vegetation (especially the presence of bamboo grass) are needed. Acknowledgements: We thank Dr. Masaaki Kadosaki for valuable advice and the kind help during this study; Dr. Hidetsugu Sato for providing the walnuts; Dr. Mark A. Brazil for critically reading and comments on the final manuscript. References Andrén, H. and Delin, A. 1994. Habitat selection in the Eurasian red squirrel, Sciurus vulgaris, in relation to forest fragmentation. Oikos 70: 43-48. Andrén, H. and Lemmell, P. A. 1992. Population fluctuations and habitat selection in the Eurasian red squirrel Sciurus vulgaris. Ecography 15: 303-307. Brewer, B. A., Lacy, R. C., Foster, M. L. and Alaks, G. 1990. Inbreeding depression in insular and central popu- lations of Peromyscus mice. Journal of Heredity 81: 257-266. Celada, C., Bogliani, G., Gariboldi, A. and Maracci, A. 1994. Occupancy of isolated woodlots by the red squirrel Sciurus vulgaris L. in Italy. Biological Conservation 69: 177-183. Environment Agency. 1981. Vegetation map, Sapporo and Ebetsu, Tokyo. Environment Agency. 1983. The foundation investigation of nature conservation: the distribution of wildlife (mammal) (3). Tokyo, 126 pp. (in Japanese). Gronwall, O. and Pehrson, A. 1984. Nutrients content of fungi as a primary food of the red squirrel (Sciurus vulgaris L.). Oecologia 64: 230-231. Gurnell, J. 1983. Squirrel numbers and the abundance of tree seeds. Mammal Review 13: 133-148. Gurnell, J. 1987. The Natural History of Squirrels. Christopher Helm, London, 201 pp. Gurnell, J. and Pepper, H. 1993. A critical look at conserving the British red squirrel Sciurus vulgaris. Mammal Review 23: 127-137. Kadosaki, M. 1995. The investigation of an environmental impact statement in RTN region of Ebetsu. Report of mammals. Ebetsu-shi (in Japanese). Kadosaki, M. and Inukai, T. 1995. Brown Bear. The Hokkaido Shimbun Press, Sapporo, 365 pp. (in Japanese). Moller, H. 1983. Foods and foraging behaviour of red (Sciurus vulgaris) and grey (Sciurus carolinensis) squirrels. Mammal Review 13: 81-98. Moller, H. 1986. Red squirrel (Sciurus vulgaris) feeding in a Scots pine plantation in Scotland. Journal of Zoology 209: 61-84. Sapporo District Forestry Office. 1992. Vegetation map of Nopporo Forest Park, Sapporo. Lee and Fukuda, Eurasian Red Squirrel Habitat Use 5) Takaragawa, N. 1980. A study on Sciurus vulgaris orientis in a Quercus forest and its neighboring forests in Obihiro city. M.S. thesis, Obihiro University of Agriculture and Veterinary Medicine, Obihiro, 82 pp. (in Japanese). Takaragawa, N. 1996. Eurasian red squirrel. In (T. Kawamichi ed.) The Encyclopaedia of Animals in Japan, I Mammals 1. Pp. 68-69. Heibonsha, Tokyo (in Japanese). Tatewaki M. and Igarashi, T. 1973. Botanical survey on the Nopporo National Forest — with special reference to the forest vegetation. Sapporo Regional Forestry Office, Sapporo, Japan (in Japanese). Tittensor, A. M. 1970. Red squirrel dreys. Journal of Zoology 162: 528-533. Van Apeldoorn, R., Celada, C. and Nieuwenhuizen, W. 1994. Distribution and dynamics of the red squirrel (Sciurus vulgaris L.) in a landscape with fragmented habitat. Landscape Ecology 9: 227-235. Wauters, L. A. and Dhondt, A. A. 1988. The use of red squirrel Sciurus vulgaris dreys to estimate population density. Journal of Zoology 214: 179-187. Wauters, L. A. and Dhondt, A. A. 1990a. Nest-use by red squirrel (Sciurus vulgaris Linnaeus, 1758). Mammalia 54: 377-389. Wauters, L. A. and Dhondt, A. A. 1990b. Red squirrel (Sciurus vulgaris Linnaeus, 1758) population dynamics in different habitats. Zeitschrift fiir Sdugetierkunde 55: 161-175. Wauters, L. A. and Dhondt, A. A. 1992. Space behaviour of red squirrels, Sciurus vulgaris: variation between habitats and the sexes. Animal Behaviour 43: 297-311. Wauters, L. A., Hutchinson, Y., Parkin, D. T. and Dhondt, A. A. 1994. The effects of habitat fragmentation on demography and on the loss of genetic variation in the red squirrel. Proceedings of the Royal Society of London B 255: 107-111. Wauters, L. A., Swinnen, C. and Dhondt, A. A. 1992. Activity budget and foraging behaviour of red squirrel (Sciurus vulgaris) in coniferous and deciduous habitats. Journal of Zoology 227: 71-86. Wildt, D. E., Bush, M., Goodrowe, K. L., Packer, C., Pusey, A. E., Brown, J. L., Joslin, P. and O’Brien, S. J. O. 1987. Reproductive and genetic consequences of founding isolated lion populations. Nature 329: 328-331. Received 27 April 1998. Accepted 19 January 1999. : ziti #3 ienceaieres ae Sonirt xa hid 7 SS ear prs Paap: eT sii nd tans Heres a ‘aye et) nis u ate f ' s a oa i i y e ar i ee F si \ ta ty ; Zt eatin i ee a ™ ‘i She ere omc 7 + = r 1 ra i 4 Mn oy P “ z ws eh het ive. Ons = wy eet ‘ - a a - =) bs “ i f a a i g ‘See 1 3 7 ‘ = 1 z - ‘! , i. ‘ - 1 a : F; : 7 7 My CA Py a ; ls i ‘ i te 2 Ne < ‘ 1 ‘ 7 Ne j So gahbel } 2) xo ae : Ni H fi - ~ AS 2 | ay « fe > ao - 2 nea A ees 5 = if i ts : . : ans , Lo ei. 3 \ a 24 woe = =, 4 Hl Y f j . s ie vi ¥ J * © = tr : ‘ =) a = a 3 ; , f x e t Ri i s u - i 1 S F Te > ’ Fe 4 4 1 = X% > = Ti is a ia [aes = i 2 a a i “ = aly . i 2 7 2 - ed ee | € 5 ) = ; é _ a is ~ Z = , { ay : ( = \ = prs f ; ; 4 2 eo - C PE £ = = % a= \ x x i x % i = 5 = = £ - J £ ~ “Za 3 e i a y 7 j re £ be { 4 ~ y 4 = P) a, + = Mammal Study 24: 17-23 (1999) © the Mammalogical Society of Japan Molar wear rates in Sika deer during three population phases: increasing versus decline and post-decline phases Hiroshi Takahashi!, Koichi Kaji? and Toru Koizumi? 1Graduate School of Environmental Earth Science, Hokkaido University, Sapporo 060-0810, Japan Hokkaido Institute of Environmental Sciences, Sapporo 060-0819, Japan 3Kyushu Research Center, Forestry and Forest Products Research Institute, Kumamoto 860-0862, Japan Abstract. Wear rates of lower first molars (M;) in Sika deer, Cervus nippon, were compared among the increasing, declining and post-decline phases of population dynamics on Nakano- shima Island, Hokkaido, Japan, to evaluate the effects of food limitations on deer feeding ecology. Teeth specimens were collected also from a population in eastern Hokkaido, as a control, where foods were abundant. The maximum length and width of M, were not different among the three phases. A linear regression coefficient for log-transformed M, height against age was not different between males and females, but significantly smaller in the post-decline phase population than in the increasing phase and the control populations. The results suggest that M, wear rates increased as food declined. Key words: Cervus nippon, food limitation, molar wear rates, Nakanoshima Island, popu- lation phase. Food limitation influences life history characters of mammals through its effects on their physical conditions (Fowler 1987). Since tooth wear of ungulates reflects food quality (Morris 1972; Fortelius 1985) and affects physical condition by its influence on ingestion and mastication (Skogland 1988), tooth wear rate can be used as an index of life history charac- ters. For example, female reindeer, Rangifer tarandus, in a low density population showed lower wear rates of molars than in a high density population (Skogland 1988). Similarly, tooth wear was related to survival rates of roe deer, Capreolus capreolus (Gaillard et al. 1993) and kudu, Tragelaphus strepsiceros (Owen-Smith 1993). These results suggest that tooth wear patterns are related to the demography of ungulate species. Three individuals of Sika deer, Cervus nippon, were introduced to Nakanoshima Island in Lake Toya, Hokkaido, Japan from 1957 to 1965 (Kaji et al. 1988). The population in- creased to 299 (57.5/km_2) in 1983, and grazing effects on vegetation became apparent (Kaji et al. 1991). The population crashed under food limitations in 1984, and gradually recovered to approximately 180 (34.6/km7?) in recent years (Hokkaido Institute of Environmental Sciences, hereafter HIES 1997). The dynamics of this population and its impacts on vege- tation have followed the typical pattern of introduced ungulates (Caughley 1970). We had ‘E-mail: yuji@ees.hokudai.ac.jp 18 Mammal Study 24 (1999) the opportunity to test the influence of food limitations on tooth wear rates during different population dynamic phases. Since life history parameters such as fecundity decreased as food availability declined (Kaji et al. 1988), tooth wear rates may also be an indicator of population quality if they vary with population phases. Materials and methods Tooth samples were collected from naturally dead deer on Nakanoshima Island from 1980 to 1984, and from 1992 to 1997. These were divided into the increasing (1982 or before), the decline (1983 and 1984) and the post-decline (1985 or after) phase groups accord- ing to the year of death for each sample (hereafter INC, DEC and POST, respectively). A control group (CONT) was sampled from the deer killed in pest controls in 1990 in eastern Hokkaido, where the population showed high fat reserves (Yokoyama et al. 1996) and high reproductive rates (Suzuki and Ohtaishi 1993), which indicate good nutrition. Age of each sample was determined by cementum annuli from the first incisors or the first molars after Ohtaishi (1980). The lower first molar (M,) was used to measure wear rates because it has the longest exposure to wear. Morris (1972) recommended measuring the area of exposed dentine to assess tooth wear because of ever-increasing quantity. However, in many of our samples, wear extended over the entire occlusal area, and the area of dentine exposed reached the ceiling. Therefore, we measured the crest height from the cervical line to the postloph lingual crest (Ohtaishi 1980) to the nearest 0.01 mm with a caliper. The maximum M, length and width were also measured for samples from Nakanoshima Island in order to compare M, size among the different phases. We obtained samples ten years old and older from the POST, but not from other phases. To compare wear rates in equivalent age classes, only samples under ten years of age were used in the analysis. The M, length and width were compared between sexes and among the phases by two-way ANOVA. Linear regression coefficients for the log-trans- formed crest height against age were compared between sexes and across phases. If ANOVA for parallelism of regression lines proved significant, multiple comparisons of regression coefficients were carried out using the Tukey-Kramer method (Sokal and Rohlf 1995). Results The means of the maximum M, length and width of the three phases are shown in Table 1. Both the length and width were significantly different between sexes (two-way ANOVA: Table 1. Mean (+SD) of maximum M, length and width by sex in each phase. Phase Sex n Length (mm) Width (mm) Increasing Female 6 16.14+0.28 11.09+0.61 Male 7 16.37+0.65 11.56+0.33 Decline Female 18 16.28 +0.64 11.39+0.40 Male 30 16.33 +0.56 11.49+0.44 Post-decline Female 22 16.12+0.54 11.14+0.60 Male 14 16.66+0.43 11.44+0.45 Takahashi et al., Molar wear rates in Sika deer 19 length, F;,9,=4.013, P=0.048; width, F;,9;=5.459, P=0.022), but not among phases (length, F>,5,=0.641, P=0.529; width, Fy 9,=1.265, P=0.287), and sex-phase interaction was not significant (length, Fy, 9,=1.796, P=0.172; width, F,,5,;=0.807, P=0.449). This suggests that M, size is a sexually dimorphic character unrelated to food limitation. Increasing phase @ Male O Female Decline phase Log M1 height (mm) 1 3 5 7, 9 Age (year) Fig. 1. Changes in log-transformed M, height with age in Sika deer during three population phases on Nakano- shima Island and in deer from eastern Hokkaido (control). 20 Mammal Study 24 (1999) Table 2. Regression coefficients for log M, height against age (b) by sex in each sample group. Female Male Carnal Sample group SaaS n b SE P n b SE P difference Increasing phase 7 —0.033 0.009 ‘3 10 —0.030 0.005 es ns Decline phase 18 —0.053 0.004 we 30 —0.047 0.005 ae ns Post-decline phase 22 —0.053 0.004 oe 14 —0.056 0.008 ao" ns Control 55 —0.040 0.002 ea 109 —0.036 0.004 cs ns P (two-tailed): *, <0.05; **, <0.001. Table 3. Regression coefficients for log M, height against age (b) in each sample group con- taining both sexes. Sample group n b SE P Increasing phase 17 = 02032 0.004 <0.001 Decline phase 48 —0.050 0.003 <0.001 Post-decline phase 36 —0.054 0.004 <0.001 Control 164 ami) .039 0.002 <0.001 Changes in log-transformed crest height with age are shown in Fig. 1. Sexual differences in regression coefficients of log M, height against age were not detected within each phase group nor in the mainland control group (ANOVA for parallelism of regression lines: F; 3 =0.083, P=0.219 for INC; F,, 16=0.605, P=0.448 for DEC; F;, }>=0.066, P=0.199 for POST; F,, 2=0.553, P=0.472 for CONT; Table 2). Therefore, data of both sexes were pooled to increase sample sizes, and regression coefficients were recalculated (Table 3). ANOVA detected significant differences among the three phases (F3, 4.=4.880, P=0.006), and multiple comparison showed significant differences between INC and POST (P< 0.05) and between POST and CONT (P<0.05). These results suggest that wear rates of M, in INC were equivalent to those in CONT, and that the wear rates in POST were higher than those in INC. Discussion On Nakanoshima Island, food resources were abundant in 1980, but the deer began to consume more tree bark as palatable plants declined in 1982 and 1983 (Kaji et al. 1991). Thereafter, production in short-grass communities during summer decreased from 198.6 g/m? in 1984 to 63.9 g/m? (average, 1992-1994, Miyaki et al. 1995). Available understory plants were scarce and the deer were obliged to consume short greens and fallen leaves. The production of fallen leaves was estimated to be 28.7 kg/ha/month in July 1994, while that of the short-grass communities was simultaneously estimated to be 144.4 kg/ha/month (Miyaki et al. 1995). However, due to the limited area of short-grass communities (0.4% of the is- land), and the fact that deer can use them only during the snow-free season (late April to October), the short greens could support only 29 deer (14% of the population) even in sum- mer, and the deer would depend mostly on fallen leaves (Miyaki et al. 1995). Thus, high quality forage was not available in either DEC which experienced sudden food shortage, or Takahashi et al., Molar wear rates in Sika deer 21 in POST which faced continuous food limitations. Consequently, wear rates in DEC were not apparently different from INC, while those in POST were significantly higher than in INC and CONT. In addition to experiencing changes in food quality, deer were often ob- served to ingest soil when grazing. Similar reports have been made of higher tooth wear rates associated with soil ingestion by white-tailed deer, Odocoileus virginianus (Rue 1978) and with the presence of abrasive elements in the diet of Spanish ibex, Capra pyrenaica (Fandos et al. 1993). Previous studies demonstrated that food limited populations showed higher wear rates than food rich populations in reindeer (Skogland 1988) and Spanish ibex (Fandos et al. 1993). In this study, we found that a deer population under food limitations showed higher wear rates than when under food rich conditions. On Nakanoshima Island, body size of Sika deer and degree of sexual dimorphism were reduced by the effects of food limitation (Kaji et al. 1988). In this study, however, M, sizes (length and width) were different between sexes but not among the three phase groups. Since M, reaches a given size before skeletal growth is completed (Fortelius 1985), M, sizes may not be as influenced by food limitation as skeletal sizes are. Tooth size appears not to affect wear rates. Some studies have suggested that higher teeth wear rates in males are a result of the male’s greater food consumption associated with larger body size (black-tailed deer, Odocoileus hemionus columbianus, Thomas and Bandy 1975; Sika deer, Ohtaishi 1976; Takatsuki 1998), although statistically significant differences were either unexamined or equivocal. Takatsuki (1998) showed that wear rates of first incisor were higher in male sika deer than in females on Kinkazan Island, where males consumed foods of lower quality, but not obviously different in Mt. Goyo, where higher quality foods were available to both sexes. Since tooth wear reflects diets of animals for a given period, sexual differences in wear rates might arise when sexual differences in food habits occur and continue for certain periods. Under food rich conditions, high quality foods may be consumed by both males and females. On the other hand, under the food limitations on Nakanoshima Island, both sexes were forced to consume low quality foods. These situations would make sexual differences in food habits unclear, consequently obscuring sexual differences in wear rates. In addition, the patterns of sexual differences in molar wear may differ from that in incisor wear. The results of the present study rely on the accuracy of age estimation. McCullough (1996) pointed out that the cementum aging technique in white-tailed deer sometimes failed because the cementum annuli disappeared when a population density was low and available forage was relatively abundant. If our age estimates are similarly biased, older animals of INC and DEC would have had more years during times of relative food abundance. Similarly, samples of the CONT were collected in 1990 when the deer were well nourished irrespective of age (Yokoyama et al. 1996). In these cases, since the regression slopes may become less steep in INC and DEC or be unchanged in CONT, differences between regression slopes of INC and POST would be even greater. Thus, our conclusion that wear rates increased substantially during the post-decline phase would not be affected greatly by underestimates of age. In conclusion, both the duration and the extent of food limitations clearly contribute to differences in tooth wear rates. Tooth wear seems to be not only population-specific as Fandos et al. (1993) suggested, but also population phase-specific. Tooth wear rates could 22 Mammal Study 24 (1999) be a relative indicator of population health and food conditions. Acknowledgements: We are grateful to Mr N. Hachiya, Drs M. Suzuki, H. Tsuruga, and Mr K. Yoshida for technical consultation and assistance in age determination, and to Ms C. Katsuta for help to measure the specimens. We thank Drs S. Higashi, D. R. McCullough, N. Tyler, N. Ohtaishi and Mr M. Miyaki for useful comments on the earlier draft, Mr J. P. Moll for helping with English. Two anonymous referees improved the manuscript. We are also indebted to Toya-Ko Kisen Co. Inc., and Toya Lake Station for Environmental Biology, Hokkaido University for supporting during the field study. References Caughley, G. 1970. Eruption of ungulate populations, with emphasis on Himalayan thar in New Zealand. Ecology SS 538} 7/72, Fandos, P., Orueta, J. F. and Aranda, Y. 1993. Tooth wear and its relation to kind of food: the repercussion on age criteria in Capra pyrenaica. Acta Theriologica 38: 93-102. Fortelius, M. 1985. Ungulate cheek teeth: developmental, functional, and evolutionary interrelations. Acta Zoologica Fennica 180: 1-76. Fowler, C. W. 1987. A review of density dependence in populations of large mammals. In (H. H. Genoways, ed.) Current Mammalogy 1. Pp. 401-441. Plenum Press, N.Y. Gaillard, J. M., Delorme, D., Boutin, J. M., Van Laere, G., Boisaubert, B. and Pradel, R. 1993. Roe deer survival patterns: a comparative analysis of contrasting populations. Journal of Animal Ecology 62: 778-791. Hokkaido Institute of Environmental Sciences. 1997. Results of a survey related sika deer and brown bear in Hokkaido III. 100+6 pp. (in Japanese). Kaji, K., Koizumi, T. and Ohtaishi, N. 1988. Effects of resource limitation on the physical and reproductive condition of Sika deer on Nakanoshima Island, Hokkaido. Acta Theriologica 33: 187-208. Kaji, K., Yajima, T. and Igarashi, T. 1991. Forage selection by introduced deer on Nakanoshima Island, and its effect on the forest vegetation. In (N. Maruyama et al. eds.) Proceedings of the International Symposium on Wildlife Conservation, in INTECOL 1990. Pp. 52-55. Japan Wildlife Research Center, Tokyo. McCullough, D. R. 1996. Failure of the tooth cementum aging technique with reduced population density of deer. Wildlife Society Bulletin 24: 722-724. Miyaki, M., Hori, S., Nishikawa, Y. and Kaji, K. 1995. A research on carring capacity for Sika deer on Nakanoshima Island, Lake Toya. In Landscape Ecological Study for Basin Management. Pp. 143-147. Hokkaido Technical Center of Forest Management (in Japanese). Morris, P. 1972. A review of mammalian age determination methods. Mammal Review 2: 69-104. Ohtaishi, N. 1976. Wear on incisiform teeth as an index to the age of Japanese deer at Nara Park. Annual Report of Nara Deer Research Association 2: 71-82 (in Japanese with English summary). Ohtaishi, N. 1980. Determination of sex, age and death-season of recovered remains of Sika deer (Cervus nippon) by jaw and tooth-cement. Koukogaku to Shizenkagaku (Archaeology and Natural Science) 13: 51-74 (in Japanese with English summary). Owen-Smith, N. 1993. Comparative mortality rates of male and female kudus: the costs of sexual size dimorphism. Journal of Animal Ecology 62: 428-440. Rue, L. L. 1978. The Deer of North America. Times Mirror Magazines, Inc., N.Y. 463 pp. Skogland, T. 1988. Tooth wear by food limitation and its life history consequences in wild reindeer. Oikos 51: 238-242. Sokal, R. R. and Rohlf, F. J. 1995. Biometry, 3rd edn. Freedman and Company, N. Y. 887 pp. Suzuki, M. and Ohtaishi, N. 1993. Reproduction of female sika deer (Cervus nippon yesoensis Heude, 1884) in Ashoro District, Hokkaido. Journal of Veterinary Medical Science 55: 833-836. Takatsuki, S. 1998. The life of Sika deer read from a tooth. Iwanami Shoten Press, Tokyo. 143+3 pp. (in Japanese). Takahashi et al., Molar wear rates in Sika deer 23 Thomas, D.C. and Bandy, P. J. 1975. Accuracy of dental-wear age estimates of black-tailed deer. Journal of Wildlife Management 39: 674-678. Yokoyama, M., Maruyama, N., Kaji, K. and Suzuki, M. 1996. Seasonal change of body fat reserves in sika deer of east Hokkaido, Japan. Journal of Wildlife Research 1: 57-61. Received 31 August 1998. Accepted 16 April 1999. Pa ‘he iy * 3 . a s oie Sian r es ¥ =~ u aa oa Sat { F y A Os e Roa! < ay : gy , if i - fy fa vias =) fo a J i Spr Ae : i SS Paleo . _ es sy A i i ee ae —aow,s ) ‘i = 2 " = a i +! ; 7 i ‘eal ; ° ae Shae i - ; iy i cee si 4 Ba if : | , ‘ A vue H i ye Al \ i = ? > ee . i Tora J ’ x 4 mel sa 7 - 5 - Ges N ; . = oe ak ; ; * tS r x a Oa ry elias \, i t Sth Sn) es fl 2 = ; 4 ia. 4 P % fe AS 4 F tie 4 aes eer : Wy 2 ) i y as { ae & : “ > f en Sos ei : i } eG: A oe ae i vas Bi 5 5 i y a 7 - - \\ i . , \ Lr : a - 7 t bere 3 =f % ; s ‘ Wit = ta " S > s een 7 A eroed oy » : Me 1 ; mo a7 F che ree 3 2 raed Ae f . ~ M 7 } 4 = = eile , = << see =— ) d We : t hy = s iy < s oat ‘ 3 ek 4 p fé a 2 Que . “ ‘ Y td 7 M y N a } 7 ae: ; é oars 4 fae ears a ’ n sexs . — 3 Beer A = : Z Ss L , . nd ee * } i ¢ i zs ene i, { ) uJ i ’ we ‘ ( - Me) 3} j r ”, # 4 Jak , 2 iy 4, 3 (eget . Re) = ra NP) j = emai * F ‘ # § ' ‘ a G és C t Bon, i - \ 1 = ) rn See Sy / i= i s a " = / ‘ ak 2 q 7 jf faa : one A - ~ regen ef * \ E Mammal Study 24: 25-33 (1999) © the Mammalogical Society of Japan Genetic relationships within and between the Japanese marten Martes melampus and the sable M. zibellina, based on variation of mitochondrial DNA and nuclear ribosomal DNA Tetsuji Hosoda!, Hitoshi Suzuki?, Masahiro A. Iwasa?, Mitsuhiro Hayashida‘, Shigeki Watanabe*, Masaya Tatara® and Kimiyuki Tsuchiya’ 1Gobo Shoko High School, 43-1 Komatsubara, Yukawa, Gobo 644-0012, Japan 2,3Graduate School of Environmental Earth Science, Hokkaido University, North 10, West 5, Kita-ku, Sapporo 060-0810, Japan 4Faculty of Agriculture, Yamagata University, Tsuruoka 997-8555, Japan 52-24-5 Ao-madanihigashi, Mino 562-0022, Japan 6Wildlife Conservation Centre of Tsushima, Nature Conservation Bureau, Environment Agency, Saozaki, Kami-agata, Nagasaki 817-1600, Japan 1Miyazaki Medical College, 5200 Kihara, Kiyotake-cho, Miyazaki 889-1692, Japan Abstract. We examined the intra- and inter-specific genetic relationships of the Japanese marten Martes melampus and the sable M. zibellina using cytoplasmic and nuclear DNA markers. The interspecific sequence divergences in the 402 base pairs of the mitochon- drial cytochrome b gene averaged 3.3%. The extent of the divergences among thirteen indi- viduals of M. melampus collected from Honshu, Shikoku, Kyushu and Tsushima was small (S0.5%), irrespective of their fur color variation. A somewhat higher degree of intra- specific variation (up to 1.3%) was observed among M. zibellina specimens, but the extent of inter-populational variation between Primorye, Russia, and Hokkaido, Japan, was not so high (minimum 0.2%), suggesting that there has been recent genetic communication between Hokkaido and the continent. Among the 24 restriction sites of the nuclear ribosomal DNA spacer, there was no difference within either species, however one site differed between the two species. Using these molecular markers we confirmed that an amimal from Hokkaido, showing the typical morphological characteristics of M. melampus, possessed the same genotype as M. melampus from Honshu. From these results and descriptions in the litera- ture, we presumed that the animal in question could be a descendent of M. melampus intro- duced to Hokkaido from Honshu by fur farmers about 50 years earlier. Eight animals examined from Hokkaido showed no indication of hybridization between the two species. Key words: Japanese marten Martes melampus, sable Martes zibellina, geographic varia- tion, mitochondrial cytochrome Db, ribosomal DNA. Two species of martens, the sable Martes zibellina, and the Japanese marten M. melampus, occur naturally in the Japanese archipelago. The sable ranges across the northern part of 1E-mail: tehosoda@wakayamanet.or.jp 26 Mammal Study 24 (1999) the Eurasian Continent, and the population occurring on Hokkaido, Japan, is described as the endemic subspecies M. z. brachyura. Martes melampus occurs in the main Japanese archipelago, southern Hokkaido, and the Korean Peninsula. Three separate subspecies are recognized on the basis of differences in their coat coloration (Anderson 1970; Corbet 1978): M. m. melampus on Honshu, Shikoku, and Kyushu; M. m. tsuensis on Tsushima Island; M. m. coreensis on the Korean Peninsula (although the reliability of its identity is still con- troversial). Martes zibellina shows within population, regional, and seasonal variation in fur color and quality (Ognev 1931; Stroganov 1962; Anderson 1970). In winter, the sable’s fur color ranges from light yellow or grayish brown, often with a russet tinge, to dark blackish- brown. A very dark and silky fur characterizes the sables occurring in Transbaikalia and southern Yakutia, Russia, while from the west to east the color gradually becomes paler, and the fur becomes coarser. In general, however, there is considerable fur color variations within populations (Stroganov 1962). Martes zibellina of Hokkaido also shows fur color variation, from pale yellow, to cork colored, and to dark brown (Imaizumi 1986). The color of those with yellowish fur is indistinguishable from yellow specimens of M. melampus from northern Honshu. Martes melampus from Kyushu and Honshu (except for the southern part of the Kii Peninsula), having body fur which changes from dark brown to yellow in winter, tends to show some regional variation in fur color (Hosoda and Oshima 1993). The head remains light gray, and the legs are dark brown. Individuals from the the Tohoku region of northern Honshu are a particularly vivid yellow. In contrast, individuals from the southern Kii Peninsula, from Shikoku and Tsushima, remain dark brown throughout the winter, although the throat is either yellow or pale yellow (Hosoda and Oshima 1993). The evolutionary history of these two closely related species remains largely unknown, and no evaluations of genetic differen- tiation among the regional populations based on fur-color variation have been made. Martes melampus have been introduced to various parts of Japan where this species did not occur naturally, in particular to Sado Island and Hokkaido. Just before World War II, M. melampus was introduced from the Tohoku region to a breeding farm near Sapporo, Hokkaido. When feed became unavailable during the war, the animals were released into the wild (Inukai 1975). That they and their descendants survived, and are still being ob- served in southern Hokkaido has been noted by Inukai (1975) and Kadosaki (1996). Given that the two species are thought to have a similar chromosomal constitution, with the same diploid number and fundamental arm number, then hybridization may have occurred or be occurring between the Hokkaido native M. z. brachyura and introduced M. melampus (Tsuchiya 1979; Obara 1982, 1991; Tsuchiya unpublished). Natural hybrid between the two sympatric Martes species, M. zibellina and the pine marten M. martes in the Pechora Basin and the trans-Urals of Russia, have been reported (Ognev 1931; Novikov 1962; see for review Anderson 1970; Corbet 1978). Thus hybridization between sympatrically occuring closely related Martes species is not only possible, but also perhaps even likely. Two molecular markers have been used so far in evaluating the genetic relationship between M. melampus and M. zibellina, firstly the restriction fragment length polymorphism (RFLP) of the nuclear ribosomal DNA (rDNA) spacer (Hosoda et al. 1993, 1997), and secondly the mitochondrial cytochrome b (cyt b) gene sequences (Masuda and Yoshida 1994b). We used these markers to reveal the extent of intra- and inter-specific variation between the two species. We also examined one M. melampus from Hokkaido genetically, Hosoda et al., Genetic relationships of martens in Japan 27 and discussed the possibility of interspecies hybridization in nature. Materials and methods DNA samples DNA was extracted from liver tissues of M. zibellina and M. melampus from a range of localities, using the method described by Maniatis et al. (1982) (see Table 1 and Fig. 1). Direct sequencing of cyt b gene Semi-nested polymerase chain reactions (PCRs), and direct sequencing were performed following methods previously described by Suzuki et al. (1997). The universal primers L14724 and H15915 (Kocher et al. 1989) were used for the first PCR, and R-L14724 and U- H15155 (Suzuki et al. 1997) were used for the second PCR. Then both strands of the second PCR product were sequenced directly by an automated sequencer (model 373A; ABI). Table 1. Profiles of samples used and specific types of mtDNA. Genus Species Serial no. and locality Sample no. Sex Type of mtDNA Martes M. zibellina 1. Khabarovsk, Russia VK183 unknown Mzil HS949 unknown Mzi2 2. Hokkaido, Japan TH043 male Mzi3 TH044 male Mzi3 TH045 male Mzi3 TH047 male Mzi3 TH053 male Mzi3 TH107 male Mzi3 HEG293 male Mzi3 M. melampus 3. Hokkaido, Japan TH048 male Mmel 4. Tochigi, Japan THO17 female Mmel 5. Niigata, Japan THO006 male Mmel 6. Wakayama, Japan TH020 male Mmel 7. Shimane, Japan THO18 male Mmel 8. Miyazaki, Japan HS862 male Mmel 9. Tokushima, Japan TH131 male Mmel TH176 male Mmel THO10 male Mme2 TH175 female Mme2 10. Tsushima Is., Japan TH004 female Mme3 THO005 male Mme3 THO007 male Mme3 Mustela M. itatsi 11. Aomori, Japan THO089 male Mit M. sibirica 12. Vladivostok, Russia HS1223 male Msi 28 Mammal Study 24 (1999) Russia Sado Island 1 ae. 5 a Kui Peninsula 125° E 130° 135° 140° 145° Fig. 1. Localities from which individuals of Martes zibellina (closed circles) and M. melampus (open circles) were collected for this study. (Numbers beside collection points refer to Table 1). Construction of phylogenetic trees We produced a matrix of sequence divergence for all possible combinations of mtDNA sequences (Table 1) using the computer program DNADIST in PHYLIP 3.5 (Felsenstein 1993) and Kimura’s two parameter method (Kimura 1980). We constructed a phylogenetic tree using the neighbor-joining (NJ) method (Saitou and Nei 1987) using the computer pro- gram NEIGHBOR in PHYLIP 3.5. Confidence levels for each grouping were calculated using the bootstrap program SEQBOOT (with 1,000 replications) in the PHYLIP package. The tree was produced using the CONSENCE program in the PHYLIP package. Analysis of rDNA RFLP Variations in rDNA were examined using Southern’s blot analysis (Southern 1975). For the construction of restriction maps of the various types of rDNA repeating units, the genomic DNAs were digested with twelve restriction enzymes: Aatl, BamHI, Bcll, Bell, Dral, EcoRI, HindIll, Kpni, PstI, Pvull, Sacl and Xbal. The digested DNAs blotted on nylon filters were hybridized sequentially with three 32P-labeled rDNA probes as described by Hosoda et al. (1993). Hosoda et al., Genetic relationships of martens in Japan Results Variations in mtDNA We determined partial sequences (402 base pairs (bp)) of cyt b genes of 22 martens, and two weasels (Mustela sibirica and M. itatsi) as an outgroup (Table 1, Fig. 2), and calculated the sequence divergence. Based on the extent of the sequence divergence, we constructed a phylogenetic tree using the NJ method (Fig. 3). The sequence divergence between Martes melampus and M. zibellina was 2.6-3.9% (3.3% on average), which was similar to the degree of divergence found between M. sibirica (Msi) and M. itatsi (Mit), 4.3%. Both M. melampus (Mme) and M. zibellina (Mzi) had three haplotypes (Mmel, Mme2, Mme3 and Mzil, Mzi2, Mzi3). Martes melampus of Honshu (Niigata, Tochigi, Shimane and Wakayama prefectures) and Kyushu (Miyazaki) were monomorphic (Mmel only), while the Shikoku population had two haplotypes (Mmel and Mme2), and two individuals from Tsushima 10 20 30 40 50 60 70 80 Mzil ATGACCAACA TTCGTAAAAC TCACCCACTA GCTAAAATCA TCAACAATTC ATTCATCGAC TTACCTGCCC CATCAAACAT [MP2ILZ):. igs GIGUCECE CRORE RRC RCE RRO MZOOMMEMEEONcislecc los heice eee e sweenls gues 6 Ba Giore evade ely Tete altete Goetare el Yaie oreo ew Se esse miele’ ue: avaetheterie ere 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 Fig. 2. Partial sequences of the mitochondrial cytochrome b gene for martens and the outgroup, Mustela. The abbreviations of the gene types are as in Table 1. 30 Mammal Study 24 (1999) Aomori (TH089) Mit Mustela itatsi Russia (HS1223) Msi Mustela sibirica Hokkaido (TH048) Niigata(TH006) Tochigi (TH017) Wakayama (TH020) Shimane (TH018) Tokushima (TH131) Tokushima (TH176) Martes melampus Miyazaki (HS862) Tokushima (TH010) 631 Tokushima (TH175) | Mme2 Tsushima (TH004) 100 70] Tsushima (TH005) Mme3 Tsushima (TH007) Mmel 97 Russia (VK183) Mzil Russia (HS949) Mzi2 99 Hokkaido (TH043) Hokkaido (TH044) Hokkaido (TH045) Hokkaido (TH047) Mzi3 Hokkaido (TH053) Hokkaido (TH107) Hokkaido (HEG293) 0.01 93 Martes zibellina Fig. 3. A neighbor-joining tree constructed from the cytochrome b gene sequences (402 bp) of 22 individuals of Martes. Two species of Mustela were used as an outgroup. The bootstrap scores above each branch are expressed in percentages of 1,000 replicates. possessed one specific type, Mme3. All seven animals of M. zibellina from Hokkaido shared a common sequence (Mzi3), while two individuals from Khabarovsk had different types (Mzil and Mzi2) revealing a rather considerable extent of intra-population variation (1.0% sequence divergence). There was, however, only 0.2% (1/402 bp) sequence divergence be- tween one of the continental types, Mzi2, and the Hokkaido type, Mzi3. Variation in rDNA We examined the nuclear rDNA-RFLP with 12 restriction enzymes and compared 24 restriction sites along with the external spacer regions of rDNA from 14 M. melampus and M. zibellina (Table 1). As Hosoda et al. (1993) reported, only the BglII site(s) located up- stream from the 5’ end of the 18S rRNA gene differs between the two species: 19 kb for M. melampus and 15 kb for M. zibellina. We found no variation within the species. Martes melampus in Hokkaido Since one yellow animal, obtained from Sapporo, was morphologically similar to M. melampus, we examined genetic characteristics of the two molecular markers. It proved to have a cyt b sequence Mmel specific to M. melampus (Table 1). With the 18S rDNA probe, the 19kb Beg/II band was detected, but the 15 kb band, which is specific to M. zibellina, was definitely absent. Since patterns of nuclear rDNA may reflect a specific kind of genomic status (i.e., the band represents a hundred copies of repeating units that are generally dis- Hosoda et al., Genetic relationships of martens in Japan 31 persed among different chromosome loci), the rDNA profile is likely to indicate the status of most of the other nuclear genes in this individual. Discussion Interspecies relationships One of our aims in this study was to evaluate the genetic relationship between M. melampus and M. zibellina in Hokkaido, from both evolutionary and current perspectives. The extent of the divergence of the cyt b gene (3.3%) between these two species was almost the same as the divergence between the Japanese and Siberian weasels (Fig. 3; Masuda and Yoshida 1994a). Masuda and Yoshida (1994a) estimated, on the basis of the sequence divergence of the cyt b gene region (375 bp) is 4.0-4.3%, that the split between the two weasel species occurred some 1.6-1.7 million years ago. The differentiation of the two marten species is also evident from the rDNA-RFLP data (Hosoda et al. 1993), leading us to presume that these two species have also genetically differentiated considerably, during the last one or two million years. Although the existence of land bridges between Honshu and Hokkaido during recent ice ages may have presented several opportunities for hybridization, it is also possible that the two species could have maintained their own genetic independence without exchanging genetic elements. In order to evaluate the possibility of genetic hybridization between the two species under natural condition, it was necessary to examine individuals from a site where both species occur. Considering the limited literature available (Inukai 1975) and the patterns of mtDNA and rDNA, it seemed most likely that M. melampus from Sapporo, in western Hokkaido, would be the descendants of translocated martens from Honshu which were then released or escaped from fur farms half a century ago. We did not find any sign of interspecific hybridization in this sample, or among seven sable from Teshio (northern Hokkaido), indicating that hybridization between these two species is unlikely. As there have been, however, several cases of natural hybridization between continental martens, such as between M. zibellina and M. martes (Anderson 1970; Corbet 1978), a continuous survey of a suitable sample size is necessary to finally conclude the possibility of natural hybridization between M. melampus and M. zibellina. Such a study would also be useful for estimating the risk of genetic contamination through introduced animals. Geographic variation Mitochondrial DNA sequence variation within each species was not great (Fig. 3). Martes melampus tsuensis from Tsushima are distinguishable as a separate subspecies from other geographic populations on the basis of their morphological differences (see Introduc- tion, Anderson 1970). The types of mtDNA differed only slightly between the subspecies, with only one base substitution among the 402 bp sequence. This result suggests that there has been some recent (in geological terms) genetic exchange between the Tsushima and mainland Japanese populations of this species, probably during the late Pleistocene. We examined M. zibellina from just two localities, Teshio, in Hokkaido (seven indi- viduals), and Khabarovsk, Russia (two individuals); and found no substantial differences in the cyt b of the two populations. The Hokkaido type Mzi3 differed from the Russian type Mzi2 by only one base among the 402 sites (Fig. 2), indicating that there has been recent 25 Mammal Study 24 (1999) divergence between Hokkaido and the Russian Far East populations. In the case of the red fox, Vulpes vulpes, the mtDNA D-loop sequences of individuals from Hokkaido and from the Russian Far East are involved in a clade with a small extent of polymorphism (Tsuda et al. 1997). These results, for both fox and sable, are consistent with the fact that Hokkaido was periodically connected to the continent by ice age land bridges, and only finally isolated within the last 10,000 years (e.g. Oshima 1990). It is now evident that carnivorous mammals ranged across both the Russian Far East and Hokkaido exchanging genetic elements between these now isolated geographic regions, during a geologically recent period. Acknowledgements: The authors are very grateful to Drs. Alexei P. Kryukov, Sang-Hoon Han, Vladimir P. Korablev, Toru Ikeda, Koji Uraguchi, Hisashi Yanagawa and Mr. Mitsuru Mukoyama for supplying tissue samples and morphological information on specimens. We also thank Dr. Hisashi Abe and Mr. Masayoshi Tawara for providing information on the history of the Japanese marten introduction to Hokkaido. We are very grateful to Dr. Mark Brazil for improving the English manuscript. This study was partly funded by Grants-in-Aid for Scientific Research from the Ministry of Education, Science and Culture, Japan. The nucleotide sequences can be reached in the DDBJ, EMBL and Gen Bank with following accession numbers: AB029420-AB029422, AB029424-AB029428. References Anderson, E. 1970. Quarternary evolution of the genus Martes. (Carnivora, Mustelidae). Acta Zoologica Fennica 130: 1-133. Corbet, G. B. 1978. The mammals of the Palaearctic Region: a taxonomic review. British Museum Natural History London, 314 pp. Felsenstein, J. 1993. PHYLIP: Phylogenetic inference package, version 3.5. Department of Genetics, University of Washington, Seattle. Hosoda, T., Suzuki, H., Yamada, T. and Tsuchiya, K. 1993. Restriction site polymorphism in the ribosomal DNA of eight species of Canidae and Mustelidae. Cytologia 58: 223-230. Hosoda, T. and Oshima, K. 1993. Color variation of the fur of Japanese marten (Martes melampus melampus Wagner) in Japan. Nankiseibutu 35: 19-23 (in Japanese with English summary). Hosoda, T., Suzuki, H., Tsuchiya, K., Lan, H., Shi, L. and Kryukov, A. P. 1997. Phylogenetic relationships within Martes based on nuclear ribosomal DNA and mitochondrial DNA. In (G. Proulx, H. N. Bryant, and P.M. Woodard., eds.) Martes: Taxonomy, Ecology, Techniques, and Management. Pp. 3-14. Provincial Museum of Alberta, Edmonton. Imaizumi, T. 1986. Weasels and Martens. Jiyukokuminsha, 126 pp. (in Japanese). Inukai, T. 1975. Animals in the Northernmost Japan, Hokuensha, 152 pp. (in Japanese). Kadosaki, M. 1996. Wild Traces in Hokkaido, Hokkaido-shuppan, 303 pp. (in Japanese). Kimura, M. 1980. A simple method for estimating evolutionary rates of base substitutions through comparative studies of nucleotide sequences. Journal of Molecular Evolution 16: 111-120. Kocher, T. D., Thomas, W. K., Meyer, A., Edwards, S. V., Paabo, S., Villablanca, F. X. and Wilson, A. C. 1989. Dynamics of mitochondrial DNA evolution in mammals: amplification and sequencing with conserved primers. Proceedings of National Academy of Science, USA 86: 6196-6200. Maniatis, T., Fritsch, E. F. and Sambrook, J. 1982. Molecular Cloning. Cold Spring Harbor. New York, 545 pp. Masuda, R. and Yoshida, M. C. 1994a. Nucleotide sequence variation of cytochrome b genes in three species of weasels, Mustela itatsi, Mustela sibirica, and Mustela nivalis, detected by improved PCR product-direct se- quencing technique. Journal of the Mammalogical Society of Japan 19: 33-43. Masuda, R. and Yoshida, M. C. 1994b. A molecular phylogeny of the family Mustelidae (Mammalia, Carnivora), based on comparison of mitochondrial cytochrome b nucleotide sequences. Zoological Science 11: 605-612. Hosoda et al., Genetic relationships of martens in Japan 33 Novikov, G. A. 1962. Fauna of the U.S.S.R.62. Carnivorous mammals. Israel Scientific Translations Program, Jerusalem, 816 pp. Obara, Y. 1982. C- and G-banded karyotypes of the Japanese marten, Martes melampus melampus. Chromosome Information Service 33: 21-23. Obara, Y. 1991. Karyosystematics of the mustelid carnivores of Japan. Honyurui Kagaku [Mammalian Science] 30: 197—220 (in Japanese). Ognev, S. I. 1931. Mammals of Eastern Europe and Northern Asia. Vol. II. Carnivora (Fissipedia). (1962, Israel Scientific Translations Program, Jerusalem), 589 pp. Oshima, K. 1990. The history of straits around the Japanese islands in the Late-Quaternary. The Quaternary Research 29: 193-208 (in Japanese with English abstract). Saitou, N. and Nei, M. 1987. The neighbor-joining method: a new method for reconstructing phylogenetic trees. Molecular Biology and Evolution 4: 406-425. Southern, E. M. 1975. Detection of specific sequences among DNA fragments separated by gel electrophoresis. Journal of Molecular Evolution 98: 503-517. Suzuki H., Minato, S., Sakurai, S., Tsuchiya, K. and Fokin, I. M. 1997. Phylogenetic position and geographic differentiation of the Japanese dormouse, Glirulus japonicus, revealed by variations among rDNA, mtDNA and the Sry gene. Zoological Science 14: 167-173. Stroganov, S. U. 1962. Carnivorous Mammals of Siberia. (1969, Israel Scientific Translations Program, Jerusalem), 522 pp. Tsuchiya, K. 1979. A contribution to the chromosome study in Japanese mammals. Proceeding of the Japan Academy 55(B): 191-195. Tsuda, K., Kikkawa, Y., Yonekawa, H. and Tanabe, Y. 1997. Extensive interbreeding occurred among multiple matriarchal ancestors during the domestication of dogs: Evidence from inter- and intraspecies polymorphisms in the D-loop region of mitochondrial DNA between dogs and wolves. Genes and Genetic Systems 72: 229-238. Received 21 August 1998. Accepted 12 May 1999. ieee Gir alt eau = ay ‘he y i] ‘ . } ed z N) a } Par ane nes “ mid ae ¥ 9 Rs X pes a saa i i } “ - \= - i Wh XK a i SN Pcs he ‘Sion yrlialay vai ry. oT ae anus, Mammal Study 24: 35-41 (1999) © the Mammalogical Society of Japan A karyological analysis of the Korean red-backed vole, Eothenomys regulus (Rodentia, Muridae), using differential staining methods Masahiro A. Iwasa!, Sang Hoon Han? and Hitoshi Suzuki? 130 aboratory of Ecology and Genetics, Graduate School of Environmental Earth Science, Hokkaido University, Sapporo 060-0810, Japan Ecosystem Conservation Division, Ministry of Environment, 1, Joongang-dong, Kwacheon, Kyunggi- do 427-760, Korea Abstract. The conventional and G- and Q-banded karyotypes of the Korean red-backed vole Eothenomys regulus (2n=56) are described here for the first time. The autosomes were found to be composed of 26 pairs of acrocentrics and one pair of metacentrics, as in other species of red-backed voles. Side-by-side pair-matching analysis revealed that the G-band- ing patterns of E. regulus were essentially identical to those of the grey red-backed vole Clethrionomys rufocanus, and therefore the karyotype of E. regulus was of a “rufocanus” type, not of a “glareolus” type, which is characterized by 1-9 translocation. The sex chro- mosomes of FE. regulus were found to be composed of a large subtelocentric X chromosome and a medium-sized subtelocentric Y chromosome, closely resembling those of FE. smithii in both size and morphology. Both X and Y sex chromosomes were indistinguishable between these species, as far as conventional staining is concerned. Further analysis indicated, how- ever, that E. regulus’ Y chromosome has a large C-band area on the terminal half of its long arm, whereas E. smithii has a large C-band area on the proximal half of its long arm. Such C-band patterning implies the involvement of the Y chromosome in paracentric inver- sion during the course of speciation. Key words: karyotype, Eothenomys regulus, the Korean red-backed vole, sex chromosomes. The Korean red-backed vole was first described as Craseomys regulus by Thomas (1907), on the basis of the type specimen collected at Min-gyong, Korea. Now, this species is widely regarded as belonging to the genus Eothenomys (Corbet 1978; Kaneko 1990; Corbet and Hill 1991; Musser and Carleton 1993), although on the basis of molecular data from mitochon- drial, and nuclear ribosomal DNA, its inclusion in the genus Clethrionomys has also been proposed (Wakana et al. 1996; Suzuki et al. 1999). Thus the taxonomic status of this vole remains uncertain. With the exception of the Korean species, the karyotypes of all of the East Asian red-backed vole species have been studied. Differential staining methods have shown that all of them share the same diploid number 2n=56 with essentially 26 pairs of 1F-mail: masahiro@ees.hokudai.ac.jp 2Present address: Wildlife Information and Research Centre, Chongnyang, Tongdaemun-ku, Seoul 130-011, Korea 36 Mammal Study 24 (1999) acrocentrics (or subtelocentrics) and one pair of metacentrics, showing a high degree of karyotypic similarity (Tsuchiya 1981; Ando et al. 1988; Kashiwabara and Onoyama 1988; Yoshida et al. 1989; Sokolov et al. 1990; Obara et al. 1995; Kitahara and Harada 1996). Detailed G-banding analysis has revealed, however, that the red-backed vole species complex can be divided, karyologically, into two groups, the “glareolus” and the “rufocanus” groups (Gamperl 1982; Iwasa 1998). The “glareolus” group is characterized by the 1-9 translocation which can be seen in C. glareolus, C. rutilus, C. gapperi and C. californicus (Modi 1987; Modi and Gamperl 1989; Obara et al. 1995), whereas the “rufocanus” group (C. rufocanus, C. rex (dealt with as a synonym of C. montanus) and two Japanese species E. andersoni and E. smithii) shows no such translocation (Obara 1986; Ando et al. 1988; Kashiwabara and Onoyama 1988; Yoshida et al. 1989; Sokolov et al. 1990; Obara et al. 1995; Kitahara and Harada 1996). The purpose of this study was to make the first examination of the karyotype of E. regulus, and to compare it with those of related species, so as to be able to ascertain, from a cytogenetic perspective, the phylogenetic position of E. regulus among the East Asian red- backed vole species. Materials and methods Two male Eothenomys regulus were captured, using Sherman live-traps, at Tonmyon-ri, Sesanmyon, Ponghwa-gun, Kyongsangbuk-do, Korea. They were identified on the basis of their cranial and dental characteristics as described by Kaneko (1990) (see Table 1 and Fig. 1), and preserved in 70% ethanol as specimens HEG22-97 and HEG49-97. Six HEG22-97 = HEG49-97 Fig. 1. Enamel patterns of the right upper molars of the Eothenomys regulus specimens examined in this study. (Arrowheads indicate the fourth outer small salient angle. Bar=1mm. See Table 1 for specimen number). Iwasa et al., Karyotype of Eothenomys regulus 37 Table 1. Morphological measurements of the Korean red-backed vole, Eothenomys regulus, examined in this study. Specimen No. Sex Capturing date T.L. (mm) T. (mm) T.R. (%) H.F. (mm) HEG22-97 male 25 Apr. 1997 142.5 36.0 33.8 19.3 HEG49-97 male 24 Apr. 1997 141.0 40.0 39.6 18.2 T.L.: Total length; T.: Tail length; T.R.: Tail rate; H.F.: Hind foot length. Table 2. Number of cells observed. Specimen No. Conv. Giemsa G-band Q-band C-band HEG22-97 30 15 28 16 HEG49-97 62 36 115 2D total 92 51 143 38 Clethrionomys rufocanus collected in Hokkaido, and six E. smithii collected in Shikoku, were used for a comparison of the sex chromosomes. Chromosome preparations were made from bone marrow cells after short-term culture (40 min at 37°C) in MEM containing 15% fetal calf serum and colchicine (final concentration 0.025 g/ml). The bone marrow cells were treated in 0.075 M KCI at 37°C for 18 min, followed by fixation with Carnoy’s fixative (methanol: acetic acid = 3:1). Cell suspensions were dropped on slides and air-dried. Chromosomes were analyzed by both conventional and differential staining methods. For the latter staining method C-, Q- and G-bands were examined following methods described by Caspersson et al. (1971), Sumner et al. (1971) and Sumner (1972; see Table 2). Results and discussion Two red-backed vole specimens collected from the Korean Peninsula were examined in- tensively in order to determine their specific identification on the basis of their morphological features since two very similar species of voles, E. regulus and C. rufocanus, have been reported from the region (Corbet 1978). The two species closely resemble each other in morphology, but E. regulus has a specific “complex form” of enamel patterning on the upper third molar (Kaneko 1990), which is distinguishable from that of C. rufocanus. Our two specimens both had “complex form” upper third molars (Fig. 1), and so were confirmed as E. regulus (Kaneko 1990). Eothenomys regulus was confirmed as having 26 pairs of acrocentrics and one pair of metacentrics, which was the smallest pair in the complement (Fig. 2a). The autosomes and the X chromosome (excluding its short arm) had G-banding patterns identical with those of C. rufocanus (Fig. 3) and other Japanese red-backed vole species. Thus, karyologically, E. regulus belongs to the “rufocanus” group, which has no 1-9 translocations (Gamperl 1982; Obara et al. 1995). As expected, the Q-banding patterns (Fig. 2b) were almost identical to the G-banding patterns (Fig. 3); the bright bands basically corresponded to G-positive bands. Centromeric regions showed dull fluorescence in all chromosomes after Q-banding. In contrast to the highly consistent constitution of the autosomes of red-backed vole species, the sex chromosomes showed both inter- and intraspecific variation. The sex chro- 38 Mammal Study 24 (1999) =o eee MoM ton Orsay Ab Ah Oh Wk Oe Fig. 2. Conventionally stained (a) and Q-banded (b) karyotypes of Eothenomys regulus. mosomes of E. regulus proved to be composed of a large subtelocentric X and a medium- sized subtelocentric Y chromosome. Such a combination is markedly different from the XY chromosomes of C. rufocanus, which has a large acrocentric X and a small acrocentric Y chromosome (Fig. 4). Two distinct karyological forms of E. smithii have been reported, one with a small Y chromosome (the so-called smithii form of south-western Honshu and Shikoku (Fig. 4; Ando et al. 1988), and the other with a large Y chromosome the kageus form of central Honshu (Ando et al. 1988). The Y chromosome of E. regu/us was equiva- lent in length to that of the small smithii form of E. smithii. A detailed comparison of the C-bands of E. regulus and E. smithii indicated, however, the possibility of a structural rear- Iwasa et al., Karyotype of Eothenomys regulus 39 He Ne 1 2 3 NS O1 (@p) >, “ae OO — 2 O <= fs 0! Of ff ga Oh bt Bh oe 11 12 13 4 +15 +=t6 =~ 617f—h618—6~—=619)— 20 fy Wa Sh #6 Bh Oa we i of Z| 22 23) 24 25 26 27 X Y Fig. 3. Composite karyotype of Clethrionomys rufocanus and Eothenomys regulus prepared by side-by-side arrangement on the basis of G-band homology. (Left = C. rufocanus. Right = E. regulus. The asterisk indi- cates overlapping chromosomes). rangement of the Y chromosome. The Y chromosome of FE. regulus has a large C-band area on the terminal half of its long arm, whereas that of E. smithii has a similarly sized C-band on the proximal half of its long arm (Fig. 5). Similar C-band patterns in E. smithii have also been described by Ando et al. (1988) and Yoshida et al. (1989). Such interspecific differences in C-banding patterns can be explained by the occurrence of paracentric inversion involving most of the long arm of the Y chromosome during the course of speciation (Fig. 5). The Y chromosome morphology suggests a closer relationship between E. regulus and E. smithii than with C. rufocanus, in which the Y chromosome is small and metacentric in the Primorskyi region of Russia, and small and acrocentric in Hokkaido, Japan (Vorontsov et Lt Crf Erg Esm Fig. 4. Conventionally stained X and Y chromosomes of Clethrionomys rufocanus (Crf), Eothenomys regulus (Erg) and E. smithii (Esm). 40 Mammal Study 24 (1999) paracentric Inv. E. regulus : E. smithit Fig. 5. C-banding patterns in the X and Y chromosomes of Eothenomys regulus and E. smithii shown by photo- graphs and ideograms. al. 1980; Tsuchiya 1981; Obara 1986; Yoshida et al. 1989). This chromosomal evidence is consistent with the fact that adult E. regulus and E. smithii both have rootless molars. In contrast, however, molecular phylogenetic data, on the variation of nuclear ribosomal and mitochondrial DNA, suggests a closer relationship between FE. regulus and C. rufocanus, than with E. smithii (Wakana et al. 1996; Suzuki et al. 1999). The Shikoku E. smithii population, however, has specific mitochondrial sequences that differ from those of the Honshu and Kyushu populations, but which show affinities with those of both C. rufocanus and E. regulus (Suzuki et al. 1999). Thus, the phylogenetic relationships of these three red- backed voles, E. regulus, E. smithii and C. rufocanus are extremely complicated and as yet unresolved. Our cytogenetic and molecular findings indicate that interspecific genetic exchange may have played at least a partial role in complicating the genetic constitution of these three red-backed vole species. An analysis of the sequence variations in the genes specific to the X and Y chromosomes, and molecular cytogenetic analysis of the Y chro- mosomal C-heterochromatin, is considered likely to yield valuable information towards a more precise understanding of the phylogenetic relationships of these species. We are cur- rently in the process of examining the relationships between the red-backed voles from these standpoints. Acknowledgements: The authors are grateful to Dr. Yoshitaka Obara of Hirosaki Univer- sity for his continuous encouragement throughout this study. We also thank Mr. C.C. Yoon for his kind co-operation in collecting animals at Tonmyon-ri, Kyongsangbuk-do, Korea. This study partly supported by a Grants-in-Aid for Scientific Research from the Ministry of Education, Science and Culture, Japan. Iwasa et al., Karyotype of Eothenomys regulus 41 References Ando, A., Shiraishi, S., Harada, M. and Uchida, T. A. 1988. A karyological study of two intraspecific taxa in Japanese Eothenomys (Mammalia: Rodentia). Journal of the Mammalogical Society of Japan 13: 93-104. Caspersson, T., Lomakka, G. and Zech, L. 1971. The 24 fluorescence patterns of the human metaphase chro- mosomes-distinguishing characters and variability. Hereditas 67: 89-102. Corbet, G. B. 1978. The Mammals of the Palaearctic Region: a Taxonomic Review. Brit. Mus. (Nat. Hist.) & Cornell Univ. Press, London & Ithaca, 314 pp. Corbet, G. B. and Hill, J. E. 1991. A World List of Mammalian Species, 3rd edn. Oxford University Press, Oxford, 243 pp. Gamperl, R. 1982. Chromosomal evolution in the genus Clethrionomys. Genetica 57: 193-197. Iwasa, M. A. 1998. Chromosomal and molecular variations in red-backed voles. Honyurui Kagaku [Mammalian Science] 38: 145-158 (in Japanese with English abstract). Kaneko, Y. 1990. Identification and some morphological characters of Clethrionomys rufocanus and Eothenomys regulus from USSR, northeast China and Korea in comparison with C. rufocanus from Finland. Journal of the Mammalogical Society of Japan 14: 129-148. Kashiwabara, S. and Onoyama, K. 1988. Karyotypes and G-banding patterns of the red-backed voles, Clethrionomys montanus and C. rufocanus bedfordiae (Rodentia, Microtinae). Journal of the Mammalogical Society of Japan 13: 33-41. Kitahara, E. and Harada, M. 1996. Karyological identity of Anderson’s red-backed voles from the Kii peninsula and central Honshu in Japan. Bulletin of the Forestry and Forest Products Research Institute No. 370: 21-30. Modi, W.S. 1987. Phylogenetic analyses of chromosomal banding patterns among the Nearctic Arvicolidae (Mammalia: Rodentia). Systematic Zoology 36: 109-136. Modi, W.S. and Gamperl, R. 1989. Chromosomal banding comparisons among American and European red- backed mice, genus Clethrionomys. Zeitschrift fiir Sdugetierkunde 54: 141-152. Musser, G. G. and Carleton, M. D. 1993. Family Muridae. In (D. E. Wilson and D. A. Reeder, eds.) Mammal Species of the World. A Taxonomic and Geographic Reference. 2nd edn. Pp. 501-755. Smithsonian Institution Press, Washington and London. Obara, Y. 1986. G-band homology between the Japanese red-backed vole, Clethrionomys a. andersoni and the grey red-backed vole, C. rufocanus. Chromosome Information Service 40: 7-9. Obara, Y., Kusakabe, H., Miyakoshi, K. and Kawada, S. 1995. Revised karyotypes of the Japanese northern red- backed vole, Clethrionomys rutilus mikado. Journal of the Mammalogical Society of Japan 20: 125-133. Sokolov, V. Ye., Aniskin, V. M. and Serbenyuk, M. A. 1990. Comparative cytogenetics of 6 species of the genus Clethrionomys (Rodentia, Microtinae). Zoologicheskii Zhurnal 69: 145-151 (in Russian with English summary). Sumner, A. T. 1972. A simple technique for demonstrating centromeric heterochromatin. Experimental Cell Research 75: 304-306. Sumner, A. T., Evans, H. J. and Buckland, R. A. 1971. New technique for distinguishing between human chro- mosomes. Nature New Biology 232: 31-32. Suzuki, H., Iwasa, M., Harada, M., Wakana, S., Sakaizumi, M., Han, S.H., Kitahara, E., Kimura, Y., Kartavtseva, I. V. and Tsuchiya, K. 1999. Molecular phylogeny of red-backed voles in Far East Asia based on variation in ribosomal and mitochondrial DNA. Journal of Mammalogy 80: 512-521. Thomas, O. 1907. The Duke of Bedford’s zoological exploration in eastern Asia. II. List of small mammals from Korea and Quelpart. Proceedings of Zoological Society of London, 1906: 858-865. Tsuchiya, K. 1981. On the chromosome variations in Japanese cricetid and murid rodents. Honyurui Kagaku [Mammalian Science] 42: 51—58 (in Japanese). Vorontsov, N. N., Lyapunova, E. A., Borissov, Y. M. and Dovgal, V. E. 1980. Variability of sex chromosomes in mammals. Genetica 52/53: 361-372. Yoshida, I., Obara, Y. and Matsuoka, N. 1989. Phylogenetic relationships among seven taxa of the Japanese microtine voles revealed by karyological and biochemical techniques. Zoological Science 6: 409-420. Wakana, S., Sakaizumi, M., Tsuchiya, K., Asakawa, M., Han, S.H., Nakata, K. and Suzuki, H. 1996. Phylogenetic implications of variations in rDNA and mtDNA in red-backed voles collected in Hokkaido, Japan, and in Korea. Mammal Study 21:15 —25. Received 17 February 1999. Accepted 20 May 1999. Me > = int >: < sce! ' carpi de weuid A ic set. an oa et . bie. sos onal i Hea Mammal Study 24: 43-50 (1999) © the Mammalogical Society of Japan The genetic status of two insular populations of the endemic spiny rat Tokudaia osimensis (Rodentia, Muridae) of the Ryukyu Islands, Japan Hitoshi Suzuki!, Masahiro A. Iwasa?, Nobuo Ishii*?, Hiroko Nagaoka‘ and Kimiyuki Tsuchiya? 1,2Graduate School of Environmental Earth Science, Hokkaido University, North 10, West 5, Kita-ku, Sapporo 060-0810, Japan 3,4Japan Wildlife Research Center, Yushima 2-29-3, Bunkyo-ku, Tokyo 113-0034, Japan Experimental Animal Center, Miyazaki Medical College, 5200 Kihara, Kiyotake-cho, Miyazaki 889- 1692, Japan Abstract. We examined the geographic variation of Zokudaia osimensis through the analy- sis of mitochondrial cytochrome b (cyt b) gene sequences and the restriction fragment length polymorphism (RFLP) in the nuclear ribosomal RNA gene (rDNA), using samples collected from Tokuno-shima and Amami-oshima in the Ryukyu Islands. The two populations show intrinsic karyological variation (Tokuno-shima, 2n=45; Amami-oshima, 2n=25). Sequences of the cyt b gene differed considerably between the two island populations. The extent of the sequence divergence among 1,140 bp of the gene was calculated to be 0.088 using the Kimura two parameter method, and was comparable to those between related species of rodents such as within genus Mus or Rattus. The extent of the differentiation in the rDNA-RFLP was also high. Three out of 22 restriction site variants were found to be fixed in the nuclear rDNA arrays of hundreds of copies in either one of the two island populations. These intensive inter-populational differences indicate that the two island populations may have been isolated for a considerable period of evolutionary time, probably several millions of years, despite there having been several opportunities for renewed genetic contact during the Pleistocene ice ages. Our data strongly suggest that the current taxo- nomic status of the populations of the two islands, Amami-oshima and Tokuno-shima, which regards them conspecific, should be reviewed. Key words: geographic variation, cytochrome Db gene, nuclear rDNA-RFLP, Ryukyu Islands, Tokudaia osimensis. The Nansei Shoto or Ryukyu Islands, Japan’s southernmost islands, harbor a unique fauna and flora, and the central region, consisting of the three islands of Amami-oshima, Tokuno-shima and Okinawa and adjacent islets, is especially rich and a center of endemism. Three genera of the following mammals are endemic to this small area of islands: the Ryukyu spiny rat Tokudaia osimensis; the Ryukyu long-haired rat Diplothrix legata; and the Amami 1E-mail: htsuzuki@ees.hokudai.ac.jp 44 Mammal Study 24 (1999) rabbit Pentalagus furnessi (Corbet and Hill 1991; Musser and Carleton 1993; Hoffmann 1993; Abe 1994; Kaneko and Murakami 1996). Because of their uniqueness and zoological importance, all three are protected as natural monuments by the Japanese government and also regarded as endangered species (IUCN 1996; Kawamichi 1997). These three species are also considered to be symbolic of the significant biodiversity of the Central Ryukyus, and for the conservation of the fauna of the islands. Moreover, their distribution and status provides invaluable information towards an understanding of the historical episodes of the Ryukyu fauna as well as contributing to an understanding of general evolutionary issues. Tokudaia osimensis, in particular, raises various interesting scientific issues. The species shows intrinsic karyological features in its autosomes and sex chromosomes, with the diploid numbers of both females and males being 44 in Okinawa, 45 in Tokuno-shima, and 25 in Amami-oshima (Honda et al. 1977, 1978; Tsuchiya et al. 1989). Since the Y chromosome in the Tokuno-shima and Amami-oshima island populations disappears (Honda et al. 1977, 1978), and the animals from Amami-oshima are shown to lack the Sry gene (Soullier et al. 1998), an unusual sex-determining system must have been evoked in these populations (Honda et al. 1977; Tsuchiya et al. 1989; Soullier et al. 1998; Xiao et al. 1998). However, neither the evolutionary process leading to these differences, nor the biological implications of the differences have been elucidated. The evolutionary history of the populations of 7. osimensis and the origin of this lineage have long been debated (for review see Kawamura 1989). A recent molecular phylogenetic study (Suzuki et al. 1999b) has revealed that 7. osimensis’ lineage is distinct from the other members of the subfamily Murinae examined so far, including Apodemus, which had been considered a likely candidate for the sister lineage of Tokudaia based on molar morphology (Kawamura 1989). An assessment of the genetic diversity within this species is inevitably needed for back ground information to elucidate the above biological problems, and to resolve the unsettled taxonomic status of the three island populations of 7. osimensis. Although recently each of the three populations is presumed to be a distinct species (Honda et al. 1977; Tsuchiya et al. 1989; Musser and Carleton 1993), there has only been limited research on this species with such complicated genetic property using molecular markers (Tsuchiya et al. 1989). In a preliminary study using a limited number of restriction enzymes we found sub- stantial genetic differences between populations of 7. osimensis from Tokuno-shima and Amami-oshima, based on restriction fragment length polymorphisms (RFLP) of mitochon- drial DNA (mtDNA) and nuclear ribosomal RNA genes (rDNA) (Tsuchiya et al. 1989). This study was conducted therefore to improve our knowledge of the molecular phylogeny of the Tokuno-shima and Amami-oshima island populations, by examining a whole sequence for the mitochondrial cytochrome b (cyt b) gene and the rDNA-RFLP with more additional restriction enzymes. Materials and methods Animals We have tentatively followed Abe’s (1994) classification and accepted that Tokudaia consists of just one species (T. osimensis) with three island populations. Five individuals of T. osimensis were examined, two from Tokuno-shima and three from Amami-oshima. With H. Suzuki et al., Genetic diversity in Tokudaia osimensis 45 the exception of one sample from Amami-oshima, the samples were the same as those previously used by Tsuchiya et al. (1989). The new sample (sample no. HS1142) from Amami-oshima was collected at Tatsugo, 28 February 1996 through a wildlife survey con- ducted by Japan Wildlife Research Center (Environment Agency of Japan 1995). Sequencing and phylogenetic analysis Nuclear DNA extraction, Southern blot analysis and the construction of restriction maps for the rDNA repeating unit type (repetype), were all carried out following Suzuki et al’s (1994a) methodology. The cyt b region was analyzed using nested polymerase chain reac- tions and a direct sequencing method as described previously by Suzuki et al. (1997, 1999b). In order to estimate the sequence divergence from restriction site variation among rDNA repetypes, we compared the arrangement of the restriction sites between the pairs of repe- types and then counted the common and divergent sites (Suzuki et al. 1994a). To do this, we used Gotoh et al’s (1979) method, in which backward mutations and parallel mutations are taken into account, to produce a matrix of sequence divergence among all possible combi- nations of repetypes. To estimate the sequence divergences from sequences of the cyt b gene, we used the two parameter method (Kimura 1980) and MEGA (Kumar et al. 1993). Results Cyt b sequences Fragments of the cyt b gene, from each of the five specimens, consisting of 402 bp were determined, and it was found that each island population had unique sequences. We then sequenced the entire gene region of the cyt b gene of one individual from Tokuno-shima (the nucleotide sequence can be reached in the DDBJ, EMBL and GenBank with follow- ing accession number: AB029429) and compared it with that of the previously described sample from Amami-oshima (Suzuki et al. 1999b), calculating sequence divergences (see Kimura 1980) taking into consideration complete substitution (d), and only transversional substitution (dv; see Table 1). The extent of transversional substitution amounted to 0.026, which is comparable to that between species of Rattus-Diplothrix and Mus (dv =0.014-0.016; Table 1). The extent of complete substitution (d=0.088) was also extremely high when compared with other cases of intraspecific sequence divergences within mammalian species (Avise et al. 1998; Johns and Avise 1998; Table 1 for the case of Glirulus japonicus) and rather comparable to those among congeneric mammalian species (Johns and Avise 1998). Such high degrees of divergence in the cyt b sequences were congruent with our previous study with the mtDNA-RFLP (Tsuchiya et al. 1989). rDNA-RFLP We carried out Southern blot analysis with the two island samples using 12 restriction enzymes. Among the enzymes examined the KpnI bands, with both the 18S and 28S probes, remained at higher molecular weight position without any indication of digestion with this enzyme in samples from both islands. Thus, we considered there to be no KpnI site located in the spacer region in these populations. Restriction maps were constructed taking into consideration the banding patterns (Fig. 1). Interestingly, the Amami-oshima sample’s 46 Mammal Study 24 (1999) Table 1. Comparison of sequence divergences between related species and among geographic popula- tions in small mammals. Sequence divergences in the cytochrome b gene (1,140 bp) were calculated using Kimura’s (1980) two parameter method considering all substitutions at all codon positions (d) and transversions at all codon positions (dv). Substitution considered Taxa compared d dv Between geographic populations 1. Tokudaia osimensis ‘Amami-oshima’ vs ‘Tokuno-shima’ 0.088 0.026 2. Mus musculus* M. m. domesticus vs M. m. musculus 0.024 0.004 3. Glirulus japonicus** ‘Wakayama’ vs ‘Yamanashi’ 0.075 0.012 Between species within Mus and Rattus* 4. M. musculus vs M. spretus 0.091 0.014 5. R. rattus vs Diplothrix legata 0.102 0.016 Between genera Mus and Rattus* 6. M. musculus vs R. norvegicus 0.186 0.082 * Suzuki et al. (1999b). The genus Diplothrix is a member of a Rattus group in the molecular phylogenetic view. ** Suzuki et al. (1997; unpublished data) repeating type was heterogeneous within a genome as depicted in the HindIII and Xbal sites upstream of the 18S rRNA gene and EcoRI, and Dral sites downstream of the 28S rRNA gene (Fig. 1). In contrast, the banding patterns of the Tokuno-shima specimens were monotypic within a genome at each restriction site. These phenomena can be explained either by there being a large population on Amami-oshima or by some prevention of the homogenization process (including DNA recombination) within a genome in the Amami- oshima population. The former postulates that the banding patterns of individuals from a large population size tend to show polymorphic state rather than those from a small popu- lation size (Suzuki et al. 1994b). Although there is no substantial data on population size of this species, the area of Amami-oshima is about three times as large as that of Tokuno- shima. In the latter case, if rDNA clusters coexist onto terminal and interstitial regions of chromosomes, recombination between non-homologous chromosomes would be unfavorable since it may cause abnormal chromosomal changes with serious damage to the cell. We just presume a possibility that a rDNA cluster(s), which often locate distal portions of chromo- somes accompanied by heterochromatic regions but not euchromatic one, as in the cases of Mus and Rattus (Babu and Verma 1985), incorporated into inside chromosomes by chro- mosomal rearrangement in the Amami-oshima population (2n=25). The difference between the geographic populations became more conspicuous during examination of the rDNA-RFLP. According to Gotoh et al’s (1979) method, inter-popu- lational sequence divergence was calculated to be approximately 2.3%. This extent was considered likely to be as high as between distantly related local populations such as of the Japanese dormouse Glirulus japonicus (2.9-3.3%, Suzuki et al. 1997), and between closely related species of red-backed voles (genera Clethrionomys and Eothenomys) in Japan (1.9- 2.3%, Wakana et al. 1996; Suzuki et al. 1999a). Since each variant spreads over the arrays H.. Suzuki et al., Genetic diversity in Tokudaia osimensis 47 Xi Bi X3D2 Li B2 B3 Vi E2 1 kb i 18S 28S 5.88 X2DiPi1 E:Hi AiD3Gi $1 _—‘S2 I SS SSE EE 18SB INT 288 18S upstream internal 28S downstream SSeS Ie eT a a aaaaaaa aa aaaa aaaa a a 13, Jal LAG XS PV DB AEDS VGP B x a a bb AAAAAR A aa babaa bp aaa a E Hee He xemel AG XSIPE DB BALDS PE HVG x Amami-oshima I * * b 2 kb BD ——l Fig. 1. Restriction maps of the rDNA repeating units of Tokuno-shima and Amami-oshima populations of Tokudaia osimensis. Each rDNA repeating unit is composed of three rRNA genes (28S, 5.88, and 18S rRNA) which are separated from each other by spacers. With respect to the restriction sites on the flanking spacers, only those nearest to the distal end of the genes for 18S or 28S rRNA are shown. The upper diagram shows the con- served restriction sites in the coding and the internal spacer regions of the genes for 18S and 28S rRNA, which are not represented in the lower maps. The positions of the probes are also shown by arrows. Letters with super- scripts represent specific types of restriction sites identified after comparison with the restriction maps. Types of Tokuno-shima are treated as a. Asterisks indicate polymorphic sites within individuals. A=Aatl; B=BamHI; D=Dral; E=EcoRI; G=Beglll; H=Aindill; K=KpnI; L=Bcll; P=Pstl; S=Sacl; V=Pvull; and X=Xbal. of rDNA within a population through certain homogenization mechanisms (Coen et al. 1982), the presence of several distinct variants between the two islands clearly indicates that the two populations have been isolated for a considerable period of time. The amount of the sequence divergence, 2.3%, corresponds to a divergence time of 1.2-2.3 million years, if we assume that the divergence rate is 1-2% per million years (Suzuki et al. 1994a, 1999a). Discussion During this study we detected considerable differences in the cyt b sequences and the rDNA-RFLP between populations of 7. osimensis from the islands of Tokuno-shima and Amami-oshima, as previously predicted by karyological analysis (Honda et al. 1977, 1978; Tsuchiya et al. 1989) and our preliminary molecular analysis (Tsuchiya et al. 1989). The difference between the populations, and the extent of the divergence in the two molecular markers, has greatly improved our knowledge of the evolutionary processes of these island populations. Our data will be helpful in assessing the evolutionary history and in recon- sideration for taxonomic status of this species. The extent of the inter-populational variation in the cyt b sequences between the two island populations was comparable to that between Rattus species and Diplothrix legata (Table 1). These results suggest that certain kinds of populational differentiation began a very long time ago. Differentiation of genes under the ordinal inherited mode, however, does not always reflect populational differentiation. Furthermore, in the case of mtDNA, 48 Mammal Study 24 (1999) the differentiation patterns do not reflect the movement of males. For example, the differentiation patterns of mtDNA in geographically separate populations of the Japanese dormouse Glirulus japonicus, and Smithii’s red-backed vole Eothenomys smithii, are not congruent with those of nuclear genes and morphological types (Suzuki et al. 1997, 1999a; Iwasa et al. unpublished). In contrast, data sets of the nuclear rDNA, a member of multigene families, would provide more useful information on the genetic status of given populations. The rDNA consists of several hundred copies within a genome, and a given variant extends to all of the units by certain homogenization mechanisms, and to all of the genomes of the same population as a result of mating (Dover 1980; Ohta 1980). In the case of 7. osimensis, of the 22 restriction sites examined, three sites were completely differentiated, and four more were under differentiation between the rDNA repeating units of the two islands (Fig. 1). This data implies that the two island populations of T. osimensis have been reproductively isolated for some million years, despite there having been many chances to exchange genetic elements during the Pleistocene ice ages when falling sea levels led to land bridges existing between the islands (Kimura 1996). We could conclude, there- fore, that these two island populations are already genetically differentiated to such an extent that there is little or no probability of future genetic contact. Consequently, the spiny rats from the two islands of Amami-oshima and Tokuno-shima may be better regarded as two independent species. This assumption is congruent with the observed karyological differentiation between the island populations in which the diploid numbers are 2n=45 (Tokuno-shima) and 2n=25 (Amami-oshima). From the karyological perspective (Honda et al. 1977; Tsuchiya et al. 1989), such populations would not be expected to produce fertile progeny, that is they have been reproductively isolated through certain post-mating isolation mechanism. Such infor- mation clearly brings into question the current taxonomic status and suggests that the status of 7. osimensis as a monotypic species should be reconsidered (Honda et al. 1977; Tsuchiya et al. 1989; Musser and Carleton 1993; Kaneko and Murakami 1996). Interestingly, the extent of the cyt b divergence between these two island populations is somewhat similar to the level of distinctness of D. /egata (Suzuki et al. 1999b; Table 1). This may imply that some geological event was attributable to both the geographical diver- gence of 7. osimensis and to the migration and colonization of D. /egata in the Okinawa Islands. The most simple explanation for such differentiation is that it was triggered by the disappearance of land bridges that once connected the islands of the region. Our rough time estimation predicts that divergence occurred 3.8-4.9 million years ago (Mya), taking into account the extent of transversional substitution (Table 1) and using the “standard” time estimation of the rat-mouse split as 12-14 Mya (though others have estimated the rat-mouse split to be more ancient (20-29 Mya, O’hUigin and Lee 1992; 40 Mya, Kumar and Hedges 1998)). If the time frame is estimated on the basis of a total-substitution rate of 2% per million years (Brown et al. 1979), then divergence is estimated to be 4.4 Mya. Both of these estimates related well to the geological view that the Ryukyu Islands were once connected to the Asian continent but became disconnected during the beginning of the Pleistocene, around 1.7 Mya (Kimura 1996). It may be postulated that such geological changes affected the differentiation of D. /egata from other continental sister Rattus lineages, and simul- taneously triggered the geographic divergence of the mtDNA haplotypes in 7. osimensis. In order to fully understand the various important issues related to the status of 7. H. Suzuki et al., Genetic diversity in Tokudaia osimensis 49 osimensis, comparable data for 7. osimensis from the Okinawa, is required. Karyologically, the Okinawan population represents the normal type, and may represent the ancestral situa- tion of the unusual karyotypes. Studies of the Okinawan population are essential for the investigation of other issues such as the geographical differentiation of genes, and the taxo- nomic reconsideration of the island populations. Despite the scientific importance, all three populations of this taxon, especially in Okinawa, are thought to have already decreased to a point where those are seriously endangered possibly due to habitat destruction, predation by and competition with introduced species such as the Javan mongoose Herpestes javanicus, the feral cat Felis catus and the feral dog Canis familiaris, and the black rat Rattus rattus. The Environment Agency (1995) listed the Okinawan population as critically endangered and the populations of Amami-oshima and Tokuno-shima as endangered in the national Red List. Given the current status of 7. osimensis in the wild in Okinawa, and given the remarkable biological importance of this taxon, effective conservation efforts are required, and these may include a research project to promote their reproduction in captivity while the issue of alien predators is dealt with. Acknowledgements: We are grateful to Drs. M. Brazil, M. Izawa, Y. Sawashi, M. Takaku, K. Minato, and Y. Arakawa for their valuable suggestions. We wish to thank the Environ- ment Agency of Japan who funded the wildlife survey providing a part of materials of this study. This study was supported in part by Grants-in-Aid for Scientific Research from the Ministry of Education, Science, Sports and Culture, Japan. This study was also supported in part by a grant from the Environment Agency. References Abe, H. (ed.) 1994. A pictorial guide to the mammals of Japan. Tokai University Press, Tokyo, 195 pp. (in Japanese). Avise, J.C., Walker, D. and Johns, G.C. 1998. Speciation duration and Pleistocene effects on vertebrate phylogeography. Procceeding of the Royal Society of London B 265: 1707-1712. Babu, K. A. and Verma, R.S. 1985. Structural and functional aspects of nucleolar organizer regions (NORs) of human chromosomes. International Review of Cytology 94: 151-176. Brown, W.M., George, M. Jr. and Wilson, A.C. 1979. Rapid evolution of animal mitochondrial DNA. Proceedings of the National Academy of Sciences USA 76: 1967-1971. Coen, E.S., Thoday, J. M. and Dover, G. 1982. Rate of turnover of structural variants in the rDNA gene family of Drosophila melanogaster. Nature 295: 564-568. Corbet, G. B. and Hill, J. E. 1991. A World List of Mammalian Species, 3rd edn. Oxford University Press, London, 243 pp. Dover, G. 1980. Molecular drive: A cohesive mode of speces evolution. Nature 299: 111-117. Environment Agency. 1995. A Report of Biodiversity Survey on Amami Islands. Japan Wildlife Research Center, Tokyo, 108 pp. Gin Japanese). Gotoh, O., Hayashi, J., Yonekawa, H. and Tagashira, Y. 1979. An improved method for estimating sequence divergence between related DNAs from changes in restriction endonuclease cleavage sites. Journal of Molecular Evolution 14: 301-310. Hoffmann, R.S. 1993. Order Lagomorpha. In (D. E. Wilson and D.M. Reeder, eds.) Mammal Species of the World, 2nd edn. Pp. 807-827. Smithsonian Institute Press, Washington and London. Honda, T., Suzuki, H. and Itoh, M. 1977. An unusual sex chromosome constitution found in the Amami spinous country-rat, Tokudaia osimensis osimensis. Japanese Journal of Genetics 52: 247-249. Honda, T., Suzuki, H., Itoh, M. and Hayashi, K. 1978. Karyotypical differences of the Amami spinous country- 50 Mammal Study 24 (1999) rats, Tokudaia osimensis osimensis obtained from two neighbouring islands. Japanese Journal of Genetics 53: 297-299. IUCN. 1996. IUCN Red List of Threatened Animals. IUCN, Gland, 448 pp. Johns, G.C. and Avise, J.C. 1998. A comparative summary of genetic distances in the vertebrates from the mitochondrial cytochrome b gene. Molecular Biology and Evolution 15: 1481-1490. Kaneko, Y. and Murakami, K. 1996. The history of taxonomy in Japanese small rodents. Honyurui Kagaku [Mammalian Science] 36: 109-128 (in Japanese with English summary). Kawamichi, T. 1997. Red List of Japanese Mammals by the Red Data Committee of the Mammalogical Society of Japan. Bunichisougou-shuppan, Tokyo, 279 pp. Kawamura, Y. 1989. Quaternary rodent faunas in the Japanese Islands (Part 2). Memoirs of the Faculty of Science, Kyoto University, Series of Geology and Mineralogy 54: 1-235. Kimura, M. 1980. A simple method for estimating evolutionary rates of base substitutions through comparative studies of nucleotide sequences. Journal of Molecular Evolution 16: 111-120. Kimura, M. 1996. Quaternary paleogeography of the Ryukyu Arc. Journal of Geography 105: 259-285 (in Japanese with English summary). Kumar, S. and Hedges, S. B. 1998. A molecular time scale for vertebrate evolution. Nature 392: 917—920. Kumar, S., Tamura, K. and Nei, M. 1993. MEGA: molecular evolutionary genetics analysis, version 1.01. The Pennsylvania State University, University Park, Pa. Musser, G. G. and Carleton, M.D. 1993. Family Muridae. In (D. E. Wilson and D. M. Reeder, eds.) Mammal Species of the World, 2nd edn. Pp. 501—806. Smithsonian Institute Press, Washington and London. Ohta, T. 1980. Evolution of Multigene Families. Lecture Notes in Biomathematics 37. Springer-Verlag Berlin, 131 pp. O’hUigin, C. and Li, W-H. 1992. The molecular clock ticks regularly in muroid rodents and hamsters. Journal of Molecular Evolution 35: 377-384. Soullier, S., Hanni, C., Catzeflis, F., Berta, P. and Laudet, V. 1998. Male sex determination in the spiny rat Tokudaia osimensis (Rodentia: Muridae) is not Sry dependent. Mammalian Genome 9: 590-592. Suzuki, H, Kawamoto, Y., Takenaka, O., Munechika, I., Hori, H. and Sakurai, S. 1994a. Phylogenetic relation- ships among Homo sapiens and related species based on restriction site variations in rDNA spacers. Biochemical Genetics 32: 257-269. Suzuki, H., Tsuchiya, K., Sakaizumi, M., Wakana, S. and Sakurai, S. 1994b. Evolution of restriction sites of ribosomal DNA in natural populations of the field mouse, Apodemus speciosus. Journal of Molecular Evolu- tion 38: 107-112. Suzuki, H., Minato, S., Tsuchiya, K. and Fokin, I. M. 1997. Phylogenetic position and geographic differentiation of the Japanese dormouse, Glirulus japonicus, revealed by variations in rDNA, mtDNA and the Sry gene. Zoological Science 14: 167-173. Suzuki H., Iwasa, M., Harada, M., Wakana, S., Sakaizumi, M., Han, S-H., Kitahara, E., Kimura, Y., Kartavtseva, I. and Tsuchiya, K. 1999a. Molecular phylogeny of red-backed voles in Far East Asia based on variation in ribosomal and mitochondrial DNA. Journal of Mammalogy 80: 512-521. Suzuki, H., Tsuchiya, K. and Takezaki, N. 1999b. A molecular phylogenetic framework for the Ryukyu endemic rodents Tokudaia osimensis and Diplothrix legata (Muridae: Murinae). Molecular Phylogenetics and Evolution. (in press). Tsuchiya, K., Wakana, S., Suzuki, H., Hattori, S. and Hayashi, Y. 1989. Taxonomic study of Tokudaia (Rodentia: Muridae): I. Genetic differentiation. Memoirs of the National Science Museum, Tokyo 22: 227-234 (in Japanese with English summary). Wakana, H., Sakaizumi, M., Tsuchiya, K., Asakawa, M., Han, S-H., Nakata, K. and Suzuki, H. 1996. Phylogenetic implications of variations in rDNA and mtDNA in the red-backed voles collected in Hokkaido, Japan, and in Korea. Mammal Study 21: 15-25. Xiao, C., Tsuchiya, K. and Sutou, S. 1998. Cloning and mapping of bovine ZFX gene to the long arm of the X-chromosome (Xq34) and homologous mapping of ZFY gene to the distal region of the short arm of the bovine (Yp13), ovine (Yp12—-p13), and caprine (Yp12—p13) Y chromosome. Mammalian Genome 9: 125-130. Received 7 June 1999. Accepted 24 June 1999. Apology and exchange In acknowledging those persons who had kindly reviewed manuscripts for Vol. 23 (2) of Mammal Study, Dr. M. Motokawa’s name was unintentionally omitted. I would like to deeply appologize to Dr. Motokawa for that oversight. As there were also several mistakes in the index in Vol. 23 (2), please exchange it for the revised index attached to Vol. 24 (1). Seiki Takatsuki (The former Chief in Editor) 5 i ok I ey Teg ie a Mee bags wer ” ~ = a : ; ala” ate _ yr i , et hi 7 i 4 i ages i f nes a eh ey A epee i it a ; 8% "era ae i ee im Ply! arated) c ee ae a Za are tate : bi (4 ‘ Soe + > . “ ‘Ss fi i i = — - : ; ss : f : . 1 BEA th f q i= = } i 1 a Fs he Cee = oh) ; i t 2 % / ‘im ‘) 7 ee - & f ' i +, “a pe , ‘ Das x 7 re eee ‘ = iy) ’ & = - am ~ = x *. a = rd me i wu “4 “ Ne 4 oa = > A Cae ) x " . %. eS = = = ~! \e & bs — = > ) 5 a Pa = SPs ; ay 4) * A ra — ! a — "7 ¥ 5 : ws 5 ; j t } ‘ rane aah = , i, es 4 ae ; ; S F oe De seks ‘ r ; ‘ tr “ C= x i] ‘a! i Ag i ah — = =) & Rs \ it a oo a rire o = = = ; 2 = ey 3 . ¢ t FN, = ey i z i 5 - < 7h L as bs 2 = t 4 4: m ae ber a ty, ' i a ‘ > ¢ \ We ic rs = ‘ae 1 ree ~ eA 3 me 7 : ; - Pipe bd > or a : = rele ; = i e = ; i , us ; mes ‘ y cf = x e . im — iL = =. a H R, , E } 3 { at } - 4 A t “ ies ‘ ri i - i i Sy 2 ; ce 1 f 7 ; al ; Hs € : ; j oy ‘ a ef a & Ka = . i 4 a “s 5 7 A ¥ PhS Ase By 7 z a 7 Ne d i OR f = » el 7 ¥ p=\ Si / 2 ai) 5 hie = p , ' f Ni at y i < nN Y ‘ =; 5 = XY ’ My = = ¢ : s on ( Uae, 4 ree a } A ¢ 5 reay = } : = Q Sue oA = , Re 2 . x ~ = cs ey am 3 a: 5 2 1 + . E : # % u a 1 - Y, Bf ) { } ie i 4 = ) t ; 3.6 ; \ = 3 — a ne > “ - i = a) in = % 7 i = 4 ; ; j ~ ‘ Ve { ee aes fa Li - : é 5 = = : EAS 1 2 i i} te ACTA THERI OLOGICA Auctore Augusto Dehnel condita Founded by August Dehnel in 1954 is an international journal of mammalogy, covering all aspects of mammalian biology. It publishes original research reports, short communications (Fragmenta Theriologica), and book reviews. The journal also includes review papers. Editor-in-Chief: Zdzistaw PUCEK Assistant Editors: Anna M. WOJCIK, Jan M. WOJCIK Current Editorial Board: Roman Andrzejewski (Warszawa), Wiestaw Bogdanowicz (Warszawa), Gilbert L. Dryden (Ashland), Jifi Gaisler (Brno), Joanna Gliwicz (Warszawa), Ilkka Hanski (Helsinki), Lennart Hansson (Uppsala), Kazimierz Kowalski (Krakow), William Z. Lidicker (Berkeley), Sandro Lovari (Sienna), Brian K. McNab (Gainesville), Gerhard Storch (Frankfurt am Main), Peter Vogel (Lausanne), Nikolay N. Vorontsov (Moscow), January Weiner (Krakow). e Among subjects included are ecology, behaviour, bioenergetics, morphology, development, reproduction, nutrition, paleontology and evolution of mammals. Papers demonstrating a comparative perspective in anatomy and physiology of mammals are also welcomed. Papers represent mammalogical research in over 40 countries, including Eastern Europe and the Commonwealth of Independent States. Published now quarterly, in English. Exchanged or subscribed in 63 countries. Indexed in: Biological Abstracts, Elsevier BIOBASE/Current Awareness in Biological Sciences, Current Contents A, B & ES, Ecological Abstracts, Polish Scientific Journals Contents—Agric. & Biol. Sci., Referativnyi Zhurnal, Science Citation Index, Wildlife Review, Zoological Record. e@ Edited since 1958, and now also published by the Mammal Research Institute, Polish Academy of Sciences, Biatowieza, Poland. Special emphasis is payed on a series of papers e Bisoniana — over 110 papers devoted to anatomy, physiology, ecology, behaviour, of the European bison and its hybrids with domestic cattle. e Studies on the European hare — over 50 papers have been published on hare morphology, reproduction, and different aspects of population ecology. e Monothematic issues or supplements — Ecology of the bank vole (1983), Ecological genetics in mammals I (1993), II (1995), II (1998), Developmental homeostasis in natural populations of mammals: phenetic approach (1997). More information are available on Internet: http://bison.zbs.bialowieza.pl/acta/acta.html Manuscripts for consideration should be sent to: The Editor, Acta Theriologica, c/o Mammal Research Institute, Polish Academy of Sciences, 17-230 Biatowieza, Poland e@ Manuscripts are peer-reviewed e@ No page charges e Fifty reprints free of charge Subscribe today or request a free sample copy by filling in the order form Subscription rates: Institutions 102.00 USD per volume, Individuals 68.00 per volume Postage included. Full air mail delivery (on request) is possible. Back issues are available. ORDER FORM for PERSONAL/INSTITUTIONAL SUBSCRIPTION Please tick appropriate box and send an order card to: Polish Academy of Sciences, Mammal Research Institute, 17-230 Bialowieza, Poland, e-mail: acta@bison.zbs.bialowieza.pl LJ Please enter my subscription, beginning with: Volume 42/1997, Volume 43/1998, Volume 44/1999 LI Please accept my cheque for CL} Please send me a sample copy. U) Please send me instructions for contributors. EVOLUTION OF SHREWS Edited by JM. WOJCIK and M. WOLSAN In spite of an apparent recent increase of interest in shrews (Soricidae) and an impressive bibliogra- phy on the evolution of this fascinating group of mammals, until now there has been no compre- hensive work that deals with current problems in shrew evolutionary research. This book represents an attempt to redress this omission, by offering a volume that seeks to review the present state of our knowledge of shrew evolutionary biology. CONTENTS: Introduction; A Classification of the fossil and Recent shrews; Fossil history of shrews in Europe; Fossil history of shrews in Asia; Fossil history of shrews in Africa; Fossil history of shrews in North America; Dental adaptations in shrews; Chromosomal evolution in shrews; Chromosomal evolution: the case of Sorex araneus; Protein evolution in shrews; Mitochondrial DNA evolution in shrews; Evolution of energetic strategies in shrews; Evolution of social systems in shrews; Shrew mating systems; Appendix: A list of the living species of shrews; Taxonomic index. Published by Mammal Research Institute, Polish Academy of Sciences Date of publication: May 1998 Number of pages: xii + 458 ISBN 83-90752 1-0-7 Cover: hardback Price: 38 USD + postage To order and for further information please contact: Library, Mammal Research Institute, Polish Academy of Sciences, 17-230 Biatowieza, Poland; Tel./Fax (+48) 85 6812289 E-mail: evolbook @bison.zbs.bialowieza.pl To order by Internet see: http://bison.zbs.bialowieza.pl/evol/evol.htm ORDER FORM Please fill in this order card and send it to the above address. Ci Yes, | would like to order... copy/ies of Evolution of Shrews E} Please bill Me/MYy IMSUITUION 0... cede cee eee tect tear crinleniegtie eae ie TE aa Sai (eV 13 eee mr ln CO Oe OC TN EC. ssacconanosanovtccorcwone PNGOTOSS oo csko.coeci So ick heat eee ee ee oe NEE ee (2 SY (3) (4) (5) (6) (7) BBHICBd bP, ARS GH) RBCt. lho Ch, RBC RHBELCG BIMBGiLd: 0 Clk HO KA. [BIO LD Te RPBDMRORS RAD! ERAALTWT WADE EVECA. Ee RY CimiICBmMTsCECH. Ay Ove ep Fd. 2-34 AD bY+-+2v-—Y av (circulation BN) DHAnNCKS BO ete S hn, B, BASmensa CMS ZRBARPROMAAN CAM SNSZLICH. BRSERSS Ci-TANe Has LK CA Vt as Y) ear bo—K, BEC OMBMBCH. TAFVAKSTI, [4HEHBO—i], PREBO—MRI, [5 ER OCA |, (REBOZ#| & 4 BORER bh, CHEN20K Fr, 220K Fr, 160 KEV, MOK RUC LE. SOC PSs cE OH LH), MAlLARHOSMAD AE S Hhiboct. SBMCIIMAICTA, BMBHEROKDOFRE LCILAWCL: 5. BRD BSbrsAckteab, BMBCKSEMRMCEAROTT. 2 RED 2 HO HACEHEDZS Lieb 1F20054 (64K) COA, DP LORRNITCRH HS SDT CLD YD E ah. ZHEKSCAMABbonNIT RIE Bes L, 1 EU ACRES SST ODE DD xD teititte 0 EA (2000EORS CRAL, AK ITC HH MICHET OUR YE +). Et, ARENAS OAMERLEZ Sie bit, 20028¢ CHE, 2H, BITS, F SHH CvADS CR. DED OED (BRHRITBAHED 3468). ty YavV7-T7Yay SOR-HHA RRFELC SSB SV VEER BY RAH SAIL, 20014FD ITC K A (M77 A) CBML, Bonxe SBME IDEPHOS TL: D. 4. BRSHoncn ZOEH, KLA, KER, Ball, ABR, Hae 1. HRS LIRE SWS &OP FCiCBIMeERSAKAEEROAGYV bo LeSERVETA, BRABICOUTE IWS RCH a BH bCL 1 oD. ITC AABIELRRT FIC4RD, COBRCDE DBZ TBD NICES Tho ROI, BE PROA« 3A, BRARICHIR LCR RI - BCR - H)|, ¥ PC RPSABMICMT SMA CLA bh SAFO i SY VE CHR LCE 6 FECH. BBBL UTC, JEM OMIJAMROBBICMIC, Say vReU-ATHS< OSA ITC BAER A RICH CK hhld, EBACE. Et, HRAROM CHD RERE RH DOAD DL BMMMGS LEVER ETM, BH SR DPEVW bo Le brwk 3s CH Q0058CIL, ABBE L TH ZH4LNEEA). 2. RIASSEL Ae > D> (1) ROMEO ) — FLOSS OMA DEM LED. MOICC EEC La A> Pe MEP REED ) —F- LAR DKS IF 4 YATH. ADOMHICMTS7 FT A RAROSZSMDYRLHUERAL, Ek, BAMHCBEOS oD eEGONSDSELNE +f /. a Ay ATV 32 CHAnNS ITC C, KREIOKAV AA CHI DEO ERHDS EBbnae, AADHELR FAILED LOCAL SD, bat bne LK. “4, NR SAIt ITC OBBBAX LOBbh, TOBRIC ITC #BDSHBEOEeZIK Lo CT. Ses BmiiaC, SA CARAORARIMLELK. CORR, BLACOBRAD, FP BX GFORBOF » VAIS, FROVANT y TICORDS, BRYCRED DAE EOR HC, ITC REX BR ENICAZCWUSZCEMDDVELK. Lael, PMNITCHBRECHSS EDR ZTE, EWS RAED RA bTHSV ELK. COE CBB vt, OMCHEeSIXSG SIC LCEUPRAS, KET EZHDEDDS, @c DLO AMBX 1EORACRETAZCELHLY, EDF Db, 4 FRORILEINICA WBE CHL LBZ, TATVAKSE ITC BBBARICH LT, | 2001F- KAO RA COBH EIL eID <<, APTHE CHS. ORO RRIICRN LCA, Foci z brig & eae oe Ne 1 Lie. TATVAKSER, PRAS CHROME AICO Cam L, ITC RNBASLED SIA Tal pec BEMIS OV CRATSZCLICLELK. RNBBSITHR, FL, BSPEHK OBAEDS ay fe CHS CEXRAL, SbICR ANT RNITA RAR SI AMCCLICEOELK. BIALETA, FAT AKSOBAIC ANAS SI ITC KEARSE OPA SH 5 OD lt, BOIRRHOM7T 7) AHMBDPRTSERLHKEDOCLE. CORD, ITC H#EBE AWD CBRMORBHMEELEboKRbU CH. CR, B77) DEABDRGE YLT, SE Gove ae Ib iee 3. ITC BARIEICR SSK LORS l. BAFSSOMEA ITC Dig h GIEW7cFLF OKA CHSACERBRZSAL, AAMABZADORVICR Vic H OES. LeeBol, HEORABAICKH ST SRA SOF Zit HFA L OBI ER DISD bRFASDEABRNCT VY eHEDS | EDO ARB bSBS EL. REL, [EMM t V5 Ot [RED] CHSZCEABRLERA. ITC OHAMEICBMRAROFSULBITHSL FIV CETL, HMO L I) ITC CIAO PMRILSHOERA. LKB, REEDS, BRA, 7S, KES, SES, FROWTSORBTSLBITAZOARE4RBKLOLS ZOWEF. Eh, fWFAMBMLy VY a VEOR-—WIM1 ABM HILASOMBAAAD OD, Fk bKSKBADHD OED. BRRROSLCOBALTEbANIE, MEMICEDDOET. Bal LET, HAS hae ¢ OFM EEG MB ICANSZNSBRLEZHNET. 2. We EO es ZUR 38425) OFadicit (BIPMAO hic IFA AD b=aFAAOBRAD DE | Cc HO LEDRESN COED. LOL, REBICHTABIMD CRIB A RET ANS CHSZCL, FAD CUSCE GAD SOBMEAAMOTA), AADMiftfEceERAZSE, Dia DILRIR IA VY EB RZKRAOMER CT. BEET, 18H SNKERAERSZS Clit, MTEETAR (6B A - BRRVOMATABAAYLSED) & PERM: UCHSIE mye sirewekt Uk. ITC OBMARCAS HRAFLRSSILRSROFSCH), BALE eA y ceo) METAL AWE 7c ARIE ABE CL OD, REHAB BAS CEH I5 12. Be 14. Ie 16. Ws 18. 19. 20. Ze Mpa dpe 24. WD. 26. Zale 28. Large spatial and temporal scales in mammalian ecology: perspectives from the Americas P. Meselve, P. Marquet Paleomammalogy in Mexico M. Montellano, J. Aitoyo-C. Geographical ecology of mammals D. Morris, B. Kotler, J. Brown Recent developments in predator-prey interactions D. Murray, S. Boutin Ecology as a tool in taxonomic studies J. Shoshani, C. Groves Ecological and evolutionary aspects of mammal-plant interactions M. Steele, B. Danielson, P. Smallwood Mammalogy in Mexico: History, development, and perspectives D. Valenzuela, L. Vazquer, J. Schondube Experimental testing of hypotheses in mammalian behavioral ecology H. Ylonen, J. Wolff Biology and conservation of endangered and rare deer L. Sun, D. Moore Current priorities in the conservation of mammals I. Chestin, C. Servheen, D. Jackson Physiological ecology of mammals Rochelle Buffenstein The flagship species approach to ecosystem conversation. What works, what doesn’t and why Pat Foster-Turley Habitat disturbance and tropical mammals: a global perspective A. Cuaron, C. Peres Systematics and Biogeography of montane rodents in Southeastern Mexico and Northern Central America M. Engstrom, Y. Hortelano Molecular systematics of Peromyscine-Neotomine rodents C. W. Kilpatrick The ecological, evolutionary and geomorphological significance of open burrows system G. Ceballos Veterianrians in conservation biology A. W. English Workshops (11) 1; oO COND AB Dy Migratory bats: research and conservation priorities and perspectives G. McCracken, R. A. Medellin IUCN/SSC Lagomorph specialist group meeting A. Smith, A. Velazquez, N. Formozov US/Mexico cooperation in the conservation of rare species W. Spencer, E. Mellink, J. Maldonado History of mammalogy. K. Sterling Meeting of Latin American Mammal Societies J. Arroyo, R. Ojeda Prairie dog conservation J. EF Gully, Meeting of the Mexican Society of Mammalogists R. A. Medellin Evolution of the Procyonidae S. Zeveloff Conservation issues concerning marine mammals in Latin America S. Manranilla et al. Mammal diversity and conservation in Latin America G. Ceballos, R. A. Medellin Ecology, evolution and conservation of Equidae P. D. Moehlman ITC OPM EM BORE 19977E 7A 1 5 ACF REKEO) REE SAD OMB KAER CSR) CHRD D YO, ED HMvat) PROP CAHMILD OEPCA. 4FIC 1 ERE Sh, RI CILKKReE PDIC1, 000A EOZIMap oo ecmIN Cle s. EGiie CObMEMIS 1. 2A77, 2. 777 —, 3. ~rvy 22, A. sa PSEY PY, Bs WS =, OS VP Sas lo rave Yel) G23 Opera w ) DAEAIE-C2001ZEICEADNSAPIECT. BIBRRM, Fuse V-ety Va VR VV RLV AK EWZMACHNOKE CHV DH eC ERBDHETAR, CEOCHKZAEMLET AT V2 (44 2GRE) KSOMEBT LET. lo YP DDS TAF VARKSIh, 199749 A7ADSILAECOS AM (3 HARARE AR SO ROCHEHR 4 Hisl) BAaaeEL KR. VV RVD AUER EFRCOONT, HCEATO << OPOX YY a YUL FR Db FRG bE CHAN), THENIOABERBEMCSZEG CHAN, FROY YRYDA (I-FYayT7) ORNNCKSR (SIMBVOAS bv) CHVFV-t#y YarvEPH DE LIE HIE, YSZ Yap 7 SS VIRL YS CRIA st Drews Ciayay, icles ae 7) aVPAVTy bRHVELK. CHOOOBBRICMZ, RAK-BREKSELAHTC 4 AH 0, ZO AHOKSRADPAEBD) CAPS bHvELE. FVFV—ty Vay, VV VIR, JHIV 5 yy TORA PWEA-DIA F— (DSHS) KOM) CT. Plenary sessions (4) The Mexican commission of biodiversity: assessment of status of Mexican biological diversity J. Soberon The vicarious Gondwanan history of mammals, the other history R. Pascual Body size and biodiversity J. H. Brown The wild and the time in the past and the present J. Clutton-Brock Symposiums (28) 1. Island biogeography, comparisons between insular and mainland populations S. T. Alvarez-C., L. Heaney Mammal collections S-T. Alvarez-C., A. Castro-C., M. Hafner Canids ecology and conservation T. Fuller, M. Mills, D. McDonald Biology of gliding mammals R. Goldingay, J. Scheibe Global changes in mammal diversity at the end of the Pleistocene R. Graham, J. Arroyo-C. Sai Claes) Demography and population dynamics in Clethrionomys L. Hansson, G. Bujalska, N. Yoccoz 7. Evolution and biology of Old and New World Hystricognath rodents R. Honeycutt, Burda 8. Biology of subterranean rodents: evolutionary challenges and opportunities E. Lacey, G. Cameron, J. Patton 9. Biology and management of pest rodents H. Leirs, G. Singleton 10. Ecology of disease and parasites in small mammals: victims and models H. Leirs, H. Henttonen 11. Behavioral and demographic responses to a patchy world: a mammalian perspective W. Lidicker Esl ESM YLAR=< (International Theriological Congress) pater OVY TC Fi ASM LAA 22 75 a 1. AFORE KER O FEAT OV CLA B BWR DAA LETD, 20 HESH CODE 9 RRMA “7 (International Theriological Congress ; LX F Crk ITC EMS MTS) OB ABAED BAIAYLS PRICE SNH CWE. COMM TIE, BEICEAE A REM SES ORN AT bn CRE LCM, SE 5 A 8 AICO MRAS TES, SbICA AM cee ies LE Li. CORR, ITC O BAIL, SAL SOICFRO Be (EEL, AA OMAR ZORBICKS < BRITS EH L, [RRC LCRAMOF A CHis GIR CRAIC RER) whys | & Oiiawlc wLELK. Lal, BRRFSOREIL, KETO HS CL 2, AFSC - SAIC KE ABRBAD OC LICERN ED. Lieto, [ARCEMLHDS | KOK ABOTR READER AS LIAS SD ECEHO EVA. ME ITC AA (Q0014EB7 7 ) DHEA) OX TD 2 MRE RD EPL AND [AB] oR < & MOREA AKIC ITC HHMI AS DBD 0, GFOBRBKS Clk [ARTE iae HED SOL | ICRA CR BOR SA ORRY WKEEERWEBZCWED. COLORES, ZHEBASOR ITC RBOT SYVEX BAKE L, ITC HEM BOTH B ES RICHERTSCLAEROELK. LOL, BEBO CHA OKA RIC FIT Se LCE SCL TEDHOED. CORD, SAIC COMPRA LURARICARY BEV TARR PEL, S5ICGHEO ITC ONAP HACKS SHEAEO ene, ERR ReO BAEIC Bd SEY - SR, FON 4) y bree eA THK CEICL Ele. tavveRk dhe (FRE LCLANOA A CEMA S | = LIC 4 HL LO CHEAP Sv». feds, BLM CHEE > CV AiARIS, EEA EAMMAMICED bNREOCH (ABBORD [HAMEED | OMAHA TRIMER). Lito, BHC DIS BRA CBE SH DBAS EA CUS ARE HOES. CORIO TIL BHP LOCO WESS FE SW: 2. ITC chive MmORERICOWT Ae be USB) > PHE5 (al: Bleeatees) ITC OBAERTBIA, 1997 OT ATA AKSOPAC ITC BBBDOSATBANKE LCM SOC, VRB WeBD CR CPA bm BRAROUEK CRO DbE Lae BRLEF. ITC (294A SFOR 4 DEN c RAR, HAMAR eWRE LCI (aa: SR 137 Author Abe, H. Abe, S. Agungriyono, S. Ando, A. Ando, K. Asada, M. Asakawa, M. Atoda, O. Boonsong, P. Chan-ard, T. Doi, T. Endo, A. Endo, H. Funakoshi, K. Gao; Z: Z.. Han, S. H. Hayashi, Y. lanai oY Hondo, D. Hongmark, S. Inuzuka, N. Ishibashi, Y. Jiang, Z.W. Jin, K. Kaji, K. Kaneko, Y. Kanzaki, N. Kawamichi, T. Kurohmaru, M. Mano, T. Maruyama, N. Masuda, R. Mori, T. Motokawa, M. Murakami, T. Nabhitabhata, J. ee LS, a5 sell > 45 65 5 15338 838 @5) is) 223 i/ a37s23> 1 : 95; 23: 49 : 63 lise 25 8 ai) Tle SOS NGS 8109 : 109 SeSilerso3 25379 Se 7-238 1 : 41 : 109 Nadee, N. Nagata, J. Nakamura, K. Nakata, K. Nakatsu, A. Nishiumi, I. Nonaka, N. Ochiai, K. Ohdachi, S. Ohno, W. Saitoh, T. Sakaizumi, M. Satoh, K. Shimazaki, K. Shiraishi, S. Smeenk, C. Sugasawa, K. Suzuki, H. Suzuki, T. Takahashi, K. Takatsuki, S. Takeda, Y. Tomisawa, M. Tsuchiya, K. Tsukada, H. Uraguchi, K. Urayama, K. Wakana, S. Wakayama, T. Yabe, T. Yamada, J. Yamada, T.K. Yamagiwa, D. Yoshida, M. C. Yoshinaga, Y. Zubaid, A. 23: 23: 23: Dike 22: 23: ai lg 21: 21: 24p26 D2): 21: DD: 23: DD: mails 23: 21: 23: D2: DD): 23: 2S: 21: 21: 23: 21: Pile 21: 23: 23: 23: 21: DD: D2: D2: Mammal Study 1 95 119 59232) 19 Pay 1 1337/ 15358235095 653722 ili e23395 53 55 2 15 39 119 45, 53 161 O85 1535 WS 109 393) 23305 I 2331635103 49 109 5), 15) STs 2728 Al 31 59 155125 37 123, 129 1 119 Shy 339233 95 53 95 index raccoon dog radio-tracking radiotelemetry rat, roof Rattus argentiventer — exulans — norvegicus — rattus rDNA red fox reproduction reproductive cycle resource partitioning restoration Rhinolophus cornutus — ferrumequinnum ribosomal DNA Rishiri Island Russia scrotum sexual dimorphism sexual maturity Shikoku Shiraishi, S. Shiretoko shrew Sichuan sika deer Sikkim silicon reconstruction Sorex caecutiens — gracillimus — unguiculatus South Korea 2S: Oa: 23: DS: 23: 23: 23: 23: alt: 21: 23: Mpeg 23: 21: 23): 23: Di: 21: 23): 22: 22: Mp9 eile D2: Dil: Qiks Pale 21: 21: 23: Pails 21: Dik: pails 109 Di 41 123 129 129 9, 129 123, 129 15 1B 72222 Til 28205) 19, 103 95 49 43 49 49 Sy 125 15 63 81 53 S23 319 71 1 13722 3e/ aol 652.22 1 89 Pil NSBR PBR LS IKOS) 161 119 65 65 65 125 spatial segregation species diversity Stipa surface activity sympatric Szechwan Talpidae taxonomic revision taxonomy telemetry system temperature temporal muscle testis trace recorder triangle size twin twinning rate ultrasonic vocalization ultrastructure underground activity Ursus arctos vole, gray-sided —, Japanese field — , northern red-backed — , red-backed =, Stn — , Smith’s red-backed Vulpes vulpes wildlife conservation Yunnan 21: 2apee 23: 22): 235 21: 21: vA Aai18 apy 23: 23: 248 23: 23: 23: 23: 2 23: 22: 23: Dupe 2s papa 2g Zr Ia 21: 23: AA Ie 136 S13023279 109 41 103 103 53 85 11 41 5 5929222 5832349555 39 1522245 161 45 137; 2207 eas 63 89 135 heterozygosity histochemistry Hokkaido home range Honshu identification Inner Mongolia insectivorous bat interference competition Japan Jindo island joint angle Kanto kinematic gait analysis Korea Kyushu laboratory mouse laboratory rat lens weight limitation of reproduction locomotion longevity Malayan pangolin mammal mandible Manis javanica masseter muscle masticatory muscle Mesocricetus auratus microsatellite DNA Microtinae Microtus Microtus montebelli — pennsylvanicus — sikimensis Miniopterus fuliginosus mink, American mitochondrial DNA Mogera Mogera imaizumii Mogera minor — tokudae — wogera 23: 23: 21: D2: 23: 21: Pails 21: 23: 23: Dap ai D2 23: Dile ail Dil 21: 21: Dike: 23: 23: DD: D3: 21: 21: 23: Bilt: 23: 23: 2S) 23: 23: D2: DD: DD: Dili: 23: 21: 21: 23: 21: 21: 21: 21: pail 21: ails 95 9 53 OS, lls lil, 7le 31, 41, 95 D295 254 109 il 89 63 49 11 Se 77/5 S39 le 7s 31, 41, 103 125 43 59 43 15 71: 23: 49 SLR IR D354 S82 9, 85 1 161 49 37 IS}, 1S Mls AS Mls WAS 115 71 Mls 1S molar mole, Japanese Mongolia Mongolian gazelle morphological variation mouse, Japanese field — , Japanese wood — , striped field Mt. Goyo mtDNA murids Mus musculus Musculi digastricus — masseter — mylohyoideus — temporalis Mustela Myotis macrodactylus — nattereri Nara Nara River nasal sac Nemuro Peninsula Neodon sikimensis nest burrows nests neuromuscular junction niche shift nocturnal activity Nozaki Island Nyctereutes procyonoides Ochotona daurica optic lens orange, tankan Oshima pangolin pawpad lamillae PCR primer Petaurista leucogenys Phocoenoides dalli pika, Daurian Pitymys sikimensis polymorphism population density porpoise, Dall’s postnatal development prey selection Procapra gutturosa provisions pulmonary vein ile 21: 23: 2S: 21: 23: 21: 21: 23: 21: 23: 23: 23: DS: 23: 2S: 21: 23: DS: D3: ile 23: 23: Pails DD: DD: 23: DR: 2p 48 Palle 23: D2: pap 23: 23: 23: 23: Dapp pape DS): 2p 92 21: Dit: 23: 23: DD: 23: 23: 21: Zit: Mammal Study 1 Wis WIS 63 63 89 19 Sy) 125) 105 IS V5) 129 5 81; 23: 79 119 89 161 iSeel25 19 119 SBS 2-838 tsp) 49 63 11339/ 37 index Index This index covers Mammal Study Vol. 21 (1996) to Vol. 23 (1998). Subject Abe, H. acetylcholinesterase acquisition age at sexual maturity age determination age estimation age variation Amami Oshima Aneurolepidium chinense Apodemus Apodemus agrarius Apodemus argenteus Apodemus speciosus Arvicola Arvicola sikimensis Arvicolidae Asahikawa automatic collar release system bark-stripping begging behavior Boso Peninsula bottle neck breeding season brown bear cardiac musculature cardiac myocyte Cervus nippon Cheju Island Chiba China Citrus tankan Clethrionomys Clethrionomys glareolus — montanus = is — rufocanus — rutilus — sikotanensis coexistence conception date condylobasal length Cynopterus Daikoku Islet Delphinus delphis 22: 23: Ds 23: 22: 2096 24118 23: 23: 225 21: 2p 4p Male Dit: Dit: 21: 225 23: 23: mails 21: 23: 23: 23): rails 21: 2A 21: Dil: Dil: 23: 21: Dil: ah |p 21: 21: Dike 21: D2: 21: 21: 22: 21: 23: 15 WS 28 ME) 595 225271 161 161 89 27 109 123 137 153 95 19 4] 3) By) Zils NSBR PRE Cd MOB 125 153; 23: 95 89; 23: 63 123 ISR 2418. Si, Pall 1 15 15 els 222.5527, ISS 2428 39) 15 11 153 den digastric muscle distribution dolphin, common dynamic interaction enamel pattern Eothenomys Eothenomys andersoni — chinensis — custos — eva — inez — olitor — proditor — regulus — shanseius — smithii — wardi ermine error estimation eye lens fecal analysis ferret fiber types field test flying squirrel — , Japanese giant food begging behavior food habits food shortage foraging behavior forest structure forestry gait analysis geographic variation Geoje island golden hamster Gompertz equation Goto Archipelago growth curve habitat factor habitat preference habitat selection haplotype 23: DS: Dil: 23: 21: 21: 2p42 Dike 21: ilk: ile Pai IB 21: 21: 21: Pai le 21: 21: Dit 23: 2p 23: 21: 23: 23: pee 22: DD: Zit: DD: 2: 74942 22%: 21: Ot 74) (2 23) 2p 2 21: 22 21: 21: 23: 71418 1; 22: 45 41 81; 23: 79 81; 23: 79 71 137; 23: 9, 49 89 137227195 Dil Di Instructions to contributors Mammal Study publishes original Articles, Short Communications and Reviews, written in English, on all aspects of mammalogy. In principle, membership of the Society is pre- requisite for the submission of papers except for invited papers, but non-members may be co-authors. Manuscripts are submitted to qualified referees for critical scientific reviewing. Authors are notified, with referees’ comments, on acceptance, rejection or need for revision within three months. The editor also customarily sends accepted manuscripts to qualified reviewers for English editing. Manuscripts should be submitted typewritten on one side of the paper (use A4 21.0 x 29.7 cm paper), and double-spaced. An approximately 3 cm margin should be left on all sides. Do not hyphenate words at the right margin. Manuscripts should be arranged in the following order: the title, name(s) of author(s) and affiliation, fax number and E-mail address, abstract (fewer than 200 words) and key words (five words or fewer), main text, acknowledgments, references, tables, figure legends, figures. Titles of papers must be ac- curate and concise, and (for abstraction services) include any relevant taxonomic name. Text pages should be numbered through from title to references. Manuscripts should be line-numbered, every five lines, in the left margin. Short Communications do not exceed four printed pages. Abstracts and key words are omitted from Short Communications. Tables and figures should be simple and self-explanatory, and their preferred locations should be indicated in the right margin of the text. The author’s name and figure numbers should be written on the back of original figures and on the surface of copies. Scientific names should be written in italic. All measurements should be in metric units. The following abbreviations should be used. Length: km, m, cm, mm, etc.; area: km?, m?, cic = volume: kim, m>°, kl, Il, mil, etc.; weight: ke, g, mg, etc.; time: hr, min, sec, etc.; others: cal, kcal, °C, Hz, df, P (probability), SD, SE, CV, etc. Arabic numerals should be used for numbers exceeding 10. References in the text should follow the forms: “Uchida and Shiraishi (1985) stated that ...., (Abe and Kawamichi 1990), and (Miura et al. 1993). More than one reference within the same parentheses should be listed chronologically, alphabetically if of the same year. Full references cited must be listed alphabetically by the first author according to the fol- lowing examples: Abe, H., Shiraishi, S. and Arai, S. 1991. A new mole from Uotsuri-jima, the Ryukyu Is- lands. Journal of the Mammalogical Society of Japan 15: 47-60. Eisenberg, J. F. 1981. The Mammalian Radiations. University of Chicago Press, Chicago, 610 pp. Geist, V. 1982. Adaptive behavioral strategies. In (J. W. Thomas and D. E. Toweill, eds.) Elk of North America. Pp. 219-277. Stackpole, Harrisburg. Obara, Y. 1991. Karyosystematics of the mustelid carnivores of Japan. Honyurui Kagaku [Mammalian Science] 30: 197-220 (in Japanese with English abstract). Authors are recommended to refer to recent issues of the journal for details of style and layout. Manuscripts should be submitted in triplicate, with a separate sheet giving the title, author(s), name(s), and address(es) for editorial correspondence, a running head (fewer than 20 letters), the numbers of main text pages, tables and figures. Do not send original figures until the paper has been accepted. Galley proofs will be sent to the author. Reprints may be purchased in blocks of 50. Mammal Study Vol. 24, No. 1, June 1999 Contents Original papers Hashimoto, Y. and Yasutake, A.: Seasonal changes in body weight of female Asiatic black bears under captivity :--:-:--:-+:-1: tee crecet terete eee ee ee ee Lee, T. H. and Fukuda, H.: The distribution and habitat use of the Eurasian red squirrel Sciurus vulgaris L. ee summer, in Nopporo Forest Park, Hokkaido Sie ob eilevin sale eyrah w (a js'Uelle (oileh lemon entep arreieitey wise tesreilay ayreawea todwires sewatie epteltel aire iemaytor cite eaOweM eon eR eISn Cue Cn omen Sn RG ieaeaemene PR Eso ah Takahashi, H., Kaji, K. and Koizumi, T.: Molar + wear rates in Sika deer during three population phases: increasing versus decline and post- peti phases \iSiegs ial aie use la G cighsiageie wlebie cress weld baie le Re Ole Deas be ene 7 Hosoda, T., Suzuki, H., Iwasa, M.A., Hayashida, M., Watanabe, Sa Tatara, M. and Tsuchiya, K.: Genetic relationships within and between the Japanese marten Martes melampus and the sable M. zibellina, based — on variation of mitochondrial DNA and nuclear ribosomal DNA -::::: ee DS Iwasa, M.A., Han, S.H. and Suzuki, H.: A karyological analysis of the Korean red-backed vole, Eothenomys regulus (Rodentia, Muridae), using differential staining MCAtThOdS crc rrr en ene tence eee eee enna 35 Suzuki, H., Iwasa, M.A., Ishii, N., Nagaoka, H. and Tsuchiya, K.: The genetic status of two insular populations of the endemic spiny rat Tokudaia osimensis (Rodentia, Muridae) of the Ryukyu Islands, Japan The Mammalogical Society of Japan Vee De oo ik come meee ISSN 1343-4152 f the Journal of ion oO t The Continua iety of Japan | Soc Ica : the Mammalog Tere Snelson Se nu fe) Z + N To > @D xz ® = ® O ® ra The Mammalogical Society of Japan Mammal Study Vol. 24, No. 2, December 1999 The continuation of the Journal of the Mammalogical Society of Japan Editor-in-Chief: Takashi Saitoh Associate Editor: Takuya Shimada Editorial Board: Masao Amano, Mark A. Brazil, Nikolai E. Dokuchaev, Sang Hoon Han, Allexei P. Kryukov, Tsutomu Mano, Masaharu Motokawa, Satoshi Ohdachi, Tsuneo Sekijima, Hitoshi Suzuki, Masatsugu Suzuki, Seiki Takatsuki, Hidetoshi Tamate, Toshio Tsubota, Akihiro Yamane All correspondence regarding manuscripts and editorial matters should be addressed to: Dr. Takashi Saitoh Kansai Research Center Forestry and Forest Products Research Institute Momoyama, Kyoto 612-0855, Japan Phone: +81(Japan)-75-611-1201; Fax: +81(Japan)-75-611-1207 E-mail: bedford@fsm.afirc.go.jp Published by The Mammalogical Society of Japan Officers and Council Members for 1999-2000 President: Noriyuki Ohtaishi Secretary General: Masatsugu Suzuki Executive Secretary: Keisuke Nakata Treasurers: Toshihiro Hazumi, Nobuo Ishii Council Members: Hisashi Abe, Teruo Doi, Hideki Endo, Kimitake Funakoshi, Koichi Kaji, Yukibumi Kaneko, Takeo Kawamichi, Kishio Maeda, Shingo Miura, Okimasa Murakami, Takashi Saitoh, Seiki Takatsuki The Mammalogical Society of Japan was founded in 1987 for the purpose of promoting and fostering mammalogy. The society publishes original papers in two journals: Mammal Study (the continuation of the Journal of the Mammalogical Society of Japan) for papers written in English, and Honyurui Kagaku [Mammalian Science] for those submitted in Japanese. Each journal is published twice a year. Submissions are considered on the understanding that they are being offered solely for publication by the Mammalogical Society of Japan. Both journals are distributed free of charge to the members of the Society. The following are the annual dues for the membership: Domestic members Individual members ¥9,000 (Student ¥7,000) Institutional subscriptions ¥25,000 Overseas members only for Mammal Study Individual members ¥4,500 Institutional subscriptions ¥12,500 Overseas members for both journals Individual members ¥9,000 Institutional subscriptions ¥25,000 All correspondence regarding application for membership, subscription, address change, and other matters should be addressed to: The Mammalogical Society of Japan Business Center for Academic Societies of Japan, Academic Society Center C21, 16-9 Honkomagome, 5-chome, Bunkyo-Ku, Tokyo 113-8622, Japan Fax: +81(Japan)-3-5814-5820 (©1999 The Mammalogical Society of Japan All articles published in Mammal Study are protected by copyright. Any form of reproduction requires prior written permission from the Mammalogical Society of Japan, with exception of personal photocopying. Front cover: The red-backed vole with their chromosomes illustrated by Makiko Kashiwagi. Printed in Japan by Nakanishi Printing Co. Ltd., Kyoto. Mammal Study 24: 51-65 (1999) © the Mammalogical Society of Japan Morphometric variation of house mice (Mus musculus) on the Izu Islands Yasushi Takada!, Eiichi Sakai?, Yasushi Uematsu? and Takashi Tateishi* 1,2,3Department of Anatomy, School of Dentistry, Aichi-Gakuin University, Chikusa-ku, Nagoya 464- 8650, Japan 4Omiya Research Laboratory, Nikken Chemicals Co. Ltd, Kitabukuro, Omiya 330-0835, Japan Abstract. We conducted univariate and multivariate statistical analyses of the morphometry of five island populations of the house mouse Mus musculus, from the Izu Islands (Oshima, Nijima, Kozushima, Miyakejima, Hachijojima), and compared them with three populations from the Japanese mainland of Honshu (from Kamogawa, Yokosuka, and Kawazu). Anal- yses were based on bodies, mandibles and molars. According to the analyses based on the mandible and molar measurements, the island samples differed from each other, and many of them also differed from the Honshu samples, although there was no evidence of positive directional variation, such as gigantism, in the insular samples. Cluster analyses of mor- phological distance, based on mandible and molar measurements, indicated that the island populations, with the exception of that on Oshima, were closely related to those on Honshu, while the Oshima population was slightly more distantly related. These results indicate that the divergence of the island populations is mainly attributable to the genetic variation of the initial founders and to subsequent isolation. The differentiation of the island populations may have taken place as recently as within the past 1,200 years. Key words: Izu Islands, mandible, molar, morphometric variation, Mus musculus. Islands are physically isolated, and changes amongst island populations can be expected to be conserved and to progress rapidly. Information concerning morphological and genetic changes in island populations is important, therefore, in contributing to an understanding of speciation. Island populations of rodents have proven to differ morphologically and geneti- cally from both mainland populations and from each other (see for example Hiraiwa et al. 1958; Miyao et al. 1968; Berry 1969; Berry and Rose 1975; Berry and Peters 1977; Berry et al. 1978; Sakai and Miyao 1979). That these genetic differences can accumulate rapidly, has been shown by Berry and Jakobson’s (1975) classic example of a mouse population on Skokholm Island, UK, which showed genetic changes over just 30 years. The house mouse Mus musculus (or Mus molossinus according to Marshall and Sage (1981)), occurs on many of the small Japanese islands (Imaizumi 1960; Abe et al. 1994). So far, genetic studies using biochemical markers have concentrated on the geographical varia- tion amongst house mice throughout Japan (Minezawa et al. 1979, 1980), but they have not ‘E-mail: ytaka@dpc.aichi-gakuin.ac.jp 52 Mammal Study 24 (1999) found clear-cut divergences among insular populations, presumably due to the small number of specimens examined from each locality and because of the limited number of markers. Several studies have also revealed morphological variations amongst some insular house mice populations (Suzuki 1980; Takada et al. 1994), however, populations within an archipelago have not, so far, been studied. The Izu Islands lie 90 km (Oshima) to 350 km (Aogashima) south of Tokyo Bay (Fig. 1). They range in size from Oshima, which at 91 km? is the largest, to Toshima and Shikinejima, which at just 4 km? are the smallest. These islands are mostly inhabited, but have just five species of rodents and insectivores. These are the house mouse, two species of rats Rattus norvegicus and R. rattus, the Japanese field mouse Apodemus speciosus, and the white- toothed shrew Crocidura dsinezumi (Nishikata 1986; Takada et al. 1999). Both the field mouse and the house mouse occur together on Oshima, Nijima, Kozushima (Kozu) and Miyakejima (Miyake). In addition, field mice alone are found on Shikinejima, and house mice are found alone on Hachijojima (Hachijo). White-toothed shrews occur on Toshima, Nijima and Shikinejima. In this paper, we describe the morphological differentiation of house mice in the Izu archipelago, having analyzed morphological variation amongst five insular populations from Oshima, Nijima, Kozu, Miyake and Hachijo. Furthermore, we compare these five island YOKOSUKA 35 ® ostima c] NIJIMA A KOZU e MIYAKE 3 4° Ee ) —p Z HACHIJO ¥ 33 N 140° E Fig. 1. A map showing sampling localities. Takada et al., Mice on the Izu Islands 53 populations with three mainland populations from Kamogawa (Boso Peninsula), Yokosuka (Miura Peninsula) and Kawazu (Izu Peninsula) areas of Honshu, the Japanese mainland. Materials and methods House mice were collected from December to March 1994 to 1997, using snap and live traps set in grassland around cultivated fields. Each island and peninsula was visited once for four to five days, with the exception of Kozu, which was visited three times in 1995 and 1996. The following data were recorded: sex, body weight (BW; for pregnant females, excluding embryos and uterus), head and body length (HBL; from rostrum to anus), tail length (TL; from anus to tail tip) and hindfoot length (HFL). The age of the mice specimens collected was predicted using a linear regression equation of eye lens weight against age (after Takada 1985). Only data from adults (two months old and more) were analyzed for bodily dimensions. Mouse heads were skinned and boiled for several minutes in water then soaked with a tripsin solution in order to produce clean skeletons (following Takada et al.’s (1994) tech- nique). The right mandibles and right molars were measured to the nearest 1/100mm and 1/1000 mm, respectively, using a Nikon Measurescope. For mandible measurements, only specimens aged two to eight months old were used in order to reduce age-related variation (Lovell et al. 1984). The X-axis was fixed as the inferior edge of the mandible and the Y-axis as the anterior edge. Ten dimensions were measured; five (M1-MS) consisted of heights and the other five (M6-M10) of lengths (Fig. 2). The buccolingual crown diameter was measured for upper (UM1 to UMS3) and lower molars (LMI to LM3). The occlusal surface was kept horizontal and the widest part of the crown was measured at right angles to the longitudinal axis of each molar; the axis being a line connecting the central cusps for upper molars, and the central groove for lower ones. For molar measurements, specimens with slightly worn cusps (dental wear categories 3 and 4 in Lidicker’s (1966) criteria) were used, and an average of two measurements for each molar was used for the following analyses. Measurement errors were negligible; for the Oshima sample (1=27), Gerrors WaS 2.1-:10~3 to 3.1-10~3 mm for each molar, where o2,,5,; was the sum of the squared difference of the two measurements divided by 2n (after Murai 1975). Because no significant sexual differences (P>0.05) were found (either for body (HBL, Fig. 2. Diagram of right mandible showing the 10 measurements. 54 Mammal Study 24 (1999) HEL, tail ratios=TL/HBL), or mandible or molar measurements; tested by f-statistics and Mann-Whitney’s U- one TTEST and UTEST respectively (see Aoki 1995) for body, and using Wilks’ A- one (WILKS, Aoki 1995) for mandible and molar measurements), data from both sexes were pooled for the following analyses. Morphometric differences between samples were analyzed using univariate and multi- variate statistics. Significant differences between sample pairs were tested using the Scheffé’s method of multiple comparisons after Kruskal-Wallis test for the tail ratio, and using Ryan’s method of multiple comparisons for the other variables (KWTEST and MCOMP respec- tively, Aoki 1995). To evaluate the divergence of the island samples, the relative deviation from the Yokosuka sample, one of the mainland samples with a relatively large number of specimens, was calculated using (mean,;—mean,)/SD,, where, mean, was a sample mean, and mean, and SD, were the mean and SD of the Yokosuka sample. For multivariate statis- tics, principal component analysis (PCA, Tanaka et al. 1984), using a correlation matrix of pooled samples, was employed. Mahalanobis’ generalized distance (D?) was calculated as an indication of morphological divergence between samples (MAHPCV, Tanaka et al. 1984). Cluster analysis (CLUST, Tanaka et al. 1984) was also carried out using the group average method based on D?. Results Body sizes Significant differences between sample pairs were tested for HBL, HFL and tail ratios, but no positive directional change was found among insular and mainland samples. For sample means and SDs of adult mice see Table 1, and for a list of variables indicating significant differences between samples see the Appendix. Table 1. Measurements for body size. For each measurement, sample means, SD, and number of specimens are given from the top. Oshima Nijima Kozu Miyake Hachijo Kawazu) Kamogawa Yokosuka BW (g) 11.18 10.96 IDS 11.68 12.30 12.47 15.82 10.42 2.67 155583 2.94 1.91 1.94 2.02 2.28 Dei 16 29 22 15 26 25 21 27 HBL (mm) 68.16 68.90 68.59 69.11 71.48 71.30 75.59 65.27 5.86 4.82 6.21 4.82 5.29 5.40 4.42 5.36 17 30 22 15 26 26 21 26 TL (mm) 55.89 57.66 56.00 59.51 62.02 60.71 59.42 55.14 4.01 4.62 4.63 3.06 2.80 4.32 3.08 2.42 15 30 7p) 15 26 25 Dp Di, HFL (mm) 15235 15.63 15.28 5.28 15.67 15.74 15.74 15.46 0.46 0.38 0.38 0.43 0.32 0.56 0.40 0.27 17 30 22 15 26 26 22 27 TL/HBL (%) 82.15 83.85 81.81 86.29 87.03 85.09 78.43 85.00 4.24 6.19 4.52 4.25 4.49 5.02 3.74 5.34 15 30 DD, 15 26 D5 Diy 26 BW: body weight; HBL: head and body length; TL: tail length; HFL: hindfoot length. Takada et al., Mice on the Izu Islands 55 Mandible and molar measurements Significant differences were found in variables between all pairs of sample means (see Table 2 for mandibles and Table 3 for molars). Principal component analysis The first component, expressing the overall size of the mandibles, arranges the samples from the largest, Kamogawa, to the smallest, Yokosuka and Miyake (see Table 4, Fig. 3). The second component, expressing the shape, particularly the height (M1, M2, M4; positive vector) to the length (M6, M7, M8; negative vector), arranges the samples from the highest, Oshima, to the lowest, Hachijo, Miyake and Kawazu. The third component, expressing relative height of the posterior (M3, M4, M5; positive vector) to anterior part (M1, M2; Table 2. Measurements for mandible (x 100, in mm). For each measurement, sample means, SD, and relative deviation from Yokosuka sample are given from the top. n, number of specimens. Oshima Nijima Kozu Miyake Hachijo Kawazu Kamogawa Yokosuka n 14 28 18 16 16 24 18 ZS Age mean 78 116 90 86 113 115 106 78 in days SD 16 45 30 DY 53 39 SY) 19 M1 164.3 165.4 155.4 156.6 155.4 154.9 165.7 152.6 5.6 5.4 6.1 53 6.0 5.6 S)s5) 5.0 2.32 2.54 0.56 0.79 0.56 0.45 2.60 0.00 M2 224.6 214.7 207.0 209.6 206.4 209.1 7998) 7) 205.9 7.8 83 9.4 8.8 9.5 9.4 8.8 7.6 2.46 Wohl 0.14 0.48 0.07 0.42 Dall 0.00 M3 434.4 452.3 457.3 428.9 446.8 442.9 455.2 433.9 So] 13:3 Yo 11.6 23.4 16.9 15.6 13.3 0.04 1.38 1.76 — 0.38 0.97 0.68 1.60 0.00 M4 476.3 476.6 481.0 441.3 475.9 468.3 489.0 465.1 16.8 16.5 20.0 12.9 26.9 17.3 Let 16.2 0.69 0.71 0.98 — 1.47 0.67 0.20 1.48 0.00 M5 541.2 546.5 556.2 520.8 544.9 550.9 S58), 530.1 S\o7/ 16.0 25.3 es 30.5 20.2 20.3 16.6 0.67 0.99 ilo =) 0.90 1.26 1.78 0.00 M6 22s 742.6 741.2 755.4 ISVS 762.9 767.6 729.8 19.8 24.5 De ISI 34.9 35.4 DOr 21.4 — 0.34 0.60 0.53 1.19 1.29 1.54 1.76 0.00 M7 781.8 795.5 793.9 797.4 798.9 829.6 818.2 773.8 24.2 Dies 33.9 Die 43.8 43.3 31.9 26.6 0.30 0.82 0.76 0.89 0.94 2.10 1.67 0.00 M8 894.9 907.0 897.1 907.2 941.3 929°5 939.4 893.7 25.6 28.8 33.8 20.4 41.0 32.9 23.6 24.4 0.05 0.55 0.14 0.55 1.95 1.47 1.87 0.00 M9 1012.1 1004.8 991.9 1011.8 1047.1 1025.2 1054.1 987.7 30.0 34.2 40.9 23.9 49.8 34.1 30.9 ell 0.76 0.53 0.13 0.75 1.85 ele) 2.07 0.00 M10 1047.5 1069.5 1068.2 1051.8 1086.9 1078.1 1103.3 1049.3 3)3).8) 36.1 47.4 23.3 44.1 43.9 31.6 33.5 — 0.05 0.60 0.57 0.07 1.12 0.86 1.61 0.00 56 Mammal Study 24 (1999) Table 3. Measurements for molar (i > 5 + re 2 , Mee eae Pl Kes at pe oe ii Tes GS 7 _- s a = ES . } = ; 3 — bd + 1 é i a ‘ he. 4 = ( — i 4 = s 5 J = % y » , fi : { 2 ( , a7 fe ae = ; i : x - ; = Hi Se y 2 a . f = - % ! Z } iL = 2» 3 cy ~ ra / re a : i i i . 7 a ke La , * x f { 2 7 1 F a ~ i igs y e } o \ \ é j j r € ¥ i = i ~~ Mammal Study 24: 67-78 (1999) © the Mammalogical Society of Japan Morphometric status of shrews of the Sorex caecutiens/shinto eroup in Japan Nikolai E. Dokuchaev!, Satoshi Ohdachi* and Hisashi Abe? 'Institute of Biological Problems of the North, Magadan 685000, Russia 2Institute of Low Temperature Science, Hokkaido University, Sapporo 060-0819, Japan 3Katsuraoka 26-17, Otaru 047-0264, Japan Abstract. The morphometric relationships among five operational taxonomic units of the Sorex caecutiens/shinto group (Soricidae) (S. caecutiens of Hokkaido, S. shinto shinto of Honshu including the S. chouei holotype, S. s. shikokensis of Shikoku, and S.s. sadonis of Sado) in the Japanese Islands, were examined using uni- and multivariate analyses of 15 cranial, dental, and external characters. The morphological analyses showed that the shrew from Hokkaido (S. caecutiens) and those from Honshu, Shikoku, and Sado (S. shinto) were exclusively differentiated. In particular, the surface structure of the fourth upper premolar completely separated the two taxa. In contrast, S. s. sadonis from Sado could not be com- pletely distinguished from related taxa from Honshu and Shikoku. Thus these morpho- metric analyses re-confirm that S. caecutiens of Hokkaido, and S. shinto from Honshu, Shikoku, and Sado, should be treated as two separate species, as has previously been pro- posed on the basis of a molecular phylogenetical study. Key words: Sorex caecutiens, S. shinto, sadonis, shikokensis, taxonomy. Thomas (1905, 1906) described Sorex shinto as a new shrew species from Honshu Island. Later, he described a new subspecies, S. shinto saevus, from Sakhalin Island and included the island of Hokkaido in its distributional range (Thomas 1907). Thomas (1907) did not find any morphological specific differences, however, among the shrews from Honshu, Hokkaido, and Sakhalin Islands. In the years since Thomas’s (1907) study, the taxonomic treatment of S. shinto and other taxa of the Sorex caecutiens/shinto group (in the sense of Ohdachi et al. 1997a) has varied. Bobrinskii et al. (1944) treated some medium-sized shrews from Eurasia, including S. shinto described by Thomas (1907), as a single species, S. macropygmaeus Miller, 1901. Ellerman and Morrison-Scott (1951) accepted Bobrinskii et al’s (1944) systematic concept, but they synonymized S$. macropygmaeus with S. caecutiens Laxmann, 1788. Stroganov (1957), who investigated the shrews from Sakhalin, Hokkaido, and the southern Kurile Islands in great details, concluded that the shrews in Hokkaido and Sakhalin, described as S. shinto saevus by Thomas (1907), should be included in S. caecutiens, as Ellerman and Morrison-Scott (1951) did. However, without inspecting Sorex samples from Honshu, Stroganov (1957) To whom correspondence should be addressed. E-mail: ohd@pop.lowtem.hokudai.ac.jp 68 Mammal Study 24 (1999) considered that the shrews of Honshu were a subspecies of S. caecutiens, S. c. shinto. Since Stroganov’s (1957) investigation, there have been two main opinions concerning the taxonomic status of shinto in the caecutiens/shinto group. On the one hand, some authors have objected to the specific rank of shinto, and have followed Stroganov (1957) in including it in S. caecutiens (e.g. Bobrinskii et al. 1965; Abe 1967, 1994; Gureev 1971, 1979; Yudin 1971, 1989; Corbet 1978; Gromov and Baranova 1981; Krivosheev 1984; Dolgov 1985; Okhotina 1993; Dobson 1994). Furthermore, with regard to the subspecific status of the caecutiens/shinto shrews of the Japanese Islands and vicinity, Abe (1967, 1994) treated the population of Honshu as S. caecutiens shinto, that of Shikoku as S. c. shikokensis, and that of Hokkaido and Sakhalin as S. c. saevus. On the other hand, some authors have been of the taxonomic opinion that S. shinto should be considered as an independent species that occurs in Honshu, Shikoku, and Hokkaido (and Sakhalin, according to some authors) while S. caecutiens across the Eurasian Continent (and in Sakhalin according to some authors), essentially following Thomas’s (1907) position (e.g. Imaizumi 1949, 1960; Sokolov 1973; Yoshiyuki and Imaizumi 1986; Pavlinov and Rossolimo 1987; Hutterer 1993; Pavlinov et al. 1995; Wolsan and Hutterer 1998). In addition, Imaizumi (1954) described S. chouei from Honshu as a new species, although this was later synonymized with S. caecutiens (Abe 1967, 1994, 1996) or S. shinto (Imaizumi 1970; Hutterer 1993). There has been the additional controversy in Japan concerning the taxonomic status of the Sado shrew as part of the caecutiens/shinto group. This taxon was first described by Yoshiyuki and Imaizumi (1986) from Sado Island. While some authors treat it as an in- dependent species, S. sadonis Yoshiyuki et Imaizumi, 1986 (e.g. Abe 1994, 1996; Wolsan and Hutterer 1998), others suggest that it should be considered a subspecies of S. shinto, S.s. sadonis (Ohdachi et al. 1997a; Koyasu 1998). Ohdachi et al. (1997a) recently used the DNA sequences of the mitochondrial cyto- chrome b gene to reveal the phylogenetical relationships among northeastern Asiatic soricine shrews. Their work indicated that all of the shrews from Honshu, Shikoku, and Sado should be considered as belonging to a single species, S. shinto, whereas those from Hokkaido and Sakhalin, belonged to the widespread Eurasian continental species, S. caecutiens. This taxonomic scheme has subsequently been followed by Koyasu (1998). No investigations have been made, however, of the morphological relationships among the local populations (or subspecies) of S. caecutiens and S. shinto. Our goal was to reveal the morphological status of the Sorex caecutiens/shinto group in the Japanese Islands (Hokkaido, Honshu, Shikoku, and Sado). As a result of this research, we are able to offer a morphological diagnosis making it possible to distinguish S. shinto from S. caecutiens (in the sense of Ohdachi et al. 1997a and Koyasu 1998). Materials and methods We have followed the taxonomic approach of Ohdachi et al. (1997a) and Koyasu (1998) for the caecutiens/shinto group, and call the shrews of Hokkaido S. caecutiens, those of Honshu (including S. chouei Imaizumi, 1954) S. shinto shinto, those from Sado S. s. sadonis, and those from Shikoku S. s. shikokensis. These five operational taxonomic units (OTUs) were used for the present investigation. As to geographical terms, we refer the total area of Honshu, Shikoku, and Sado Islands to the “Honshu complex”. Dokuchaey et al., Morphometric status of the Sorex caecutiens/shinto group 69 Specimens of the Sorex caecutiens/shinto group at the National Science Museum (Tokyo), the Natural History Museum, Faculty of Agriculture (K. Maekawa and H. Abe collections), and the Institute of Low Temperature Science (S. Ohdachi collection), Hokkaido University (Sapporo), were examined to provide the basic data for this study. Undamaged skulls of 40 S. caecutiens from Hokkaido, 45 S. shinto from Honshu (including the holotype of S. chouei Imaizumi, 1954, specimen code NSMT-M12513), one S.s. shikokensis from Shikoku (the holotype of S. caecutiens shikokensis Abe, 1967, NHMHU- 13311), and six S. s. sadonis from Sado (including the holotype of S. sadonis Yoshiyuki et Imaizumi, 1986, NSMT-M16180) were used for the cranial and dental analyses, and 240 specimens of S. caecutiens from Hokkaido and 25 S. shinto from Honshu were used for the analysis of external characters. Specimen codes and locations are listed in the Appendix. Only young-of-the-year (=sexually immature) specimens were used for the cranial and external measurements, with the exception of the three holotype specimens, all of which had over-wintered (=sexually matured). The reason for choosing primarily immature shrews was that the skulls of the over-wintered shrews tend to be slightly smaller (Ognev 1933; Stroganov 1957; Abe 1967), their teeth may be worn, whereas their external characters, such as body length and body weight, tend to be much greater. The three holotypes were used only for the cranial analyses. Samples from both sexes were pooled for analysis, since there is no significant difference in skull size between males and females of the caecutiens/shinto group (Abe 1967). Nine cranial and dental characters were measured. Definitions for these characters are as follows. 1) Condylobasal length: the length from the anterior medial point of the pre- maxillary bone to the posteriormost point on the occipital condyle. 2) Facial length: the length from the anterior medial point of the premaxillary bone to the posteriormost point of the foramen on the frontal bone. 3) Breadth of the braincase: the maximum width of the braincase. 4) Glenoid width: the maximum width between the right and left mandibular fossae. Definitions for (3) and (4) are illustrated in Dannelid (1994). 5) Width across the second upper unicuspids: the width between the outer margins of the right and left second upper unicuspids (U*) viewed from the crown side. 6) Width across the second upper molars: the width between the outer margins of the right and left second upper molars (M7?) viewed from the crown. 7) Length of the upper molariform tooth row: the length from the anterior point of the fourth upper premolar (i.e. the superficial “third” premolar) to the posterior point of the third molar, viewed from the crown. 8) Length of upper unicuspid row: the length from the anterior point of the first unicuspid to the posterior point of the fifth unicuspid, viewed laterally. 9) Relative basal width of the mesostyle of the fourth upper premolar: length from the anterior point of the fourth upper premolar (Pm‘*) to the posterior point of the mesostyle (“a—-b” distance in Fig. 1) relative to Pm‘ length (“a-c” distance), expressed in percentage (“a-b”/“a-c” x 100). Here, we have followed Stroganov’s (1957) and Dolgov’s (1985) terminology for tooth anatomy. Skull and tooth characters were measured using an ocular micrometer under a binocular microscope, with the exception of the condylobasal length, which was measured using callipers. Most characters were measured to the nearest 0.01 mm, however condylobasal length was measured to the nearest 0.1mm. The relative width of Pm* mesostyle was measured, using digitally-saved images from a photo-capturing system: OLYMPUS micro- scope (SZH10), OLYMPUS-Ikegami CCD camera (ICD-740), and a Macintosh computer 70 Mammal Study 24 (1999) distal medial = — Fig. 1. Buccal view of the fourth right upper premolar of (A) Sorex shinto from Honshu (specimen code, SO- 96misc15) and (B) S. caecutiens from Hokkaido (SO-88n105). Pm‘, fourth upper premolar; M!, first upper molar; US, fifth unicuspid. (Performa 5430). Six external characters, body weight, total body length, tail length, hind-foot length, tail ratio, and hind-foot ratio, were used in the analyses. Measurements of the external charac- ters were obtained from the original specimen labels, once doubtful data has been carefully eliminated. Data from both sexes were combined, since there are no sexual differences in the external characters of young shrews in the caecutiens/shinto group (Abe 1967). For our purposes, the tail ratio was calculated as the percentage tail length to head and body length, and the hind-foot ratio was the percentage to tail length. Multivariate factor, cluster, and discriminant analyses were carried out, using the nine cranial characters. For cluster analysis, the nearest neighbor method using Euclidean distance was applied. Differences in means of cranial and external characters between S. caecutiens in Hokkaido and S. shinto in Honshu were tested using Student’s ¢-test for most characters and Mann-Whitney’s U-test for ratios (relative width of Pm* mesostyle, relative tail length, and relative hind foot length). Results The cranial characters of the shrews from Hokkaido (S. caecutiens) were found to be significantly larger than in those of the shrews from Honshu (S.s. shinto) (Table 1). Remarkable differences between these two taxa were found in the relative basal width of Dokuchaey et al., Morphometric status of the Sorex caecutiens/shinto group 71 Table 1. Means+1SE, ranges (in parentheses), and the results of t- and U-tests of cranial characters in Sorex caecutiens from Hokkaido Island and S. s. shinto from Honshu Island. All the specimens were the young animals. U-test was conducted for relative basal width of Pm* mesostyle, and f-tests for the other characters. S. caecutiens S. s. shinto t or U-test Cranial and dental characters in Hokkaido in Honshu (n=40) (n= 44) is Oe (U/ IP Condylobasal length (mm) 18.0+0.05 17.4+0.06 Well <0.001 (17.0-18.5) (16.5—18.1) Facial length (mm) 9.02+0.033 8.70+0.051 5.10 <0.001 (8.55—9.55) (8.12—9.35) Breadth of braincase (mm) 9.17+0.031 8.73 + 0.034 9.30 <0.001 (8.80—9.60) (8.32—9.30) Glenoid width (mm) 5.04+0.021 4.78 +0.022 8.38 <0.001 (4.70—5.30) (4.55—5.15) Width across U? (mm) 1.81+0.009 17382-0012 5.56 <0.001 (1.70-1.95) (1.50-1.90) Width across M? (mm) 4.23+0.016 4.11+0.020 4.73 <0.001 (4.05—4.50) (3.85—4.40) Length of upper molariform 4.35+0.014 4.20+0.017 6.68 <0.001 tooth row (mm) (4.20—4.60) (3.95—4.42) Length of upper unicuspid row 2A ==0:001 2.49+0.012 15.30 <0.001 (mm) (2.55—2.85) (2.34-2.65) Relative basal width of Pm* 61.2+0.20 54.9+0.20 DAI2AO <0.001 mesostyle (%) (59.3-65.2) (52.1—57.2) Pm‘ mesostyle and the length of the unicuspid row (Table 1). While almost all craniometric characters overlapped between the two taxa, no overlap was found in observed values of the relative width of the Pm* mesostyle (Table 1). The shrews from Hokkaido were heavier, and had longer hind feet than the shrews from Honshu, but they did not differ in their total body length (Table 2). The shrews of Hokkaido could not be distinguished from the shrews of the Honshu complex (S. shinto sspp.) on the basis of the first rotated factor of the factor analysis of the craniometrical characters (Fig. 2), and the average first factor value of Hokkaido shrews was intermediate between those of the shrews from Honshu, and the shrews from Sado and Shikoku (S. s. sadonis and S. s. shikokensis) (Fig. 2). The second rotated factor, however, clearly distinguished between the shrews of Hokkaido and of the Honshu complex (Fig 2). The second rotated factor was greatly contributed to by the relative width of the Pm* mesostyle, as well as the length of upper unicuspid row (Table 3). Cluster analysis showed that the Hokkaido shrews are distant from the shrews of the Honshu complex, which occur in a closely related single cluster (Fig. 3). Within the cluster for the Honshu complex, the shrews from Sado and Shikoku formed a secondary cluster. According to discriminant analysis, five out of the nine characters were significant enough to be able to distinguish between the shrews of Hokkaido and of the Honshu com- plex. The discriminant function between the two shrew groups was as follows: 72 Mammal Study 24 (1999) Table 2. Means+1SE, ranges (in parentheses), and the results of ¢- and U-tests of external characters in Sorex caecutiens from Hokkaido Island and S. s. shinto from Honshu Island. These specimens were all of young animals. U-tests were conducted for the two characters of ratio, and f-tests for the other characters. S. caecutiens S. s. shinto t or U-test External characters in Hokkaido in Honshu (n=240) (n=25) tor U P Weight (gram) 5.0+0.03 4.4+0.11 S255 <0.001 (4.0-6.7) (3.5—5.9) Total body length (mm) 113.8+0.25 112.6+0.91 1.36 ns* (98-126) (108-125) Length of tail (mm) 48.2+0.22 5037 220555 B52 <0.01 (40.0—58.0) (46.0—S6.5) Length of hind foot (mm) 12.4+0.03 12.0+0.08 4.84 <0.001 (11.1-13.5) (11.2-12.9) Tail ratio to head & body length 73.80.44 82.44 1.84 1392.0 <0.001 (%) (60.0—103.6) (66.2—98.2) Hind-foot ratio to tail length 2n8== 0 oie 23.7+0.30 1065.5 <0.001 (%) (21.5—30.5) (21.7—26.4) P0105: Rotated Factor 2 | 5 | | 1 | | | | | | | | | _ 2.6 1.6 -0.6 0.4 1.4 2.4 3.4 Rotated Factor 1 = S. s. shintoin Honshu ¥» S. s. shinto (S. chouei type) AS. s. sadonisin Sado © S. s. shikokensis in Shikoku @ S. caecutiens in Hokkaido Fig. 2. Plot of the first two factor scores for nine cranial and dental characters of shrews of the Sorex caecutiens/shinto group on the Japanese Islands. Three symbols with asterisks (*) are the holotypes for S. chouel, S. c. shikokensis, and S. sadonis, which are treated as S. s. shinto, S. s. shikokensis, and S. s. sadonis in the present study, respectively. Dokuchaey et al., Morphometric status of the Sorex caecutiens/shinto group W5 Table 3. Varimax rotated factor matrix for nine cranial and dental characters of the Sorex caecutiens/shinto group in Japan. See the caption of Fig. 1 for abbreviation. Rotated loadings Character I II Width across M? 0.931 0.089 Width across U? 0.861 0.154 Length of upper molariform tooth row 0.833 0.356 Condylobasal length 0.686 0.573 Facial length 0.667 0.507 Glenoid width 0.665 0.473 Cranial breadth 0.587 0.678 Relative width of Pm* mesostyle 0.063 0.922 Length of upper unicuspid row 0.333 0.899 Percent of total variance explained 45.8% 34.3% S.caecutiens (Hokkaido) S.s.shinto (Honshu) S.s.sadonis (Sado) S.s.shikokensis (Shikoku) 0.00 5.00 [Nas eg ek re i a a | Fig. 3. A dendrogram generated by cluster analysis of nine cranial and dental characters of shrews of the Sorex caecutiens/shinto group on the Japanese Islands, based on single linkage method. The distance is multivariate Euclidean distance of the nine characters. Z=—47.6—1.1(FL)+8.9(LUU) + 4.9(02U?) — 2.4(M?M?) + 0.6(RMW), where FL=facial length, LUU=length of upper unicuspid row, U?U*=width across the second upper unicuspids, M?M?*=width across the second upper molars, RMW=relative mesostyle width of Pm*. The group centroids are +3.36 for the shrews of Hokkaido, and —2.58 for those of the Honshu complex. All the specimens were correctly classified into the two groups (probability of misclassification=0.0%). Discussion The morphometric analyses clearly showed that the shrews of Hokkaido (S. caecutiens) is morphologically different from the shrews of Honshu complex (S. shinto sspp.) (Figs. 2 and 3). The most important difference is in the shape of the upper premolar (Fig. 1 and Table 3). Dokuchaev (1978) found that S. caecutiens retains a well developed mesostyle of 74 Mammal Study 24 (1999) Pm‘, which is a notable difference between it and several other shrew species. This feature is consistent in S. caecutiens throughout its trans-continental Eurasian range. In the present study, we found the same morphotype of the Pm* mesostyle in all of the Hokkaido shrews we examined (Fig. 1-B), while the mesostyle of Pm* of the shrews from the Honshu complex was less developed (Fig. 1-A). For instance, the relative width of Pm* in Honshu shrews never reaches values found in Hokkaido shrews (Table 1). George (1988) treated S. shinto from Honshu as a separate species from S. caecutiens, based on allozyme analysis. Ohdachi et al. (1997a) showed that the shrews of Honshu and Shikoku were clearly distinct from those of Hokkaido, Sakhalin, and the Eurasian Conti- nent, based on mitochondrial DNA sequences (see also Fumagalli et al. 1999). According to their phylogenetical relationships (George 1988; Ohdachi et al. 1997a; Fumagalli et al. 1999) and their morphological differences (Figs. 2 and 3), S. caecutiens and S. shinto should be treated as two separate species. In contrast, among the four OTUs from the Honshu complex (S. s. shinto including S. chouei holotype, S. s. shikokensis, and S. s. sadonis), no clear morphological demarcations were found, although only a small number of specimens were examined for the last three units (Fig. 2). Sorex chouei was described on the basis of one specimen of an old individual with very worn teeth (Imaizumi 1954), and its holotype lay in an extreme point within the variation of S. shinto (Fig. 2), which might be attributed to by the very worn condition of its teeth. Sorex s. shikokensis is a larger relative of S. s. shinto in Honshu (Abe 1967), however the genetic distance between them is very small (Ohdachi et al. 1997a). The specimen of S. s. shikokensis dropped within the range of S. s. sadonis (Fig. 2) and was morphologically similar to the latter (Fig. 3). In addition, we examined more than ten S. s. shikokensis that had over-wintered and confirmed that they were morphologically similar to S. s. sadonis (this data was not used in the present analyses in order to minimize the potential influence of age). The molecular phylogenetical study suggested that the Sado Shrew, S. s. sadonis, should be considered as a subspecies or local population of S. shinto (Ohdachi et al. 1997a). Cranial and dental morphology confirmed that the Sado shrew was similar to the other taxa in the S. shinto complex (Fig. 3), and that there was morphological overlap between them (Fig. 2), although the Sado Shrews do have larger skulls than those of Honshu (as does S. s. shikokensis), longer claws on the forelegs, and darker pelage (Yoshiyuki and Imaizumi 1986). According to Ohshima (1990, 1991, 1992), Sado Island was separated from proto- Honshu in the middle Pleistocene, long before the formation of the Tsugaru Strait, that separates Honshu and Hokkaido, which is estimated to have been formed 100-150 10%-years ago. In contrast, Ohdachi et al. (1997b) have doubted the earlier formation of the Sado Strait than the Tsugaru Strait, because of the molecular phylogeny of the caecutiens/shinto group. Likewise, a more recent date for the isolation of Sado Island has been suggested by Tokuda (1941, 1969) on the basis of an examination of the distribution and morphological variation among rodents. The Sado shrew might, therefore, have separated from the Honshu population of S. shinto recently (after 150 10°-years ago at the most). Further- more, other small mammals, such as Apodemus argenteus (Temminck, 1844), A. speciosus (Temminck, 1844), and Mogera tokudae Kuroda, 1940 (the Sado mole) are found on both Sado and Honshu Islands (Abe 1994, 1995, 1997). Fossil A. argenteus have been found from earlier periods in the Pleistocene than the genus Sorex from Honshu Island, and the earliest fossils of A. speciosus and Mogera sp. were from the same period as Sorex Dokuchaevy et al., Morphometric status of the Sorex caecutiens/shinto group 75 sp. (Kawamura et al. 1989). In the case of M. tokudae, morphological and molecular phylogenetical characteristics of the populations of Sado and Honshu reveal that they are closely related to one other (Abe 1995; Okamoto 1998), as is the case in the shrews of the caecutiens/shinto group. At least, the extant Apodemus spp. and M. tokudae of Sado, whose origins seem to be older than or contemporaneous with Sorex, are considered con- specific with their Honshu counterpart populations. Therefore, the subspecific rank of S. shinto sadonis is considered to be the more appropriate taxonomic status for the Sado shrew, than S. sadonis, as suggested by Ohdachi et al. (1997a) and Koyasu (1998). In order to determine morphological status of S.s. sadonis within S. shinto more clearly, however, morphological comparisons, such as those of fur colour and claw length, should be con- ducted using larger sample sizes. To summarize, morphological analysis has clearly demonstrated that S. caecutiens and S. shinto should be treated as separate species, as has previously been proposed by Ohdachi et al. (1997a) on the basis of their molecular phylogenetical study. Furthermore, morpho- logical research also suggests that the shrew of Sado Island should be included within S. shinto. Acknowledgements: We are grateful to Hideki Endo at the National Science Museum, Tokyo, and Hideo Ichikawa at the Natural History Museum of the Faculty of Agriculture, Hokkaido University, for supporting investigations of samples. We also thank to Alexey N. Dokuchaev for his assisting in writing the manuscript, Masanori J. Toda for reviewing the early manuscript, and Mark Brazil for his help in preparing the final manuscript for publi- cation. Part of this study was conducted during the stay of N. E. Dokuchaev at the Institute of Low Temperature Science, Hokkaido University as a visiting professor. References Abe, H. 1967. Classification and biology of Japanese Insectivora (Mammalia). I. Studies on variation and classification. Journal of the Faculty of Agriculture, Hokkaido University 55: 191-265. Abe, H. (edition). 1994. A Pictorial Guide to the Mammals in Japan. Tokai University Press, Tokyo, 195 pp. (in Japanese). Abe, H. 1995. Revision of the Asian moles of genus Mogera. Journal of the Mammalogical Society of Japan 20: 51-68. Abe, H. 1996. A review of specific names of Japanese insectivores. Honyurui Kagaku (Mammalian Science) 36: 97-108 (in Japanese). Abe, H. 1997. Insectivora. In (Mammalogical Society of Japan, ed.) The Red Data. Japanese Mammals. Pp. 9-30. Bun-Ichi Syuppan, Tokyo (in Japanese). Bobrinskii, N. A., Kuznetsov, B. A. and Kuzjakin, A. P. 1944. Key to the Mammals of the USSR. Sovetskaja Nauka, Moscow, 440 pp. (in Russian). Bobrinskii, N. A., Kuznetsov, B. A. and Kuzjakin, A. P. 1965. Key to the Mammals of the USSR. 2nd Edition. Prosveshchenie, Moscow, 383 pp. (in Russian). Corbet, G. B. 1978. The Mammals of the Palaearctic Region: Taxonomic Review. British Museum and Cornell University Press, London, 314 pp. Dannelid, E. 1994. Comparison of pigment and other dental characters of Eastern Palearctic Sorex (Mammalia: Soricidae). In (J. F. Merritt, G. L. Kirkland, Jr. and R. K. Rose, eds.) Advances in the Biology of Shrews (Carnegie Museum of Natural History Special Publication 18). Pp. 217-231. Carnegie Museum of Natural History, Pittsburgh. Dobson, M. 1994. Patterns of distribution in Japanese land mammals. Mammal Review 24: 91-111. 16 Mammal Study 24 (1999) Dokuchaev, N.E. 1978. On diagnostics of morphologically similar species of shrews (Sorex, Insectivora) from North-East Siberia. Zoologicheski Zhurnal 57: 1746-1748. (Gin Russian). Dolgov, V. A. 1985. Shrews of the Old World. Moscow State University Press, Moscow, 221 pp. (in Russian). Ellerman, J. R. and Morrison-Scott, T.C.S. 1951. Checklist of Palaearctic and Indian Mammals 1758 to 1946. British Museum of Natural History, London, 810 pp. Fumagalli, L., Taberlet, P., Stewart, D. T., Gielly, L., Hausser, J. and Vogel, P. 1999. Molecular phylogeny and evolution of Sorex shrews (Soricidae: Insectivora) inferred from mitochondrial DNA sequence data. Molecular Phylogenetics and Evolution 11: 222-235. George, S. B. 1988. Systematics, historical biogeography, and evolution of the genus Sorex. Journal of Mam- malogy 69: 443-461. Gromoy, I. M. and Baranova, G. I. (edition). 1981. Mammals of the USSR (Pliocene-Recent). Nauka, Leningrad, 456 pp. (in Russian). Gureev, A. A. 1971. Shrews (Soricidae) of the World. Nauka, Leningrad, 256 pp. (in Russian). Gureev, A. A. 1979. The Fauna of the USSR. Mammalia. Vol. 4 (2). Nauka, Leningrad, 502 pp. (in Russian). Hutterer, R. 1993. Order Insectivora. In (D. E. Wilson and D. M. Reeder, eds.) Mammal Species of the World. A Taxonomic and Geographic Reference. 2nd Edition. Pp. 69-130. Smithsonian Institution Press, Washington. Imaizumi, Y. 1949. An Illustrated Book of the Mammals of Japan. Systematics and Ecology. Yoyo Shobo, Tokyo, 348 pp. (in Japanese). Imaizumi, Y. 1954. New species and subspecies of Sorex from Japan (Mammalia; Insectivora). Bulletin of the National Science Museum, Tokyo 1: 94-104. Imaizumi, Y. 1960. Coloured Illustrations of the Mammals of Japan. Hoikusha Publishing Co., Osaka, 196 pp. (in Japanese). Imaizumi, Y. 1970. The Handbook of Japanese Land Mammals, Volume 1. Shin-Shicho-Sha, Tokyo, 350 pp. (in Japanese with English abstract). Kawamura, Y., Kamei, T. and Taruno, H. 1989. Middle and late Pleistocene mammalian faunas in Japan. Daiyonki Kenkyu (The Quaternary Research) 28: 317—326 (in Japanese with English abstract). Koyasu, K. 1998. Natural history of Japanese Soricinae. In (H. Abe and Y. Yokohata, eds.) The Natural History of Insectivora (Mammalia) in Japan. Pp. 201-267, Hiba Kagakukyouiku Shinkou Kai, Syoubara-shi (in Japanese). Krivosheev, V. G. (edition). 1984. Terrestrial Mammals in the Far East of the USSR. Nauka, Moscow, 358 pp. (in Russian). Ognev, S. I. 1933. Data on systematic, morphology, and geography in the common shrews. Zoologicheski Zhurnal 12: 8-16 (in Russian). Ohdachi, S., Masuda, R., Abe, H., Adachi, J., Dokuchaev, N. E., Haukisalmi, V. and Yoshida, M.C. 1997a. Phylogeny of Eurasian soricine shrews (Insectivora, Mammalia) inferred from the mitochondrial cytochrome b gene sequences. Zoological Science 14: 527-532. Ohdachi, S., Masuda, R., Abe, H. and Dokuchaev, N. E. 1997b. Biogeographical history of northeastern Asiatic soricine shrews (Insectivora, Mammalia). Researches on Population Ecology 39: 157-162. Ohshima, K. 1990. The history of straits around the Japanese Islands in the late-Quaternary. Daiyonki Kenkyu (The Quaternary Research) 29: 193-208 (in Japanese with English abstract). Ohshima, K. 1991. The late-Quaternary sea-level change of the Japanese Islands. Chigaku Zasshi (Journal of Geography) 100: 967-975 (in Japanese with English abstract). Ohshima, K. 1992. Sealevel and coastal morphology through the late Quaternary glacial maximum. Chishitsu News 459: 40-48 (in Japanese). Okamoto, M. 1998. How many species of moles in Japan? Phylogenetical relationships of Japanese moles, inferred from mitochondrial DNA sequences. In (H. Abe and Y. Yokohata, eds.) The Natural History of Insectivora (Mammalia) in Japan. Pp. 59-61, Hiba Kagakukyouiku Shinkou Kai, Syoubara-shi (in Japanese). Okhotina, M. V. 1993. Subspecies taxonomy revision of Far East shrews (Insectivora, Sorex) with the description of new subspecies. Questions of Systematics, Faunistics and Palaeontology of Small Mammals. Proceeding of the Zoological Institute, St. Petersburg 243: 58-70 (in Russian with English abstract). Pavlinov, I. Ja. and Rossolimo, O. L. 1987. The Systematics of the Mammals of USSR. Archives of Zoological Museum, Moscow State University, Volume 25. Moscow State University, Moscow, 285 pp. (in Russian). Pavlinov, I. Ja., Borisenko, A. V., Kruskop, S. V. and Yakhontov, E. L. 1995. The Mammals of Eurasia. II. Dokuchaey et al., Morphometric status of the Sorex caecutiens/shinto group 77 Non-Rodentia. Archives of Zoological Museum Moscow State University, Volume 28. Moscow State University, Moscow, 336 pp. (in Russian). Sokolov, V. E. 1973. The Systematics of the Mammals. Vysshaja Shkola, Moscow, 432 pp. (in Russian). Stroganov, S. U. 1957. Mammals of Siberia. Insectivora. Academy of Sciences of the USSR, Moscow, 267 pp. (in Russian). Thomas, O. 1905. Abstract of Proceedings of Zoological Society of London 1905 (23): 18-19. (Cited in Thomas 1906). Thomas, O. 1906. The Duke of Bedford’s Zoological exploration in Eastern Asia. I. List of mammals obtained by Mr. M. P. Anderson in Japan. Proceedings of the Zoological Society of London 1905 (2): 331-363. Thomas, O. 1907. The Duke of Bedford’s Zoological exploration in Eastern Asia. IV. List of mammals from the Islands of Saghalien and Hokkaido. Proceedings of the Zoological Society of London 1907 (1): 404-414. Tokuda, M. 1941. Biogeography in Japan. Geological History of the Japanese Islands and Biogeographical History of Japanese Fauna and Flora, Inferred from Evolutionary Studies of Eastern Asiatic Rodents. Kokon Syoin, Tokyo, 201 pp. (in Japanese). Tokuda, M. 1969. Biogeography. Tsukiji Syokan, Tokyo, 199 pp. (in Japanese). Wolsan, M. and Hutterer, R. 1998. A list of living species of shrews. In (J. M. Wojcik and M. Wolsan, eds.) Evolution of Shrews. Pp. 423-448, Mammal Research Institute, Polish Academy of Sciences, Bialowieza. Yoshiyuki, M. and Imaizumi, Y. 1986. A new species of Sorex (Insectivora, Soricidae) from Sado Island, Japan. Bulletin of the National Science Museum, Tokyo, Series A 12: 185-193. Yudin, B.S. 1971. Insectivorous Mammals of Siberia (Key), Nauka, Novosibirsk, 172 pp. (in Russian). Yudin, B.S. 1989. Insectivorous Mammals of Siberia. Nauka, Novosibirsk, 360 pp. (in Russian). Appendix. Codes of specimens used for analyses. Deposit places are National Science Museum (NSMT), Natural History Museum, Hokkaido University (NHMHU, HA, KM), and Institute of Low Temperature Science, Hokkaido University (SO). Cranial Measures S. caecutiens in Hokkaido HA-1037, HA-1044, HA-1064, HA-1084, HA-1108, HA-1151, HA-1178, HA-1181, HA-1187, HA-1199, SO-88n105, SO-88n141, SO-88n169, SO-88n197, SO- 88n203, SO-88n207, SO-88n248, SO-88n263, SO- 88n264, SO-88n265, SO-88n285, SO-88n329, SO- 88n336, SO-88n370, SO-88n377, SO-88n378, SO- 89nn38, SO-96misc-5, SO-96misc-25, SO-96misc-26, SO-96misc-27, SO-96misc-28, SO-96misc-29, SO- 96misc-30, SO-96misc-31, SO-96misc-32, SO-96misc-33, SO-96misc-34, SO-97/8/16-10, SO-97/9/1-1 S. s. shinto in Honshu HA-1215, HA-6137, NSMT-M12479, NSMT-M12513 (holotype of S. chouei Imaizumi, 1954), NSMT- M13366, NSMT-M13397, NSMT-M13398, NSMT- M15593, NSMT-M15594, NSMT-M15595, NSMT- Received 2 June 1999. Accepted 23 August 1999. M15598, NSMT-M15599, NSMT-M15611, NSMT- M15613, NSMT-M16082, SO-95misc-2, SO-96misc-9, SO-96misc-10, SO-96misc-11, SO-96misc-13, SO- 96misc-14, SO-96misc-15, SO-96misc-16, SO-96misc-17, SO-96misc-18, SO-96misc-19, SO-96misc-20, SO- 96misc-21, SO-96misc-22, SO-96misc-57, SO-97/8/2-1, SO-97/8/5-1, SO-97/8/6-2, SO-97/8/6-3, SO-97/8/6-4, SO-97/8/6-5, SO-97misc-17, SO-97misc-18, SO-97misc- 19, SO-97misc-37, SO-97misc-39, SO-97misc-40, SO- 97misc-42, SO-97misc-134, SO-98misc-1 S. s. sadonis in Sado NSMT-M16180 (holotype of S. sadonis Yoshiyuki et Imaizumi, 1986), NSMT-M26593, NSMT-M26600, NSMT-M26601, NSMT-M26602, NSMT-M27286 S. s. shikokensis in Shikoku NHMHU-13311 (holotype of S. caecutiens shikokensis Abe, 1967) External Measures S. caecutiens in Hokkaido KM-kil12, KM-ko103, KM-kol04, KM-kol21, KM- ko122, KM-ko50, KM-ko51, KM-ko52, KM-ko70, KM- 78 ko72, KM-ko74, KM-ko83, KM-ko92, KM-ko093, KM- ko94, KM-sh9, KM-toml, KM-tom3, KM-tom4, KM- tomS, KM-tom7, KM-tom8, KM-tom9, KM-tom19, KM-tom20, KM-tom21, KM-tom22, KM-tom27, KM- tom28, KM-tom29, KM-tom30, KM-tom31, KM-tom32, KM-tom8-53, KM-tom8-54, KM-tom8-57, KM-tom8-58, KM-tom8-67, KM-tom8-68, KM-tom8-69, KM-tom8-70, KM-tom8-71, KM-tom8-72, KM-tom8-73, KM-tom8’-74, KM-tom8-75, KM-tom8-76, KM-tom8-77, KM-tom8’-78, KM-tom8-79, KM-tom8-82, KM-tom8-92, KM-tom8-93, KM-tom8-94, KM-tom8-95, KM-tom8-128, KM-tom8- 130, KM-tom8-131, KM-tom8-132, KM-tom8-132/2, KM-tom8-133, KM-tom8-136, KM-tom8-139, KM- tom8-140, KM-tom8-143, KM-tom8-144, KM-tom8-145, KM-tom8-150, KM-tom8-151, KM-tom8-152, KM- tom8-153, KM-tom8-154, KM-tom8-156, KM-tom8-157, KM-tom8-163, KM-tom8-164, KM-tom8-165, KM- tom8-167, KM-tom8-168, KM-tom8-169, KM-tom8-171, KM-tom8-172, KM-tom8-176, KM-tom8-177, KM- tom8-178, KM-tom8-180, KM-tom8-181, KM-tom8-183, KM-tom9-31, KM-tom9-32, KM-tom9-34, KM-tom9-35, KM-tom9-36, KM-tom9-37, KM-tom9-38, KM-tom9-47, KM-tom9-48, KM-tom9-49, KM-tom9-51, KM-tom9-52, KM-tom9-58, KM-tom9-60, KM-tom9-71, KM-tom9-72, KM-tom9-73, KM-tom9-74, KM-tom9-75, KM-tom9-76, KM-tom9-77, KM-tom9-81, KM-tom9-82, KM-tom9-84, KM-tom9-86, KM-tom9-87, KM-tom9-93, KM-tom9-96, KM-tom9-97, KM-tom9-98, KM-tom9-130, KM-tom9- 134, KM-tom9-137, KM-tom9-139, KM-tom9-140, KM- tom9-142, KM-tom9-144, KM-tom9-148, KM-tom9-149, KM-tom9-150, KM-tom9-151, KM-tom9-152, KM- tom9-153, KM-tom9-154, KM-tom9-157, KM-tom9-158, KM-tom9-159, KM-ton66a, SO-1-4, SO-30-1, SO-30-2, SO-31-1, SO-31-2, SO-88c025, SO-88c026, SO-88c060, SO-88c067, SO-88c068, SO-88f053, SO-88f065, SO- Mammal Study 24 (1999) 88f070, SO-88f096, SO-88f105, SO-88f110, SO-88f123, SO-88f126, SO-88f128, SO-88f132, SO-88f133, SO- 88n105, SO-88n168, SO-88n169, SO-88n197, SO- 88n203, SO-88n207, SO-88n248, SO-88n263, SO- 88n264, SO-88n265, SO-88n274, SO-88n285, SO- 88n336, SO-88t002, SO-88t006, SO-88t009, SO-88t012, SO-88t016, SO-89nn021, SO-89nn022, SO-89nn038, SO-89nn045, SO-94/9/13-8, SO-94/9/13-9, SO- 94/9/13-10, | SO-94/9/13-11, SO-94/9/14-7, SO- 94/9/14-8, SO-94/9/14-9, SO-94/9/14-10, SO-94sc3, SO-95/7/12-3, SO-95/7/13-4, SO-95/7/13-10, SO- 97/8/16-4, SO-97/8/16-5, SO-97/8/16-6, SO-97/8/16-7, SO-97/8/16-8, SO-97/8/16-9, SO-97/8/16-10, SO- 97/8/16-11, SO-97/8/16-12, SO-97/8/16-13, SO- 97/8/16-14, | SO-97/8/16-15, SO-97/8/16-16, SO- 97/8/16-17, | SO-97/8/16-18, | SO-97/8/17-5, SO- 97/8/17-6, SO-97/8/17-7, SO-97/8/17-8, SO-97/8/17-9, SO-97/8/17-10, SO-97/8/17-11, SO-97/8/17-12, SO- 97/8/17-13, SO-97/8/17-14, SO-97/8/17-15, SO- 97/8/30-2, SO-97/8/31-1, SO-97/8/31-2, SO-97/8/31-9, SO-97/9/1-1, | SO-97/9/19-8, | SO-97/9/19-9, SO- 97/9/19-10, SO-97/9/19-11, | SO-98/6/19-6, SO- 98/6/19-7, SO-98/6/20-10, SO-98/6/20-11, SO- 98/6/20-12, SO-98/7/29-4, SO-98/7/29-5, SO-98/7/29- 6, SO-98/7/30-6, SO-98/7/30-7, SO-98/7/30-8, SO- 98/7/31-4, SO-98/7/31-5, SO-98/7/31-7 S. s. shinto in Honshu SO-96misc-9, SO-96misc-10, SO-96misc-11, SO-96misc- 13, SO-96misc-14, SO-96misc-15, SO-96misc-16, SO- 96misc-17, SO-96misc-18, SO-96misc-19, SO-96misc-20, SO-96misc-21, SO-96misc-22, SO-97misc-37, SO- 97misc-39, SO-97misc-40, SO-97misc-133, SO-97misc- 134, SO-97/8/2-1, SO-97/8/5-1, SO-97/8/6-1, SO- 97/8/6-2, SO-97/8/6-3, SO-97/8/6-4, SO-97/8/6-5 Mammal Study 24: 79-89 (1999) © the Mammalogical Society of Japan Constraints on feeding type in ruminants: a case for morphology over phylogeny Jiang Zhaowen! and Seiki Takatsuki? 1The Laboratory of Wildlife Biology, Graduate School of Agriculture and Life Sciences, The University of Tokyo, Yayoi 1-1-1, Bunkyo-ku, Tokyo 113-8657, Japan 2The University Museum, The University of Tokyo, Hongo 7-3-1, Bunkyo-ku, Tokyo 113-8654, Japan Abstract. Ruminants were categorized into three feeding types: grazers, mixed feeders and browsers based on their food habits. We studied how phylogeny constrains the feeding types, the morphology of digestive organs, and their relationships in Cervidae and Bovidae. It is shown that species with different feeding types occur in the same phylogenetic group of the family, subfamily, and tribe. This suggests that phylogeny does not always reflect feed- ing type. Comparisons of three morphological indices of digestive organs (parotid gland size, rumino-reticulum capacity, and rumino-reticulum contents weight) among feeding types found that trends along the grazer-browser continuum were similar in both families. The index values of the same feeding types were similar in the two families. These results suggest that the morphology of digestive organs is closely related to feeding types, and that phylo- genetic characteristics are less important. The species in the same feeding type also share other morphological characteristics of digestive organs, irrespective of phylogeny. Key words: digestive organs, feeding type, morphology, phylogenetic constraint, ruminants. The evolution of ruminants reflects changes in food quality and availability associated with changes in climate and vegetation during the Tertiary period (Romer 1966; Janis 1976). Adaptations were apparent in food habits, feeding behavior, morphology, and physiology of the digestive systems (Janis 1976; Hofmann 1989). Studies on the feeding ecology of ungulates have revealed negative relationships between body mass and food quality (Bell 1971; Jarman 1974). These authors emphasized the im- portance of body weight for the evolution of ungulate feeding ecology. On the other hand, based on the comparative morphophysiology of digestive systems of 65 ruminant species (Hofmann 1968, 1989; Hofmann and Stewart 1972), Hofmann described the correspondence of feeding types and the morphology of digestive organs. Considering the evolution of ruminants, he concluded that changes in feeding ecology and diets were the primary adaptive factors in ruminant evolution while body weight was secondary (Hofmann 1989). Hofmann (1989) has categorized ruminants into three feeding types. Of approximately 150 ruminants including six domestic species, about 25% fall into “grazers” which eat fibrous 'Present address: The University Museum, The University of Tokyo, Hongo, 7-3-1, Bunkyo-ku, Tokyo 113-8654, Japan. E-mail: jiang@um.u-tokyo.ac.jp. 80 Mammal Study 24 (1999) foods rich in cell wall, or structural carbohydrates. For example, cattle, sheep, water buffalo, Bubalus spp., and banteng, Bos javanicus, belong to this group. More than 40% of ruminant species belong to “browsers”. They thrive on high quality diets and are adapted to process forage that is rich in plant cell contents. For example, roe deer, Capreolus capreolus, moose, Alces alces, and dik-dik, Madoqua kirki, are representa- tive browsers. The other 35% of ruminant species are “mixed feeders” which have intermediate characteristics between grazers and browsers. They show short term or seasonal changes in anatomy in response to food quality. The domestic goat, Capra hircus, and red deer, Cervus elaphus, belong to this group. Most ruminologists and animal ecologists gave little attention to phylogenetic relation- ships in comparative studies of ruminant feeding ecology. However, the importance of considering phylogeny in comparative biology has been stressed thoroughly by Harvey and Pagel (1991). One of the most important arguments is that similar characteristics shown by different species do not necessarily imply adaptation to a particular environment, because it is possible that they have resulted merely from the phylogenetic history. However, if similar correlation between feeding types and morphological characteristics of digestive organs are observed in several independently evolving lineages, this implies that the traits have evolved in a correlated fashion, and explanations associated with the phylogenetic history are less likely to apply (Harvey and Pagel 1991). The objective of this study is to clarify the importance of phylogenetic constraints on the feeding types and the morphology of digestive organs of ruminants. We classify species of Bovidae and Cervidae according to their feeding types. We then compare parameters of the morphology of digestive organs among the feeding types in each family, and the same feed- ing types between the two families. Materials and methods Groups examined and their feeding types Species-level information for the three ruminant feeding types (grazers, mixed feeders, and browsers) was collected from available literature (references in Tables 1 and 2). We limited our search to two families, Bovidae (115 spp) and Cervidae (53 spp), because they account for 91.3% of the true ruminants (184 spp), and quantitative information is more available for these two families. Taxonomic relationships of the species were used instead of phylogenetic relationships because the phylogenetic tree for all ruminant species is not available. The standard taxonomies of Spinage (1986) for Bovidae and Walker (1975) for Cervidae were adopted. For the classification of feeding types according to food habits, the results of Kay et al. (1980), Kay (1987), and Hofmann (1973, 1982, 1984) were used. Species not included in these studies were categorized according to food habit studies, i.e., the oryx, Oryx basia (Maloiy et al. 1982), bighorn sheep, Ovis canadensis (Belovsky 1986), Pere-David’s deer, Elaphurus davidianus (Axmacher and Hofmann 1988), and Roosevelt elk, Cervus elaphus roosevelti (Church and Hines 1978). Based on feeding types, the taxonomic classifications of the ruminant species were rearranged. Jiang and Takatsuki, Feeding type in ruminants 81 Indices of digestive organs Quantitative data on digestive organs of ruminants with different feeding types were collected from available literature (Tables 1 and 2). Three quantitative indices were derived: 1) ratio of parotid weight (g) to body weight (kg) (6 species of Cervidae and 14 species of Bovidae); 2) ratio of rumino-reticulum capacity (1) to body weight (kg®”°) (6 species of Cervidae and 30 species of Bovidae); and 3) ratio of weight of rumino-reticulum contents to body weight (kg®-’>5) (11 species of Cervidae and 36 species of Bovidae). Indices with inadequate sample size or otherwise unsuitable for quantitative comparison were used to describe qualitative differences between grazers and browsers (Table 3). Data related to feeding type was available for 50 species and subspecies of Bovidae and 15 species and subspecies of Cervidae, including domestic species. For these subspecies and species, we could obtain data related to the three indices for 43 species and subspecies of Bovidae and 13 species and subspecies of Cervidae. Index values are expressed as mean = SD. Results Feeding types Tables 1 and 2 show that both Bovidae and Cervidae include species belonging to different feeding types. Different feeding types were found not only in the two families, but also in lower taxonomic levels. In Bovidae, for example, the buffalo, Syncerus caffer, European bison, Bison bonasus, and greater kudu, Tragelaphus strepsiceros, in the sub- family Bovinae belonged to the grazers, mixed feeders, and browsers, respectively. Different feeding types were also found in subfamilies Antilopinae and Caprinae, and also at tribe levels, such as in Bovini, Antilopini, Neotragini, and Caprini. In Cervidae also, the sub- family Cervinae and the tribe Cervini included grazers and mixed feeders, and the sub- family Odocoilinae included both mixed feeders and browsers. There were, however, fewer species classified as grazers in Cervidae than in Bovidae. Morphology of digestive organs a. Parotid gland In Bovidae, the relative weights of parotid glands were lower in grazers than those of mixed feeders and browsers, but no obvious difference was found between mixed feeders and browsers (Fig. 1, Table 1). In Cervidae, data were not available for grazers. The mean value for browsers was higher than that for mixed feeders, but variation was great (Fig. 1, Table 2). Index values for each feeding type were similar in Bovidae and Cervidae. Index values showed a similar increasing tendency from grazers to browsers in both Bovidae and Cervidae (Fig. 1). b. Rumino-reticulum capacity In Bovidae, the relative capacities of rumino-reticula were greater in grazers than in mixed feeders and browsers (Fig. 1, Table 1). The mean value for mixed feeders was greater than that for browsers, but variation was great. Although only one datum was available for Cervidae browsers and grazers, respectively, relative capacity was larger in the grazer (Fig. 1, 82 Mammal Study 24 (1999) Table 1. Parameters of digestive organs of species belonging to different feeding types in Bovidae. Species English name Grazers Subfamily Bovinae Tribe Bovini Buffalo American bison European ox Zebu Cow Subfamily Reduncimae Mountain reedbuck Bohor reedbuck Laikipia waterbuck Waterbuck Nile lechwe Uganda kob Subfamily Hippotraginae Roan antelope Sable antelope Oryx Oryx (Wild) Oryx (Domesticated) Subfamily Alcelaphinae Blue wildebeest Hartebeest Topi Subfamily Antilopinae Tribe Antilopini Black buck Tribe Neotragini Oribi Subfamily Caprinae Tribe Caprini Ibex European sheep Mouflon Mean+SD Mixed Feeders Subfamily Bovinae Tribe Bovini European bison Tribe Tragelaphini Eland (Wild) Eland antelope (Pofu) Subfamily Aepycerotinar Impala Body weight Parotid R-R capacity R-R contents Reference Scientific name kg kg®.75 g/kg % I/kg®-5 % kg/kg°75 No. Syncerus caffer WS 55 88.4 85.3 3, 4, 6 Bison bison 800.0 150.4 69.3 6, 12 Bos taurus 600.0 22 0.6 69.8 6, 13 Bos indicus 400.0 89.4 63.3 6 Bos taurus 400.0 89.4 136.7 61.5 12, Redunca fulvorufula 235 10.7 68.4 3 Redunca redunca 45.0 17.4 55.8 20.1 35 6 Kobus ellipsiprymnus 220.0 Sol 76.9 52:5 3,05, 9 Kobus defassa 229.0 58.9 51.9 8 Kobus megaceros 80.0 26.7 6 Kobus kob 79.0 26.5 36.8 3 Hippotragus equinus 250.0 62.9 6 Hippotragus niger 200.0 e774 6 Oryx basia 174.3 48.0 48.9 8 Oryx gazella 181.5 49.5 71.8 49.1 3, 4, 6 Oryx gazella 200.0 Slo” 42.9 6 Connochaetes taurinus 182.0 49.6 80.7 57.3 3, 4, 5, 6 Alcelaphus buselaphus 156.0 44.1 70.3 38.5 3555.0 Damaliscus lunatus 119.0 36.0 86.0 44.2 37,0 Antilope cervicapra 40.9 16.2 0.7 jI3) Ourebia ourebi 16.0 8.0 49.4 3 Capra ibex 36.0 12.8 11 Ovis aries 50.0 18.8 0.5 64.8 Sil ae 556; 13 Ovis ammon musimon 355 13.9 0.7 68.2 34.2 6 115-13 0.6+0.1 73.4+23.8 51.6+16.1 Bison bonasus 800.0 150.4 44.1 6 Taurotragus oryx 700.0 136.1 52.9 57.6 3, 6 Taurotragus oryx 519.0 108.7 57.0 51.0 Beall Aepyceros melampus 62.6 DOS 5355 29.7 304.56 Jiang and Takatsuki, Feeding type in ruminants 83 Table 1. (continued) Species Body weight Parotid R-R capacity R-R contents Reference English name Scientific name kg kg?.75 g/kg % I/kg®75 % kg/kg®-75 No. Subfamily Antilopinae Tribe Antilopini Grant’s gazelle Gazella granti 64.0 22.6 2.0 56.6 23.9 3h, Sp. (Os 118) Thomson’s gazelle Gazella thomsoni Mbps 10.3 1.0 56.1 26.0 3), Oy Os 13) Springbok Antidorcas marsupialis 42.0 16.5 1.4 28.4 23.2 4, 6, 15 Tribe Neotragini Steinbok Raphicerus campestris 10.5 5.8 Dep 42.9 13.5 315 Dy (Oy JIS) Subfamily Caprinae Tribe Ovibovini Musk ox Ovibos moschatus 350.0 80.9 6 Tribe Rupicaprini Chamois Rupicapra rupicapra 33.5 13.9 1.8 53.1 11 Tribe Caprini Goat Capra hircus 40.0 15.9 44.6 a, (0) Dall’s sheep Ovis dalli 80.0 26.7 6 Bighorn sheep Ovis canadensis 72.0 24.7 18.8 12, 14 Sheep Ovis aries 30.0 12.8 44.9 6 Mean+ SD leet (05 ae Onl 928s S403 teil 359 Browsers Subfamily Bovinae Tribe Tragelaphini Greater kudu Tragelaphus strepsiceros 250.0 62.9 36.9 4,6 Lesser kudu Tragelaphus imberbis 90.5 73$).3) 45.0 3 Bushbuck Tragelaphus scriptus 60.0 21.6 37.4 18.1 35 55 © Bongo Taurotragus eurycerus 200.0 377 6 Subfamily Cephalophinae Red duiker Cephalophus harveyi 16.0 8.0 Dep) 62.5 29.6 3, 6 Grey duiker Sylvicapra grimmia 14.3 Va 43.5 19.2 35 Dy Subfamily Antilopinae Tribe Antilopini Gerenuk Litocranius walleri 40.0 15.9 2.0 39.3 del) 35 (Op thy JIS Tribe Neotragini Klipspringer Oreotragus oreotragus 12.0 6.4 26.1 12.1 6 Dik-dik Madoqua spp. S72 3.4 1.6 10.2 35 diy Wy JIB) Gunther’s dik-dik Madoqua quentheri 4.1 DS) 26.0 3 Kirk’s dik-dik Madoqua Kirki So 3.4 1.5 27.4 10.8 Il, Gy WO, 18) Suni Nesotragus moschatus 4.5 Jol 1.6 5) 12.3 3h) Oy Oh JO, 18 Mean+ SD Lotsaes sac) Spee’) R-R: Rumino-reticulum. Reference No. 1. Short et al. (1965), 2. Prins and Geelen (1971), 3. Hofmann (1973), 4. Giesecke and Van Gylswyk (1975), 5. Hoppe et al. (1977), 6. Kay et al. (1980), 7. Demment (1982), 8. Maloiy et al. (1982), 9. Clemens and Maloiy (1983), 10. Hoppe et al. (1983), 11. Hofmann (1984), 12. Belovsky (1986), 13. Kay (1987), 14. Gordon and Illius (1988), 15. Hofmann et al. (1995). Table 2). Index values for each feeding type were similar in Bovidae and Cervidae. 84 Mammal Study 24 (1999) Table 2. Parameters of digestive organs of species belonging to different feeding types in Cervidae, Tragulidae, Camelidae and Giraffidae. Species Body weight Parotid R-R capacity R-R contents Reference English name Scientific name kg kg®75 g/kg % W/kg®-> 9% kg/kg®-75 No. Cervidae Grazers Cervinae Pere-David’s deer Elaphurus davidianus 190.5 Silas 14 Cervini Sika deer Cervus nippon 61.2 21.9 56.7 48.6 10, 16 Mixed feeders Cervinae Cervini Wapiti Cervus canadensis 318.0 75.3 28.1 9, 12 Wapiti (Elk) Cervus elaphus roosevelti PAPE) 67.1 8 Red deer Cervus elaphus 150.0 42.9 0.6 71.8 40.1 4, 7, 9, 13, 18 Fallow deer Dama dama 70.0 24.2 B5e2, 29.0 4,7,9 Odocoilinae Odocoileini Mule deer Odocoileus hemionus 120.0 36.3 28.5 22.6 2s), 9 White-tailed deer Odocoileus virginianus 66.6 23e3 32.0 25.3 I Ole: Caribou Rangifer tarandus acticus 120.0 36.3 32.6 6, 9 Reindeer, Norwegian Rangifer tarandus tarandus 90.0 29:2 0.6 41.5 9=3,. 17 Reindeer, Svalbard Rangifer t. platyrhynchus 71.0 24.5 1.6 38.9 Osea Mean+SD 0.90.6 41-9220 32:3 ==7—e2 Browsers Odocoilinae Alcini Moose Alces alces 400.0 89.4 43.4 9 Capreolini Roe deer Capreolus capreolus 20.7 9.7 hep) 1I5),5 159 4,7, 9, 13 Hydropotinae Chinese water deer Hydropotes inermis 12.0 6.4 1.4 OF 13, 15 Muntiacinae Reeves’ muntjac Muntiacus reevesi 10.4 5.8 1.4 9, 13 Mean+SD 11,7/22(0)55) 155 29.7+19.4 Other families: Mixed feeder Camelidae Arabian camel Camelus dromedarius 0.5 13 Antilocapridae Pronghorn Antilocapra americana 50.0 18.8 33.8 6, 12 Browsers Tragulidae Larger mousedeer Tragulus napu 4.0 2.8 9 Lesser mousedeer Tragulus javanicus eS 1.4 9 Giraffidae Giraffe Giraffa camelopardalis 750.0 143.3 132 70.3 ll R-R: Rumino-reticulum. References No. 1. Short (1964), 2. Short et al. (1965), 3. Hakonson and Whicker (1971), 4. Prins and Geelen (1971), 5. Hofmann (1973), 6. Hobson et al. (1975), 7. Nagy and Regelin (1975), 8. Church and Hines (1978), 9. Kay et al. (1980), 10. Hofmann (1982), 11. Maloiy et al. (1982), 12. Belovsky (1986), 13. Kay (1987), 14. Axmacher and Hofmann (1988), 15. Hofmann et al. (1988), 16. Takatsuki (1986), 17. Staaland and White (1991), 18. Fraser (1996). Jiang and Takatsuki, Feeding type in ruminants 85 Bovidae Cervidae 22 22 “eb a me eS 18 Sh (3) ee aA (5) 1.4 oS ro) (5) (3) Sy Gy 1.0 ep (4) ™~! = 06 $ 0.6 a ra 0.2 02 GR MF BR GR MF BR 90 90 70 (8) 70 (1) 4) (9) i i 50 (13) 30 (1) Capacity/body weight 9:75 3 @ 10 10 GR MF BR GR MF BR : 65 65 = 3 55 55 (1) (2) B45 45 is (8) S 35 (9) 35 “eb (16) : 2 25 25 SB 15 (11) 15 c IS} O 5 5 GR MF BR GR ME BR Fig. 1. Three indices of digestive organs of Bovidae and Cervidae. Top: weight contributions of parotid glands to body weight (g/kg), middle: ratios of capacity of rumino-reticulum (1) to metabolic body weight (kg®7>), and down: ratio of content weight (kg) of rumino-reticulum to metabolic body weight (kg®-’5). GR: grazers, MF: mixed feeders and BR: browsers. Numbers in parentheses indicate sample size and vertical lines indicate SD. For data sources, see Tables 1 and 2. c. Weight of rumino-reticulum contents In Bovidae, the relative weight of rumino-reticulum contents was highest in grazers, followed by mixed feeders and lowest in browsers (Fig. 1, Table 1). A similar tendency was noted among the three feeding types in Cervidae, but only two data were available for browsers and one for grazers, respectively (Fig. 1, Table 2). Obvious difference was not found between mixed feeders and browsers (Fig. 1). Index values for each feeding type were similar in Bovidae and Cervidae. 86 Mammal Study 24 (1999) Table 3. Characters of the digestive organs of grazers and browsers. Grazers Browsers Reference No. Total salivary gland W (g)/Body W (kg) 1.8 3.6 5 Rumen structure Subdivided Simple 1 Rumen pillar Powerful Weak 1 Pappilla density in rumen wall Low, uneven High, even 2,4 Rumen dorsal wall SEF Low High 2,4 Average rumen SEF Low High 2, 4 Reticulum Small, deeply cellulated Large, lightly cellulated 2 Omasum Large, high SEF Small, low SEF [2 Orifice between reticulum and omasum Small Large V5 pd Abomasum Large Small eye Intestine L/Body L (time) 25-30 12-15 5 Small intestine L/Total intestine L (%) 80-82 65-73 5 Large intestine L/Total intestine L (%) 18-20 27-35 5 Capacity ratio of DFC/R-R 1/15-13 1/6-10 5 SEF: Surface enlargement factor of inner surface, L: Length, W: Weight, R-R: Rumino-reticulum. DFC: Distal fermentation chamber. Reference No. 1. Hofmann and Stewart (1972), 2. Hofmann (1973), 3. Kay et al. (1980), 4. Hofmann et al. (1988), 5. Hofmann (1989). Other morphological characteristics of digestive organs Other characteristics of digestive organs were compared for grazers and browsers (Table 3). The weight contribution of total salivary glands was higher in browsers than in grazers. The rumens of grazers were more subdivided, more capacious, and had more powerful muscle pillars for contraction than those of browsers (Hofmann 1968; Hofmann and Stewart 1972). Within the stomach, various shapes and sizes of papillae were more unevenly dis- tributed in grazers than in browsers. Furthermore, papillae were less dense in grazers than in browsers (Hofmann 1968, 1973). In the dorsal regions of the stomachs of grazers, extensive unpapillated zones existed, while in browsers the papillae were evenly distributed. Conse- quently, the degree of rumen surface enlargement was smaller in grazers than in browsers (Hofmann 1973; Hofmann et al. 1988). The reticula of grazers were relatively smaller and more deeply cellulated than in browsers, and exhibited distinct subdivisions in the secondary and the tertiary crests (Hofmann 1973; Church and Hines 1978). The omasa were larger with more pronounced mucosal surface enlargement in grazers than in browsers, because of many laminae of several orders in size in grazers. The abomasa were larger and more spacious in grazers than in browsers. Orifices between reticula and omasa were smaller in grazers than in browsers (Hofmann 1973, 1989). Total intestinal length of grazers were relatively longer, but the large intestines were relatively shorter than those of browsers (Hofmann 1989). The distal fermentation chambers of grazers were relatively less spacious than those of browsers. The digestive systems of grazers can pass foods more slowly through the gut and digest them more thoroughly than those of browsers (Kay et al. 1980; Van Soest 1982; Hofmann 1989). Discussion In this analysis, species relationships were derived from the traditional taxonomic Jiang and Takatsuki, Feeding type in ruminants 87 classification of ruminants based mainly on morphology (Walker 1975; Spinage 1986). In spite of considerable advances in studies on the phylogenetic relationships of ruminants (Miyamoto et al. 1990; Gatesy et al. 1992; Wall et al. 1992; Chikuni et al. 1995; Cronin et al. 1996), a phylogenetic tree for all ruminants has not been established. However, phylogenetic studies have confirmed close relationships within genera as defined by traditional taxonomic categories. We assume that the use of traditional taxonomic relationships does not affect our results. The indices analyzed are closely related to food habits and digestive physiology. The salivary gland and rumino-reticulum are the most important organs for ruminants to digest fibrous foods (Hofmann 1973). The amount of the saliva secreted by the parotid gland is closely related to the size of the glands, and the quick turnover and fermentation of ingesta in the stomach of browsers need more saliva to buffer the rumen’s volatile fatty acid and pass the digesta (Kay 1987; Hofmann 1989). Therefore, browsers possess larger parotid glands than do grazers. In contrast to the salivary glands of the browsers, grazers possess a larger rumino-reticulum, which ferments and digests fibrous food efficiently by its long retention time (Hofmann 1973, 1989). The result that different species in the same phylogenetic group (Bovidae or Cervidae) appear in different feeding types suggests that the feeding types are not constrained strongly by phylogenetic relations. The average values for each index showed a similar tendency from grazers to browsers in both Bovidae and Cervidae (Fig. 1). In addition, other morphological characteristics of the digestive organs of ruminants are similar in species of the same feeding type irrespective of the phylogenies (Table 3). This further suggests that the morphologies of digestive organs associated with different feeding types are likely consistent in different phylogenetic groups, and are not strongly constrained by phylogeny. These results suggest that the correlation among characteristics reflects independently evolving lineages in ruminants. It is, however, noteworthy that Cervidae contains fewer grazers, suggesting that species numbers are affected by phylogeny. Two conclusions arise from this study: 1) phylogenetic relations did not strongly con- strain feeding types and morphology of digestive organs of ruminants, and 2) there exists an underlying principle that feeding types of ruminants are closely related to the morphology of their digestive organs even in different phylogenetic groups. Acknowledgements: We are especially grateful to Professor H. Higuchi, Associate Professor T. Miyashita and Assistant Professor G. Fujita, of The University of Tokyo, for their encouragement, valuable suggestions and constructive comments. We would also like to express our thanks to Professor S. W. Buskirk, Department of Zoology and Physiology, University of Wyoming, and Dr. P. McIntyre for their constructive comments and kind help in reviewing English. References Axmacher, H. and Hofmann, R. R. 1988. Morphological characteristics of the masseter muscle of 22 ruminant species. Journal of Zoology, London 215: 463-473. Bell, R.H. V. 1971. A grazing ecosystem in the Serengeti. Scientific American 225: 86-93. Belovsky, G. E. 1986. Optimal foraging and community structure: implications for a guild of generalist grassland 88 Mammal Study 24 (1999) herbivores. Oecologia 70: 35-52. Chikuni, K., Mori, Y., Tabata, T., Saito, M., Monma, M. and Kosugiyama, M. 1995. Molecular phylogeny based on the k-Casein and cytochrome b sequences in the mammalian suborder Ruminantia. Journal of Molecular Evolution 41: 859-866. Church, D. C. and Hines, W. H. 1978. Ruminoreticular characteristics of elk. Journal of Wildlife Management 42: 654-659. Clemens, E. T. and Maloiy, G.M.O. 1983. Digestive physiology of East African wild ruminants. Comparative Biochemistry and Physiology 76A: 319-333. Cronin, M.A., Stuart, R., Pierson, B. J. and Patton, J.C. 1996. K-casein gene phylogeny of higher ruminants (Pecora, Artiodactyla). Molecular Phylogenetics and Evolution 6: 295-311. Demment, M. W. 1982. The scaling of ruminoreticulum size with body weight in East African ungulates. African Journal of Ecology 20: 43-47. Fraser, K. W. 1996. Comparative rumen morphology of sympatric sika deer (Cervus nippon) and red deer (C. elaphus scoticus) in the Ahimanawa and Kaweka Ranges central North Island, New Zealand. Oecologia 105: 160-166. Gatesy, J.D., Yelon, R., DeSalle, E.S. and Vrba, E.S. 1992. Phylogeny of the Bovidae (Artiodactyla, Mamma- lia), based on mitochondrial ribosomal DNA sequences. Molecular Biology of Evolution 9: 433-446. Giesecke, D. and Van Gylswyk, N. O. 1975. A study of feeding types and certain rumen functions in six species of South African wild ruminants. Journal of Agricultural Science, Cambridge 85: 75-83. Gordon, I. J. and Illius, A. W. 1988. Incisor arcade structure and diet selection in ruminants. Functional Ecology 2 NS, Hakonson, T. E. and Whicker, F. W. 1971. The contribution of various tissues and organs to total body mass in the mule deer. Journal of Mammalogy 52: 628-630. Harvey, P. H. and Pagel, M. D. 1991. The Comparative Method in Evolutionary Biology. Oxford University Press, New York, 239 pp. Hobson, P. N., Mann, S.O., Summers, R. and Staines, B. W. 1975. Rumen function in red deer, hill sheep and reindeer in the Scottish Highlands. Proceeding of the Royal Society of Edinburgh (B) 75: 181-198. Hofmann, R. R. 1968. Comparisons of the rumen and omasum structure in East African game ruminants in rela- tion to their feeding habits. In (M. A. Crawford, ed.) Comparative Nutrition of Wild Animals. Pp. 179-194. Symposium of Zoological Society of London 21: London. Hofmann, R.R. 1973. The Ruminant Stomach (stomach structure and feeding habits of East African game ruminants): Vol. 2, East African Monographs in Biology. East African Literature Bureau. Nairobi, 354 pp. Hofmann, R. R. 1982. Morphological classification of Sika deer within the comparative system of ruminant feeding types. Deer 5: 352-353. Hofmann, R.R. 1984. Feeding habits of mouflon (Ovis ammon musimon) and chamois (Rupicapra rupicapra) in relation to the morphophysiological adaptation of their digestive tract. In (M. Hoefs, ed.) Proceedings of Northern Wild Sheep and Goat Council 4: 341-355. Hofmann, R.R. 1988. Morphophysiological evolutionary adaptations of the ruminant digestive system. In (A. Dobson, ed.) Comparative Aspects of Physiology of Digestion in Ruminants. Pp. 393-407. Cornell University Press. Hofmann, R.R. 1989. Evolutionary steps of ecophysiological adaptation and diversification of ruminants: a comparative view of their digestive system. Oecologia 78: 443-457. Hofmann, R.R., Knight, M. H. and Frssaf, J. D. S. 1995. On structural characteristics and morphophysiological adaptation of the springbok (Antidorcas marsupialis) digestive system. Transactions of the Royal Society of South Africa 50: 125-142. Hofmann, R. R., Saber, A. S., Pielowski, Z. and Fruzinski, B. 1988. Comparative morphological investigations of forest and field ecotypes of roe deer in Poland. Acta Theriologica 33: 103-114. Hofmann, R.R. and Stewart, D. R. M. 1972. Grazer or browser: a classification based on the stomach-structure and feeding habits of East African ruminants. Mammalia 36: 226-240. Hoppe, P. P., Qvortrup, S. A. and Woodford, M.H. 1977. Rumen fermentation and food selection in East African sheep, goats, Thomason’s gazelle, grant’s gazelle and impala. Journal of Agricultural Science, Cam- bridge 89: 129-135. Hoppe, P.P., Van Hoven, W., Von Engelhardt, W., Prins, R. A., Lankhorst, A. and Gwynne, M.D. 1983. Jiang and Takatsuki, Feeding type in ruminants 89 Pregastric and caecal fermentation in dikdik (Madoqua kirki) and suni (Nesotragus moschatus). Comparative Biochemistry and Physiology 75A: 517-524. Janis, C. 1976. The evolutionary strategy of the Equidae and the origins of rumen and cecal digestion. Evolution 30: 215-267. Jarman, P. J. 1974. The social organization of antelope in relation to their ecology. Behaviour 48: 215-267. Kay, R. N. B. 1987. Weights of salivary glands in some ruminant animals. Journal of Zoology, London 211: 431- 436. Kay, R.N.B., Engelhardt, W. V. and White, R.G. 1980. The digestive physiology of wild ruminants. In (Y. Ruckebusch and P. Thivend, eds.) Digestive Physiology and Metabolism in Ruminants. Pp. 743-761. AVI Publ. Com inc: Maloiy, G. M. O., Clemens, E. T. and Kamau, J. M. Z. 1982. Aspects of digestion and in vitro rumen fermentation rate in six species of East African wild ruminants. Journal of Zoology, London 197: 345-353. Miyamoto, M. M., Kraus, F. and Ryder, O. A. 1990. Phylogeny and evolution of antlered deer determined from mitochondrial DNA sequences. Proceeding of Natural Academy of Sciences, USA 87: 6127-6131. Nagy, J. G. and Regelin, W. L. 1975. Comparison of digestive organ size of three deer species. Journal of Wildlife Management 39: 621-624. Prins, R. A. and Geelen, M. J. H. 1971. Rumen characteristics of red deer, fallow deer and roe deer. Journal of Wildlife Management 35: 673-680. Romer, A. S. 1966. Vertebrate Paleontology. University of Chicago Press. Chicago and London, 446 pp. Short, H. L. 1964. Postnatal stomach development of white-tailed deer. Journal of Wildlife Management 28: 445— 458. Short, H. L., Medin, D. E. and Anderson, A. E. 1965. Ruminoreticular characteristics of mule deer. Journal of Mammalogy 46: 196-199. Spinage, C. A. 1986. The Natural History of Antelopes. Croom Helm Publishers Ltd, Provident House, Burrel Row, Beckenham, Kent, 203 pp. Staaland, H. and White, R.G. 1991. Influence of foraging ecology on alimentary tract size and function of Svalbard reindeer. Canadian Journal of Zoology 69: 1326-1334. Takatsuki, S. 1986. Food habits of Sika deer on Mt. Goyo, northern Honshu. Ecological Research 1: 119-128. Van Soest, P. J. 1982. Nutritional Ecology of the Ruminant. O & B Books, Corvallis, 374 pp. Walker, E. P. 1975. Mammals of the World. 3rd edn. (J. L. Paradiso, ed.) The Johns Hopkins University Press, Baltimore and London, 1500 pp. Wall, D. A., Davis, S. K. and Read, B. M. 1992. Phylogenetic relationships in the subfamily Bovinae (Mammalia: Artiodactyla) based on ribosomal DNA. Journal of Mammalogy 73: 262-275. Received 16 April 1999. Accepted 12 October 1999. ~ . ne ; rs ? re le a ye Avciies Cathi oma th = Pe aa) a Mammal Study 24: 91-102 (1999) © the Mammalogical Society of Japan Diet of the Japanese serow (Capricornis crispus) on the Shimokita Peninsula, northern Japan, in reference to variations with a 16-year interval Keiji Ochiai! Natural History Museum and Institute, Chiba, 955-2 Aoba-cho, Chuo-ku, Chiba 260-8682, Japan Abstract. The diet of the Japanese serow (Capricornis crispus) was analyzed quantitatively in a high density (14.8+3.0 individuals/km2) population throughout the year by direct observation of feeding behavior on the Shimokita Peninsula, northern Japan, during two survey periods, 1978-1980 and 1994-1996. Serows fed on 114 plants species and one species of fungus. Analyses of 16,686 bites indicated that serows fed mainly on leaves and twigs of deciduous broad-leaved trees, which formed 54.8-58.3% of the diet in autumn and 94.5-95.0% in winter, followed by forbs (16.5-39.1% from spring to autumn). The results suggest that the Japanese serow is a browser throughout the year, and is mainly a folivore. There was no significant difference in the dietary composition at the food category level, nor was there any change in the diversity index of the diet between the two study periods. The four top-ranking food species were identical in the both periods. Browsing by Japanese serows may have only limited impacts on vegetation because of low population densities related to territoriality. Key words: browser, browsing effects, Capricornis crispus, diet, Japanese serow. The Japanese serow (Capricornis crispus) is a solitary ungulate inhabiting forested moun- tainous areas of Japan. A knowledge of food habits is essential for understanding wildlife habitat needs. The present study on the diet of Japanese serows had two aims. The first was to analyze the serow diet quantitatively throughout the year. Many reports (Chiba 1968; Chiba and Yamaguchi 1975; Miyao 1976; Akasaka 1977; Akasaka and Maruyama 1977; Yamaguchi and Takahashi 1979) have indicated that Japanese serows feed mainly on various woody species according to the region inhabited. However, these studies have been qualitative and/or analyzed with small sample size, except for a single analysis of the winter diet (Takatsuki and Suzuki 1984). Therefore, more detailed quantitative studies on all seasons are needed for a clear understanding of Japanese serow feeding habits. The second aim of the study was to analyze the effects of browsing by Japanese serows on vegetation by comparing the diets recorded in two survey periods 16 years apart. Ungulates not only depend on plant communities but also can affect plant community com- position and structure. Numerous studies on the effects of browsing have been conducted, 1F-mail: ochiai@chiba-muse.or.jp 92 Mammal Study 24 (1999) as reviewed by Gill (1992) and Augustine and McNaughton (1998). However, almost all of these studies focused on gregarious and/or non-territorial ungulates. The effects of solitary and territorial ungulates such as the Japanese serow on vegetation may be different from those of gregarious species. In this study, the effects of serows on the vegetation are discussed in comparison with corresponding information on sika deer (Cervus nippon), a gregarious ungulate inhabiting Japan. Study area The study area (90 ha) was situated in Wakinosawa village (41°8'N; 140°46’E) on the Shimokita Peninsula, Aomori Prefecture, northern Japan. The area, facing Mutsu Bay on its south and west sides, ranges in altitude between 0 and 240 m, and slopes are steep (25°). The climate belongs to the cool temperate zone; mean annual temperature is 9.3°C and mean monthly temperatures ranges from —1.8°C in February to 21.5°C in August. Mean annual precipitation is 1,337 mm at the nearest meteorological station, 4km east of the study area. The area is covered by 30-100cm of snow in winter, and snow cover persists for three months between late December and March. In 1978, 75% of the area was mature deciduous broad-leaved forests dominated by Quercus mongolica ssp. crispula, Fagus crenata and Tilia japonica with Rhododendron obtusum var. kaempferi and Viburnum dilatatum as common understory species. Natural coniferous forests of Thujopsis dolabrata var. hondae covered 7% of the area. Plantations with coniferous trees (Cryptomeria japonica and Pinus densiflora) both less than 20 years old and over 21 years old accounted for 10% and 3% of the area, respectively. The vegeta- tion composition in the study area remained unchanged between the two study periods. The proportion of younger and older plantations, however, had changed to 1% and 12% of the study area. Serows, the only species of ungulates inhabiting the study area, maintained a stable population density with a mean of 14.8 individuals/km? (SD=3.0) from 1976 to 1996 (Ochiai 1993, unpublished data). The mean population density of Japanese serows in 10 prefectures is 2.62.7 individuals/km* (mean+SD, n=174) (Maruyama and Furubayashi 1980); the density of serows in the study area was at the highest level. Methods To servey vegetation composition in the study area, trunk diameters at ground level of all woody plants (<2 m in height) were measured in forty 5mx<4m plots. For the survey two sites in the study area were selected, and the twenty plots in each site were distributed uniformly on a 100m square grid. This survey was carried out in 1997. Diet composition was estimated by direct bite count observation (Wallmo and Neff 1970). Field observations were made during two periods, from March 1978 to October 1980 (Period A, 191 days) and from October 1994 to November 1996 (Period B, 59 days). The surveys were conducted in May-June (spring), July-September (summer), October-November (autumn) and January-March (winter) in Period A and only in autumn and winter in Period B. Serows were directly observed for 947 h in Period A and 223 h in Period B, for a total of 1,170 h in 250 days. Ochiai, Diet of the Japanese serow 93 I walked through the study area looking for serows, and observed the feeding behavior of any serows detected with the aid of 7 x 35 binoculars and a telescope (x 25). Because the serows in the study area were not very alarmed by the presence of humans, it was possible to follow about 10-20 m behind without serious disturbances. The number of bites, food species and plant parts eaten were recorded. In winter, fresh signs of feeding on twigs along fresh serow tracks in snow were also recorded as bites. Foods were categorized into woody plants (deciduous broad-leaved trees, including vines, and evergreen coniferous trees), forbs, graminoids, ferns and fungi. The composition of serow diets was expressed as percentages of the total number of bites, regardless of bite size. Food diversity was measured according to the Shannon-Weaver index (77), H =—>(P)In(P)) where P; is the proportion of food item i in the total diet. Diets in autumn and winter between Periods A and B were compared by the G-test. Results Dominance of understory trees Forty-four understory tree species were recorded in the plots, and deciduous broad- leaved trees of 41 species accounted for as much as 96.6% of the total basal area at ground level (Appendix 1). Two species of deciduous broad-leaved trees, R. obtusum var. kaempferi (18.5%) and V. dilatatum (18.3%), were dominant, followed by QO. mongolica ssp. crispula (8.0%), Tripetaleia paniculata (6.5%) and T. japonica (5.4%). Diet at the food category level A total of 16,686 bites was observed. The most important food category was woody plants, which comprised 56.2-60.2% of the diet in autumn to 97.7-98.1% in winter (Table 1). Forbs accounted for 16.5-39.1% from spring to autumn, and two graminoids (Carex species) were eaten in autumn (3.9-4.7%) and winter (1.6-2.1%). Among trees, deciduous broad-leaved trees were the primary food. Serows browsed leaves from spring to autumn and 5-10 cm long twigs with buds in winter. The proportion of the twigs rose to 93.2-94.5% in the winter diet. Leaves of evergreen coniferous trees were eaten in autumn (1.4-1.9%) and winter (2.7-3.6%). Serows occasionally fed on flowers and fruit together with leaves. Flowers of R. obtusum var. kaempferi and fruits of Berberis amurensis were eaten selectively. Fallen acorns of Q. mongolica ssp. crispula were also consumed in autumn and winter. Serows dug for acorns when the snow cover was not more than 10cm deep. No bark or dead leaves of woody plants were eaten. Diet at individual species level Serows fed on 114 plant species (60 deciduous broad-leaved trees, 5 evergreen coniferous trees, 46 forbs, two graminoids and one fern) belonging to 56 families, and one species of fungus (Table 2). The numbers of food species were higher (64-81 species) from spring to summer, and lower (29-32 species) in winter. The diversity index (H’) of the diet was highest (3.29) in summer, and lowest (2.33-2.35) in winter (Table 2). 04 Mammal Study 24 (1999) Table 1. Food categories and the percentage frequencies of bites of the Japanese serow (Capricornis crispus) observed on the Shimokita Peninsula, northern Japan, in each season during Period A (1978-1980) and Period B (1994-1996). Month May-June July—Sept. Oct.—Nov. Jan.—Mar. Period A A A B A B Food category n=2,281 n=3,567 n=2,668 n=1,720 n=3,879 n=2,571 Woody plants Deciduous broad-leaved trees leaves 82.9 77.8 56.1 49.1 0.0 0.0 flowers 0.6 0.0 0.0 0.0 0.0 0.0 fruits 0.0 0.6 0.2 0.3 0.0 0.0 acorns 0.0 0.0 0.4 5.4 0.0 1.8 twigs and buds 0.0 0.0 1.6 0.0 94.5 93.2 Total deciduous broad-leaved trees 83.5 78.4 58.3 54.8 94.5 95.0 Evergreen coniferous trees (leaves) 0.0 0.0 1.9 1.4 3.6 Deal Total woody plants 83.5 78.4 60.2 56.2 98.1 97.7 Forbs leaves and stems 16.5 plod 35.8 39.1 0.3 0.2 flowers 0.0 0.4 0.1 0.0 0.0 0.0 Total forbs 16.5 21.5 35.9 39.1 0.3 0.2 Graminoids 0.0 0.0 3.9 4.7 1.6 2.1 Ferns 0.0 0.0 =F 0.0 0.0 0.0 Fungi 0.0 0.1 0.0 0.0 0.0 0.0 +: trail (<0.05). Table 2. Number of food species for each food category, diversity index of diet, and percentage frequencies of bites accounted for by major food species (3, 5 and 10 top-ranking food species) of the Japanese serow (Capricornis crispus) on the Shimokita Peninsula, northern Japan, in each season during Period A (1978-1980) and Period B (1994-1996). May-June July—Sept. Oct.—Nov. Jan.—Mar. Total Food category Period A A A B A B — Woody plants Deciduous broad-leaved trees 39 42 28 23 23 24 60 Evergreen coniferous trees 0 0 2 1 5 2 5 Forbs 25 38 23 23 2 1 46 Graminoids 0 0 2 2 7) 2 2 Ferms 0 0 1 0 0 0 1 Fungi 0 1 0 0 0 0 1 Total 64 81 56 49 32 29 115 Shannon-Wiener diversity index 2.87 3.29 3.03 3.09 2233 235 — % of the 3 top-ranking food species 50.7 35.7 39.4 39.4 59.0 57.8 — % of the 5 top-ranking food species 59.1 46.4 53.9 S24 Boll Teo — % of the 10 top-ranking food species 74.4 64.0 73.0 71.0 88.6 88.6 — Ochiai, Diet of the Japanese serow 95 In spite of the large number of food species, a major part of the diets comprised a limited number of species: e.g., the top five and 10 species in the diet accounted for 46.4— 75.5% and 64.0-88.6%, respectively (Table 2). According to a similar analysis, 80% of the total diet was comprised of 13-18 species in spring-autumn and only seven species in winter. The main food species changed seasonally (Appendix 2). Comparison between Period A (1978-1980) and Period B (1994-1996) No significant difference in the percentage frequencies of bites of the four food cate- gories (deciduous broad-leaved trees, evergreen coniferous trees, forbs and graminoids) was detected in either autumn or winter between the two study Periods A and B (Table 1; autumn, G=7.65, df=3, P>0.05; winter, G=6.78, df=3, P>0.05). There was no obvious change in the H’ values for the diet between Periods A and B; the values were 3.03 and 3.09 in autumn and 2.33 and 2.35 in winter, respectively. The following species remained unchanged as the top four species in the both periods: Callicarpa japonica, Table 3. Results of G-test for the numbers of counted bites of the Japanese serow (Capricornis crispus) on the Shimokita Peninsula, northern Japan, in autumn between Period A (1978-1980) and Period B (1994-1996). The top 15 species in each period are shown. Period A Period B Species Rank No.of % Rank No.of % G order bites order bites Callicarpa japonica 1 464 17.4 1 324 18.8 0.739 NS Alangium platanifolium var. trilobum D, 345 12.9 4 136 TD a NANOS 2 Dae Angelica ursina 3 242 9.1 2 201 7 Bn800) wil Artemisia montana 4 237 8.9 3 152 8.8 0.001 NS Buckleya lanceolata 5 150 5.6 — 0 OM WBS Ibe Akebia trifoliata 6 135 5.1 9 49 2.8 6.689 D** Smilax china 1 124 4.6 11 35 2.0 11041 DE ss Carex blepharicarpa & C. foliosissima 8 105 3.9 6 82 4.8 0.877. NS Asperula odorata 9 75 2.8 44 4 A PSSIG IDs Rhus ambigua 10 70 2.6 33 7 OA SSS Dt oe Spuriopimpinella calycina 11 66 75) 21 16 0.9 Ua Dye Rubus crataegifolius 12 61 D8) 16 75) Joe) 1.962 NS Acer japonicum 13 54 7x0) 14 28 1.6 0.455 NS Eupatorium chinense var. oppositifolium 14 48 1.8 24 14 0.8 3.927 Ds Berberis amurensis 15 43 1.6 _— 0 V0. Als ID Quercus mongolica ssp. crispula 19 35 1.3 5 114 G5, ALO) il Cacalia auriculata var. kamtschatica 27 13 0.5 13 29 1 TTL Satelite rs Schizophragma hydrangeoides 4] 3 0.1 10 45 DS BT Ws Solidago virgaurea var. asiatica 41 3 0.1 12 32 1298 F213 865 rules Lindera umbellata ssp. membranacea 46 2 0.1 15 26 1S) sp SAD ee aes Zanthoxylum piperitum — 0 0.0 7 79 aS Ss Trifolium repens — 0 0.0 8 52 3 AQIS ee Others — 393 14.7 — 270 S)57/ — — Total — 2,668 100.0 — 1,720 100.0 — — Asterisks indicate the degree of significance of the results (*** P<0.001, ** P<0.01, * P<0.05, NS=not sig- nificant), and ‘D’ and ‘I’ represent a significant decline and increase in occurrence of the individual species in the diet from Period A to B, respectively. 96 Mammal Study 24 (1999) Table 4. Results of G-test for the numbers of counted bites of the Japanese serow (Capricornis crispus) on the Shimokita Peninsula, northern Japan, in winter between Period A (1978-1980) and Period B (1994-1996). The top 15 species in each period are shown. Period A Period B Species Rank No. of % Rank No.of % G order bites order bites Hamamelis japonica var. obtusata 1 Ls WSo7 D 572. 22.2" “loin Lindera umbellata ssp. membranacea 2 858 DON 1 583 De 0.138 NS Tilia japonica 3 317 8.2 4 DSi 10.0 3.138 I* Acer japonicum 4 292 US 3 332 12.9. uf 252103mu of *** Viburnum furcatum 5 279 To2d I 75 2:9 «29536. *** Stachyurus praecox 6 211 5.4 15 11 0.4 75.640 D*** Thujopsis dolabrata var. hondae 7 120 3.1 8 val 2.8 0.299 NS Carpinus cordata 8 97 DES lst 55) Poe 0.444 NS Viburnum wrightii 9 86 Dp 5) 197 hell 53554050 1 4t* Quercus mongolica ssp. crispula 10 64 1.6 6 111 4-3 45 20 296mr s** Fraxinus lanuginosa f. serrata 11 64 1.6 10 57 Phe) 1.329 NS Carex blepharicarpa & C. foliosissima 12 61 1.6 12 ay) 2.0 0.897 NS Corylus sieboldiana 13 55 1.4 16 9 0.4" 1107345 DF * Viburnum dilatatum 14 52 1.3 9 67 2.6 6:65 7) ke * Buckleya lanceolata 15 50 1.3 — 0 0.0" 25555355 D*** Fagus crenata 19 18 0.5 14 38 15 9.020 I** Rhus ambigua 24 9 0.2 13 42 1.6 19.595 |[*** Others — 134 3.5 — 42 1.6 — — Total — 3,879 100.0 — 2,571 100.0 — — Asterisks indicate the degree of significance of the results (*** P<0.001, ** P<0.01, * P<0.05, NS=not sig- nificant), and ‘D’ and ‘I’ represent a significant decline and increase in occurrence of the individual species in the diet from Period A to B, respectively. Alangium platanifolium var. trilobum, Angelica ursina, and Artemisia montana in autumn; Hamamelis japonica var. obtusata, Lindera umbellata ssp. membranacea, Tilia japonica, and Acer japonicum in winter. However, in the second study period, among 22 species in autumn (the top 15 species in each period) nine accounted for a significantly lower propor- tion of the diet, eight accounted for a significantly higher proportion (P<0.05), and five showed no significant difference (Table 3). There were some conspicuous declines between study periods (e.g., Buckleya lanceolata, Asperula odorata). Among 17 species in winter, the proportion in the diet of five significantly decreased, seven increased (P<0.05), and five showed no significant difference (Table 4). Conspicuous declines between study periods were also apparent in the winter use of some species (e.g., Stachyurus praecox, Viburnum furcatum). Discussion General features of the serow diet On the Shimokita Peninsula, Japanese serows fed mainly on woody plants, mostly deciduous broad-leaved trees. Forbs were of secondary importance from spring to autumn. These results support the findings of Takatsuki and Suzuki (1984), who analyzed the winter Ochiai, Diet of the Japanese serow 97 foods of serows in central Japan, and described them as browsers. The current study found that Japanese serows on the Shimokita Peninsula are browsers throughout the year, and are conspicuous folivores. Food habits of Japanese serows vary regionally. Several pioneer reports indicated that conifers and evergreen broad-leaved shrubs are important in the winter diet (Chiba and Yamaguchi 1975; Miyao 1976; Akasaka 1977; Yamaguchi and Takahashi 1979). For instance, the proportion of coniferous trees occupied more in winter in central Japan (32.8%, Takatsuki and Suzuki 1984) than in the present study (2.7-3.6%). Their study areas contained many young plantations of a coniferous tree (Chamaecyparis obtusa). Yakatsuki et al. (1988) reported that a coniferous shrub (Cephalotaxus harringtonia var. nana) and an evergreen broad-leaved shrub (Aucuba japonica var. borealis) were the main winter foods in Yamagata, northern Japan. These shrubs are uncommon in the present study area. In addition, no feeding on dwarf bamboos (Sasa spp.) was observed in the present study, although it accounted for 27.2% of the winter diet in central Japan (Takatsuki and Suzuki 1984). Takatsuki and Suzuki (1984) interpreted the importance of dwarf bamboos in the diet of serows as a reflection of their relative abundance and year-round availability. Dwarf bamboos seem to be less important in low altitude areas (<600 m) such as the present study and Yamagata (Takatsuki et al. 1988) than at higher altitudes (600-1700 m, Chiba and Yamaguchi 1975; Yamaguchi and Takahashi 1979; Takatsuki and Suzuki 1984). If this altitude-related difference is valid, dwarf bamboos may be a less preferred food eaten mainly under poor food conditions. The Japanese serow is a forest-dwelling, solitary species with a small resource-defending territory (Akasaka and Maruyama 1977; Ochiai 1983a, b, 1993; Kishimoto and Kawamichi 1996). Their body size is moderate (30-45 kg), and they have little sexual dimorphism (Miura 1986). These features are typical of browsers (Bell 1971; Jarman 1974). The present results together with the findings of Takatsuki and Suzuki (1984) support the Jarman-Bell principle. The mainland serow (C. sumatraensis) and the goral (Nemorhaedus goral) belong to the same Tribe Rupicaprini as the Japanese serow. These are also primitive species inhabiting forests. Faecal analysis of these two sympatric species in North India indicated that the mainland serow was a browser, whereas the goral was a grazer (Green 1987). The goral can dwell in cliff habitats with open rocky slopes (Schaller 1977; Heptner et al. 1989; Lovari and Apollonio 1993). The maximum group size of gorals is 9-11 (Cavallini 1992; Lovari and Apollonio 1993), which is larger than the corresponding figure, 4 of the Japanese serow (Ochiai 1993; Kishimoto and Kawamichi 1996). The Japanese serow seems to be a fairly solitary browser in comparison with the goral. Effects of browsing In the 16 years between study Period A and B, no obvious difference in the crude com- position of the diet was found. However, the proportion of some species, such as Buckleya lanceolata and Stachyurus praecox, decreased markedly in the diet. These results suggest that although the browsing of serows may have no drastic impacts on overall vegetation structure and composition, some species may be affected by browsing pressure. Since the density of serows in the study area is among the highest in Japan, negative impacts of browsing on vegetation structure and composition in other areas are even less likely. 98 Mammal Study 24 (1999) In contrast, the sika deer (Cervus nippon centralis), another medium-sized ruminant (60-87 kg for males and 40-50 kg for females, Koganezawa et al. 1986; Ochiai and Asada 1995) living in Honshu, Japan, has been reported to have severe impacts on vegetation, including not only the elimination of the main food species in the habitat (Kabaya 1988) but also the alteration of forest composition (Takatsuki and Gorai 1994). This difference may reflect differences in social organization, such as the territorial isolation of the Japanese serow as opposed to the non-territorial gregariousness of sika deer. Consequently, the population density of serows seldom exceeds 20/km* (Maruyama and Furubayashi 1980), whereas it reaches 100/km2 with sika deer (C. n. nippon; Doi and Endo 1995). At such low densities, it is less likely that over-browsing by serows would lead to changes in overall vegetation structure and composition (Takatsuki 1996). Furthermore, the aggregation of serows and the concentration of their browsing on preferable species may be less than sika deer due to their territoriality, even when their population densities are similar. Differences in the volume of forage intake related to body size may also influence the relative degree of the browsing effects. Acknowledgements: I wish to thank H. Mizuhara for his valuable advice. I am also grateful to S. Lovari and Y. Ono for their helpful comments on an earlier draft of the manuscript. I thank T. Nakashizuka for his help on the identification of the plant species, K. Susaki for providing assistance during the field work, members of the Society of Serow Research on the Shimokita Peninsula for their co-operation in the survey of the vegetation, the people of Wakinosawa village, A. Matsuoka, S. Matsuoka, T. Nakazima, M. Shibata, K. Takahashi and others for their kindness and helpfulness, and J. P. Moll for improving the English manuscript. This study was supported in part by a Grant-in-Aid for Scientific Research from the Ministry of Education, Science and Culture, Japan (Nos. 06660200 and 10680559). References Akasaka, T. 1977. Food habits and feeding behavior of Japanese serow in Nibetsu, Akita Prefecture. Annual Reports of WWF-Japan 1: 67—80 (in Japanese with English summary). Akasaka, T. and Maruyama, N. 1977. Social organization and habitat use of Japanese serow in Kasabori. Journal of Mammalogical Society of Japan 7: 87-102. Augustine, D. J. and McNaughton, S. J. 1998. Ungulate effects on the functional species composition of plant communities: herbivore selectivity and plant tolerance. Journal of Wildlife Management 62: 1165-1183. Bell, R. 1971. A grazing ecosystem in the Serengeti. Scientific American 225: 86—93. Cavallini, P. 1992. Survey of the goral Nemorhaedus goral in Himachal Pradesh, India. Journal of Bombay Natural History Society 89: 302-307. Chiba, H. 1968. Some notes on the food habit of the Japanese serow, Capricornis crispus crispus (TEMMINCK). Journal of Mammalogical Society of Japan 4: 20—25 (in Japanese with English summary). Chiba, H. and Yamaguchi, Y. 1975. The food habit of Japanese serow Capricornis crispus crispus (TEMMINCK), in the basin of River Takase, the Japan North Alps. Bulletin of the Kanagawa Prefectural Museum (Natural Science) 8: 21-36 (in Japanese with English summary). Doi, T. and Endo, A. 1995. A report on the effects of the Nozaki Dam, Ojika area. Department of Ecology, Faculty of Science, Kyushu University, Fukuoka, 25 pp. (in Japanese). Gill, R. M. A. 1992. A review of damage by mammals in North temperate forests: impact on trees and forests. Forestry 65: 363-388. Ochiai, Diet of the Japanese serow 99 Green, M. J. B. 1987. Ecological separation in Himalayan ungulates. Journal Zoology. Ser. B. London 1: 693-719. Heptner, V. G., Nasimovich, A. A. and Bannikov, A. G. 1989. Mammals of the Soviet Union, volume 1 ungulates. E. J. Brill, Leiden, 1147 pp. Jarman, P. J. 1974. The social organization of antelope in relation to their ecology. Behaviour 48: 215-267. Kabaya, H. 1988. Changes of undergrowth of a broadleaved evergreen forest in relation to grazing effects by sika deer. Bulletin of the Tokyo University Forests 78: 67-82 (in Japanese with English summary). Kishimoto, R. and Kawamichi, T. 1996. Territoriality and monogamous pairs in a solitary ungulate, the Japanese serow, Capricornis crispus. Animal Behaviour 52: 673-682. Koganezawa, M., Inui, T. and Kitahara, M. 1986. Body weight and external carcass measurements of sika deer (Cervus nippon Temminck) in Nikko-Ashio Mountains, Tochigi Prefecture, Japan. Memoirs of Tochigi Prefectural Museum 4: 29-53 (in Japanese with English summary). Lovari, S. and Apollonio, M. 1993. Notes of the ecology of gorals in two areas of Southern Asia. Revue d’Ecologie 48: 365-374. Maruyama, N. and Furubayashi, K. 1980. On the distribution, density, and population size of Japanese serow. The Environmental Agency, Tokyo, 48 pp. (in Japanese). Miura, S. 1986. Body and horn growth patterns in the Japanese serow, Capricornis crispus. Journal of Mamma- logical Society of Japan 11: 1-13. Miyao, T. 1976. Stomach contents of Japanese serow indigenous to southern parts of the Japan North Alps. Journal of Mammalogical Society of Japan 6: 199-209 (in Japanese with English summary). Ochiai, K. 1983a. Pair-bond and mother-offspring relationships of Japanese serow in Kusoudomari, Wakinosawa Village. Journal of Mammalogical Society of Japan 9: 192-203 (in Japanese with English summary). Ochiai, K. 1983b. Territorial behavior of the Japanese serow in Kusoudomari, Wakinosawa Village. Journal of Mammalogical Society of Japan 9: 253—259 (in Japanese with English summary). Ochiai, K. 1993. Dynamics of population density and social interrelation in the Japanese serow, Capricornis crispus. 72 pp. Ph.D. Thesis. Kyushu University, Fukuoka. Ochiai, K. and Asada, M. 1995. Growth in the body size of sika deer (Cervus nippon) on the Boso Peninsula, central Japan. Journal of the Natural History Museum and Institute, Chiba 3: 223-232 (in Japanese with English summary). Schaller, G. B. 1977. Mountain monarchs. University of Chicago Press, Chicago, 425 pp. Takatsuki, S. 1996. Relationship between food resources and territoriality of the Japanese serow. In The Japanese serows in the Western Zao. Pp. 101-106. Yamagata Prefectural Board of Education, Yamagata (in Japanese). Takatsuki, S. and Gorai, T. 1994. Effects of Sika deer on the regeneration of a Fagus crenata forest on Kinkazan Island, northern Japan. Ecological Research 9: 115—120. Takatsuki, S., Osugi, N. and Ito, T. 1988. A note on the food habits of the Japanese serow at the western foothill of Mt. Zao, northern Japan. Journal of Mammalogical Society of Japan 13: 139-142. Takatsuki, S. and Suzuki, K. 1984. Status and food habits of Japanese serow. Proceedings Biennial Symposium of Northern Wild Sheep & Goat Council 4: 231-240. Wallmo, O. C. and Neff, D. J. 1970. Direct observations of tamed deer to measure their consumption of natural forage. In Range and wildlife habitat evaluation — a research symposium. U.S. Department Agriculture/Forest Service Miscellaneous Publication 1147: 105-110. Yamaguchi, Y. and Takahashi, H. 1979. Food habits of Japanese serow as assessed by rumen contents. In Report on wildlife damages. Pp. 29-51. Environmental Agency of Japan, Tokyo (in Japanese). Received 15 March 1999. Accepted 18 October 1999. 100 Mammal Study 24 (1999) Appendix 1. Basal area of understory woody species in the study area. Species Leaf type* Basal area** Percentage (mm?/m?) Rhododendron obtusum var. kaempferi D 63.3 18.5 Viburnum dilatatum D 62.4 18.3 Quercus mongolica ssp. crispula D PET xP 8.0 Tripetaleia paniculata D Dos) 6.5 Tilia japonica D 18.5 5.4 Lindera umbellata ssp. membranacea D 16.3 4.8 Fraxinus lanuginosa f. serrata D 15.1 4.4 Magnolia praecocissima D 14.5 4.2 Hamamelis japonica var. obtusata D 9.6 2.8 Viburnum wrightii D 933 Dea Acer japonicum D 9.0 2.6 Callicarpa japonica D 8.0 23 Carpinus cordata D 7.8 2.3 Thujopsis dolabrata var. hondae C 6.1 1.8 Zanthoxylum piperitum D 505) 1.6 Vaccinium oldhamii D 5.4 1.6 Syringa reticulata D 4.4 15S) Evodiopanax innovans D 4.2 1.2 Quercus dentata D Sail Jel Acer mono f. marmoratum D Sol el Alangium platanifolium var. trilobum D 325 1.0 Rhododendron brachycarpum E 3.0 0.9 Fagus crenata D 3.0 0.9 Cryptomeria japonica C 2.3 0.7 Corylus sieboldiana D 233 0.7 Pourthiaea villosa var. laevis D 1.9 0.5 Carpinus laxiflora D 1.8 0.5 Rhus ambigua D hed 0.5 Euonymus alatus f. ciliato-dentatus D 1.0 0.3 Sorbus alnifolia D 0.9 0.3 Viburnum furcatum D 0.9 0.3 Benthamidia japonica D 0.7 0.2 Berberis amurensis D 0.7 O7 Rubus crataegifolius D 0.6 0.2 Aralia elata D 0.2 0.1 Sambucus racemosa ssp. sieboldiana D 0.2 0.1 Vaccinium japonicum D 0.2 0.1 Clerodendrum trichotomum D 0.2 0.1 Picrasma quassioides D 0.2 0.0 Euonymus alatus D 0.1 0.0 Morus australis D 0.1 0.0 Buckleya lanceolata D 0.1 0.0 Stachyurus praecox D =F 0.0 Akebia trifoliata D = 0.0 Total — 341.6 100.0 *: D, deciduous broad-leaved tree (including two vine species); E, evergreen broad-leaved tree; C, evergreen coniferous tree. **: basal area at ground level. +: trail (<0.05 mm?/m72). 101 Ochiai, Diet of the Japanese serow v0 vl £0 vii 9°0 80 d oeooe[Njog pubipjogais snjx1oy L'€ 3°0 4 seooe[AydodAle,) SIUNWWUOD DULJAWUWOd 3°0 QT rl €'0 8°0 A sejIsodurog wnyofiisoddo ‘rea asuauiys wnisojvdny 7'0 ys 0°0 €°0 6'0 d eae InAYIeIS xoJapid sninkyonjy L'0 9°7 L'0 €°0 Q°7 O'T ad IBIOVSLIFIXES Saploasuvipdy vulsp1ydoz1yrIg L'0 9°0 ‘0 CK vl LI ad seo0BqnOIeWIS SaploissonDd DUSDADIg 80 9°0 0°0 One a A SeIOFT[OQU() SINnpa DIjasuy 9'[ €°7 OI Taal ad avo0eplioqgiog SISUBANUID S1LOGIOT Q°7 as Cl Gal IT 9 oeooessoidny appuoy “eA vJvAqvjop sisdo[ny | ICG 6 0°0 0°0 IG a d oeooRNIOg DIDP1OD SNUIAIDD Onl 70 v0 NG IC G |! d ovooRIpleovuy onsiquin snyYy v0 9'Y Gal ad seo0esey DIDJUuap SNI1ENO €'0 61 0°0 el d seSOUIUINSS T DIDGO] DIADAING [ale GO a0) 0°0 60 vil d ovooer[ojlide) MJYZ1IM WINUANGIA 67 Gu 0°0 0°0 vl d ovoorr[ojlide) uinjooinf WnuANg1A 8°C I's 60 9°0 VT d oeooeleqezipse’] DIDIOfIA] DIGAYW 07% 9'[ 87 6°€ Sali 19) oeoovlodA, DUISSISOIOL ‘Dd 2% vdivrlspYydajq XadDD 60 SiC IG 9°7 9°T d seas Tquip) DUIIAIDI BjjauiduidoLinds a 8S call 0°? d seo0eSOY pyofsiujo snqsog 07? 4 9°0 LAS 0'C S A oeooell] DUIYD XDIIWS Lit 16 © O) 0°0 YC S*T A se LOFTT[OQu() DUISIN DIjasuy eV 9°| 9°9 el LY €°0 Q°7 V‘'L‘TI d avooesey pindsisd “dss vI1JOsUuOW SNI1ENCE 70 £0 8°8 68 lv G | W) te Id ‘S “T A sesodwoy) DUDJUOU DISIWA}AV 6 CI See oT 0°? 1? 8 vv eae | d SBINB IOV wunquodvf 1090 y 6'L 6TI OL oY 1 rae seoovISULTV WNGOjid] “eA winyofiunjojd wnisunjpy 70 70 6'0 ULI CT esa ad IBIDCIONV UNJDAOULIDUL *¥ OUOW ABI cml 9°¢ vCI vy | Sv th eal d seooR[ejUeS pinjoaouD] vAajyong 0'0T C8 10 Te 0°8 ES i a d oeooellL pauodol vii [L(G a6 | 10 €°0 IL, 69 lew d oeoovIne T padpubiquiaul “dss pjojyjaquin D1apulT CGE L’87 10 v0 9°9 Laid ad seooRpI[OWIeUIe YY pvsnjqgo “red pI1UOodvs sjawmDwoy v) 6 Call 10 9°ST 69 nea d ovoorl[ojlided UNjoIo/Ip UNUANGLA 10 9°0 8°81 vLI €91 10 L’8 L“T d SBIdBUOGIOA pnuodol pdivojjoD Ol Ee eae eee ee ee aa suse sure aioe "SIT JUOSoId OY} UI UMOYS o1e ‘UOSB9S YO¥O UI Sofdods QZ do} oY} ore YOIYM ‘(Satdods Cy) JOIP MOJOS 91TJUS OY} JO Sotdads 9UO-A}XIS *(9661—-766I1) A POTOd pue (0861-8161) V POl9d UOseas Yove UI ‘ueder UIOYIIOU ‘e[NsUTUSg BITYOUIIYS dy} UO (SNAS119 SIUJOIIIADD) MOIS BsoURAEL 9} JO S911 PoAIOsqo Jo sofoudnbosyJ o3e}Ud0I0d oY} pue solseds pooy °7 xipueddy WS L'66 €°0 Mammal Study 24 (1999) c0 v0 cl 00 CC 6L8°€ V 66 0) c°0 v0 0) II ‘uI00®e FY ‘JINIF ‘I SIOMOP ‘TA ‘Woys “S Spng YIM 3IM) ‘YL ‘Jeo] “7 :,,, Uae eg "9911 SNOIOJIUOS UIdIBIIAO ‘D *qio ‘4 :(Safoods SUIA xIS BUIPNIOUI) 991] PaAva[-peOlq snonpldep ‘q :,,WIOJ JIT] Sd}Iq PdAIOSqO JO ‘ON [e1OL O7L‘T 899° LOS‘€ I8Z‘Z 989 OT 1°S6 vS6 8°€6 9°S6 0°96 0°0 af d avoor[niog 10 Le poll ral ale l)(6) G)| 0°0 10 7 ad ovoorl[ely £0 10 a ) SBOOVIPOXP I, Vv 10 Sea | d avoovuosA[Od Gal 0°0 0°0 10 S‘T d de908OI}I() 9°0 m0) 10 70 Lea al IedDRIOW IO 70 Te ad ae90e3e J 10 0'T €°0 I d ovooeUW) Oe €°0 S17 dA oeSOUIUINSST c0 0°0 VT v0 al d oeooejnounuey €°0 0) v0 OT v0 Wd ‘S “7 d aeaoeplioqiog 10 Cl v0 a | 4d ovoovjnuedures) 9°0 ima 0°0 v0 T d sevooelfojlided 61 10 8°0 10 v0 ld ‘S “7 d seyIsoduioD 8 0°0 a0) al d ovooel[ely c0 8°C 10 0) S°T A avoovIqny v0 S|! 70 0) T ad BOORIIA 7 10 a0) I d svooe Ny Lit 50 9°0 v0 50 ld ‘S “1 d selisoduio0p 0) v0 [| 10 C0 S ‘TIT A ae}Isoduiod £0 °C 9°0 Iq “7 d avooRl[eIV 60 v'T 8°0 GO 9°0 I ‘S “7 d oesodwio) £0 cil Vl 70 9°0 1 al SBOORIPIUIOV cl EG €°0 9°0 IT d oea0Rsoy a0) 9°0 nO | d aea0eI1O a0) 01 61 £0 L‘0 S“T dA aeyIsodurosy ¢'0 VT 70 L‘0 T ral oeSOUIUINSST @ POled V polled q POled V polled V polled V polled x,U9}e9 =, UOJ sureu ATU IUIN, UUININyY UuUNINY IowWNg sulIdg § [e10] wed osIT : OVUM, 102 (ponutjuod) ‘7 xipuoddy DIIMIGIS “eA DINSALY SNULY NYSOUOYIS] WINAJSNS1T DIDJa DIDAY pauodol pisauojdasD NBIAQUNY] DIADIISIAg SLUJSAA[AS DidaWYy20g SIJDAJSND SNAOP DIDUadD SN&DI DIMIUIID] SnU A suadad WnOfis] SUDIS SIJDUAID wnuvaloy winipauidy” DAOYIJOWad DAOYdOUepy NMOJIOUL DLBIIUOT DI1JDISD “eA DAANDSAIA OSDP1]OS supaouul xpuvdo1poaq DIDAOPO DinJedsy Didydosajay ‘eA DsOjnpuDnjs sisdojadup wnjidadid wnjcAxoyJuvZ DINDYISJUDY “IEA DIDINILAND D1jDIDD snaiuodofl sajisvjad snjaid xpundojvoy ‘ds wnisuld DINBAD DIPIU1JIV SNIJOfIZAD]DII SNGNY DIDAAAS *} DSOUISNUY] SNUIXDAT DUDAYSIAY VISIWALAY 40j0I1q vzapadsa'T sorseds Mammal Study 24: 103-113 (1999) © the Mammalogical Society of Japan Synaptonemal complex analyses in the XY chromosomes of six taxa of Clethrionomys and Eothenomys from Japan Masahiro A. Iwasa!, Yoshitaka Obara’, Eiji Kitahara> and Yoshiyuki Kimura‘ 1,2Department of Biofunctional Science, Faculty of Agriculture and Life Science, Hirosaki University, Bunkyo-cho, Hirosaki 036-8561, Japan 3Forestry and Forest Products Research Institute, Ibaraki 305-8687, Japan 4Faculty of Education, Fukushima University, Fukushima 960-1296, Japan Abstract. The XY chromosomes of bone marrow metaphases and the XY-synapses of pachytene spermatocytes of six taxa of Clethrionomys and Eothenomys from Japan were examined using C-banding and surface-spreading techniques. Light, and electron, microscopy revealed that in the red-backed vole, the XY size ratios of the metaphase sex chromosomes and the SC-axes of pachytene XY-synapses show a similar pattern of variation. The X chromosomes of these vole taxa were classified, on the basis of their size and morphology, as one of two types, that is they were either acrocentric or sub-telocentric. Similarly, two types of Y chromosome, small and medium, were recorded. According to these criteria, C. rufocanus, C. rutilus and Eothenomys andersoni carry an acrocentric X chromosome and a small Y chromosome, whereas the two local forms of EF. smithii, the so-called “smithii- type” and “kageus-type”, carry a subtelocentric X chromosome and a medium Y chromo- some. In contrast to these XY combinations, E. imaizumii showed a composite combina- tion, with a subtelocentric X chromosome and a small Y chromosome. In view of earlier findings on the genetic background of E. imaizumii (Suzuki 1994; Suzuki et al. 1999), such a composite combination of the sex chromosomes suggests that E. imaizumii may have inherited an X chromosome from a female E. smithii and a Y chromosome from a male E. andersoni during the course of speciation through hybridisation. Key words: red-backed voles, synaptonemal complex, X chromosome, Y chromosome. In general, red-backed voles (Clethrionomys and Eothenomys) are karyologically conserva- tive irrespective of their domestic and continental distribution and show very close karyotypic similarity (Rausch and Rausch 1975; Tsuchiya 1981; Obara and Yoshida 1985; Obara 1986; Modi 1987; Ando et al. 1988; Kashiwabara and Onoyama 1988; Modi and Gamperl 1989; Yoshida et al. 1989; Ando et al. 1991). Both diploid number and autosomal fundamental number were essentially 56 in all of the species examined. Interspecific chromosome varia- tion of these voles is found only in the sex chromosomes (Tsuchiya 1981; Yoshida et al. 1989; 'Present address: Laboratory of Ecology and Genetics, Graduate School of Environmental Earth Science, Hokkaido University, Sapporo 060-0810, Japan To whom correspondence should be addressed: E-mail: yobara@cc.hirosaki-u.ac.jp 104 Mammal Study 24 (1999) Ando et al. 1991; Kitahara and Harada 1996; Iwasa 1998), except for one case of a 1-9 translocation in a lineage containing C. glareolus, C. rutilus, C. gapperi and C. californicus (Gamperl 1982; Modi and Gamperl 1989; Obara et al. 1995). Such interspecific variation of the sex chromosomes is unclear among these voles and the synaptonemal complex (SC) analysis at the electron microscopic level, as well as a detailed chromosome banding analysis at the light microscopic level, may be necessary to clearly define interspecific variations of the sex chromosomes of this group. Suzuki (1994) and Suzuki et al. (1999) found, based on the RFLP (restriction fragment length polymorphism) analysis of the rDNA spacer region, that E. imaizumii carries two types of rDNA in about equal amounts in its genome, one the E. andersoni type and the other the E. smithii type. This mixture indicates that perhaps this species is of hybrid origin involving both E. andersoni and E. smithii. In addition, Kitahara and his colleague examined in detail the taxonomic allocation of three local populations of Anderson’s red- backed voles andersoni, niigatae and imaizumii on the basis of morphological and develop- mental analyses and crossbreeding experiments, and concluded that these three taxa belong to one species E. andersoni, and that “imaizumii’ is phylogenetically closer to E. smithii than it is to C. rufocanus (Kitahara 1995a, 1995b; Kitahara and Kimura 1995). In view of these findings, it would appear that “imaizumii’ is closely related, genetically as well as morpho- logically, to both E. andersoni and E. smithii. In order to test this view from a cytogenetic standpoint, we describe an analysis of X and Y chromosomes in mitotic metaphase and the SC configurations of XY-synapses in meiotic prophase from six taxa of Clethrionomys and Eothenomys from Japan, paying special attention to the XY combination of E. imaizumii. Materials and methods Animals In total, 36 male specimens of two Clethrionomys species, C. rufocanus (Crf) and C. rutilus (Crt), and three Eothenomys species, E. andersoni (Ean), E. smithii and E. imaizumii (Eim) were used in this study. Smith’s red-backed vole, E. smithii, consists of two geo- graphical forms, the “smithii-type” (Esm) distributed west of the Chubu district, and the “kageus-type’ and Ekg), distributed east of the Chubu districts (see Table 1 for a summary of the collecting details). Species were identified on the basis of the salient angle pattern of the third upper molars, following Kaneko (1994). Although Kaneko (1994) and Kitahara and Kimura (1995) regarded Eim and Ean to be conspecific, the “andersoni’ population from the Kii Peninsula has been dealt with here as a distinct species, E. imaizumii, following Jameson (1961), Imaizumi (1988), and the Japanese Environmental Agency (1993). Somatic chromosome analysis Somatic chromosomes were obtained from the bone marrow cells of femurs, using the short-term culture method (Obara 1982). After 30 min colchicine treatment (0.03 ug/ml at the final concentration) in TC199 medium supplemented with 15% calf serum, the cells were incubated in 0.075 M KCI solution at 37°C for 18 min. The cells were spread on glass slides and air-dried under moist conditions after being fixed with Carnoy’s fixative Iwasa et al., XY chromosomes of Clethrionomys and Eothenomys 105 Table 1. Species of Japanese red-backed voles examined in this study. Species Collecting locality Specimen’s No. Clethrionomys rufocanus Oiwake, Hokkaido 94Crf-1; 95Crf-3 Onnetoh, Ashoro, Hokkaido 94Crf-1; 95Crf-1, 2 Clethrionomys rutilus Shunkunitai, Nemuro, Hokkaido 94Crt-1, 2, 6, 9, 14, 15 Bunsen, Rikubetsu, Hokkaido 94Crt-21 Onnetoh, Ashoro, Hokkaido 94Crt-23, 24 Abiragawa, Tomakomai, Hokkaido 95Crt-2, 5 Chitose, Hokkaido 95Crt-4 Eothenomys andersoni Zatoh-ishi, Hirosaki, Aomori Pref. 94Fan-4, 6, 8; 95Ean-1 Tennohzawa, Hirosaki, Aomori Pref. 95Ean-2, 4 Mt. Iwaki, Iwaki, Aomori Pref. 95Ean-3 Eothenomys smithii Kamikumeda, Matsuoka, Fukui Pref. 94Esm-1, 3, 6; 95Esm-5 Matogawa, Matsuoka, Fukui Pref. 94Esm-2 Eiheiji, Eiheiji, Fukui Pref. 95Esm-1 Kotakakura, Ohtama, Fukushima Pref. 94Ekg-4, 5; 95Ekg-1 Eothenomys imaizumii Owase, Mie Pref. 95Eim-1, 2, 3 (methanol : acetic acid=3:1). Air-dried chromosomes were differentially stained for C- banding, following Sumner’s (1972) BSG method. From 15-40 cells from each species of voles were examined, and the relative lengths of their X and Y chromosomes and the XY ratio were analysed. Synaptonemal complex analysis Synaptonemal complex (SC) preparations of the spermatocytes were made from testicular materials taken from adult males following the slightly modified methods of Moses (1977) and Greenbaum et al. (1986). The SC and unsynapsed axes of XY-synapses were stained following Howell and Black’s (1980) one-step method. The silver-stained prepara- tions were observed with transmission electron microscopes (Nippon Denshi JEM-1210 80 kV and Hitachi H-600 75 kV), and photographed in order to measure the actual length of SC plus the unsynapsed axis (SC-axis). Measurement of the length of the XY-synapses were made using the IP Lab Spectrum program (Signal Analytic Corporation) after scanning the SC-axis with an image scanner (EPSON GT-8500). From 12 to 36 SC-axes were studied, and their absolute lengths, mean lengths and standard errors for the full pachytene stages (including early-, mid- and late-pachytene substages; subdivided according to Greenbaum et al. (1986)), were analysed statistically. Results The autosomes of the red-backed voles examined, with the exception of Crt which is characterised by 1-9 translocations (Modi and Gamperl 1989; Obara et al. 1995), showed no interspecific variation in their G-banding pattern, confirming the earlier reports of Obara and Yoshida (1985) Ando et al. (1988), Yoshida et al. (1989), Ando et al. (1991), and Kitahara and Harada (1996). The X chromosomes of these voles were classified as either acrocentric (Crf, Crt and Ean) or subtelocentric (Esm, Ekg and Eim), while the Y chromosomes were defined as 106 Mammal Study 24 (1999) Conv. . XY XY XY XY XY Crf Crt Ean Esm_ Ekg’ Eim Fig. 1. Conventionally-stained (upper) and C-banded (lower) XY chromosomes from the bone marrow metaphases of the red-backed voles examined. Crf=C. rufocanus; Crt=C. rutilus; Ean=E. andersoni; Esm=E. smithii (smithii-type); Ekg=E. smithii (kageus-type); Eim=E. imaizumii. “small” (Crf, Crt, Ean and Eim) or “medium” (Esm and Ekg) (see Fig. 1). The subtelo- centric type X chromosomes were relatively longer than the acrocentric types, and the short arm seemed to be euchromatic on the basis of its negative C-band staining properties (Fig. 1). A deeply stained centromeric C-band was observed in both types. The “small” Y chromo- some, varied in morphology (acro-, submeta- and metacentric) among the various vole species, but had a centromeric C-band in all taxa examined. The remaining interstitial and terminal areas of the “small” Y chromosome were C-stained less darkly than the centromeric C-band. In Crt, the Y chromosome was deeply C-stained along its entire length. The “medium” Y chromosome was subtelocentric, and deeply C-stained from the centromeric to the proximal area (Esm and Ekg) of its long arm. Crf, Crt and Ean carried an acrocentric X chromosome and a small Y chromosome, whereas Esm and Ekg both carried a subtelocentric X chromosome and a medium Y chromosome. Unlike these XY combinations, the sex chromosomes of Eim were composed of a subtelocentric X chromosome and a small Y chromosome. The X chromosome of Eim seemed to be slightly longer in its short arm when compared with that of Esm and Ekg, and was the longest X chromosome among the six vole taxa examined. The Y chromosome of Eim was closer in length to that of Ean than that of Crf and Crt. The mean XY ratios in the bone marrow metaphases of Crf, Crt, Ean, Esm, Ekg and Eim were 0.25, 0.22, 0.27, 0.43, 0.46 and 0.26, respectively. It is unclear whether such variations in the length and ratio of the XY chromosomes are significant since chromosome condensation is variable. Actual measurements of surface-spread XY-synapses in full pachytene may provide more reliable information about chromosomal length. In general, autosomal pachytene SCs are formed along the entire length of the corresponding autosomal homologues. Thus, the length of a given autosomal pachytene SC reflects that of the corresponding autosome in pachytene. However, in a surface-spread XY-synapsis, SC is usually only partially formed, between a small region of the X chromosome and a small region of the Y chromosome, as Iwasa et al., XY chromosomes of Clethrionomys and Eothenomys 107 Fig. 2. C-banded metaphase I plate in a spermatocyte of E. andersoni. Arrow indicates association between centromeric end of the X chromosome and one end of the Y chromosome. Bar=5 wm. suggested from a typical example of a C-banded XY bivalent in the MI stage of Ean (Fig. 2). The remaining unsynapsed areas form rather knobby axes (X- and Y-axes), as in most mammalian species reported so far (Moses 1977; Solari and Rahn 1985; Schmid et al. 1987; Sudman and Greenbaum 1990; Villagomez 1993; Ashley and Fredga 1994; Iwasa and Obara 1995). A full set of SC configurations of a surface-spread pachytene spermatocyte from Ean is shown in Fig. 3a, and typical examples of XY-synapsis in pachytene from the six taxa examined are shown in Fig. 3b-3g. In Esm and Ekg, the Y chromosome synapses with the X chromosome along less than one fifth of its entire length, and forms the SC in the synapsing area, whereas in the remaining four species the SC forms along almost half of the entire length. The long X-axis often turns round, crosses over itself (Fig. 3c, d, f and g), and sometimes forms an end-to-end association with a terminal end of the Y-axis (Fig. 3e). The statistical results of axes measurements are shown in Fig. 4. As in the metaphase chromosomes, the length of the SC-axis of the X chromosome (SC-axis (X)) in the XY- synapsis was distributed in two distinct groups, small and large: 16.07 +0.56 um~17.11+0.78 um (Crf, Crt and Ean) and 18.50+0.55 wm~20.10+0.64 wm (Esm, Ekg and Eim). The SC-axis length of the Y chromosome (SC-axis (Y)) also occurred in small and medium groups: 3.62+0.15 wm~5.13+0.17 wm (Crf, Crt, Ean and Eim) and 7.93 +0.46~9.20+0.86 um (Esm and Ekg). Thus, Crf, Crt and Ean carry small XY chromosomes, whereas Esm and Ekg carry medium or large XY chromosomes. In contrast, the XY-synapsis of Eim was composed of a large X chromosomes and a small Y chromosome. The mean XY ratios of the SC-axis in the pachytene spermatocytes of Crf, Crt, Ean, Esm, Ekg and Eim were 0.31, 0.21, 0.26, 0.43, 0.48 and 0.26, respectively, roughly matching the mean XY ratios in the bone marrow metaphases. 108 Mammal Study 24 (1999) Ne Fig. 3. Electron micrographs of a surface-spread pachytene spermatocyte of E. andersoni (a) and magnified XY configurations (b—g) in the pachytene spermatocytes of the red-backed voles examined. The arrow indicates the XY-synapsis and arrowheads indicate SC regions. X and Y show X- and Y-axes. b=C. rufocanus; c=C. rutilus; d=E. andersoni; e=E. smithii (smithii-type); f=E. smithii (kageus-type); g=E. imaizumii. Bar=2 um. Discussion The mitotic chromosomes of the red-backed voles examined were quite conservative in their autosomes, with the exception of 1-9 translocations in Crt, whereas the sex chromo- somes generally showed interspecific variations in both the size and the morphology of the X and Y chromosomes, as in other species in this group (Rausch and Rausch 1975; Nadler et al. 1976; Modi 1987; Kashiwabara and Onoyama 1988; Modi and Gamperl 1989; Yoshida et al. 1989). In such an autosomally conservative group, the sex chromosome morphology, therefore, is the only marker that distinguishes between the species chromosomally. These findings indicate that the two vole genera, Clethrionomys and Eothenomys, are phylogeneti- cally close to each other. Furthermore, the G-banding patterns of the long arms of the X chromosomes of these voles showed good accordance with each other (Obara 1986; Tsuchiya et al. 1986; Ando et al. 1988; Modi and Gamperl 1989; Yoshida et al. 1989; Obara Iwasa et al., XY chromosomes of Clethrionomys and Eothenomys 109 Esm Eim a a a 2 4 6 8 10 12 14 16 18 20 Length of SC-axis (um) Fig. 4. Actual lengths of SC-axes (X and Y) in the surface-spread pachytene spermatocytes of the red-backed voles examined. Thick and thin lines indicate mean length and standard error, respectively. et al. 1995; Kitahara and Harada 1996), therefore, it is considered that the difference of the X chromosomal morphology among these voles might have arisen as a result of the presence or absence of the short arm. Thus, the morphological differences between the subtelo- and acrocentric X chromosomes seem to have been formed through minor chromosomal rearrangements, such as the addition or deletion of the short arm segment. In this context, Kitahara and Kimura (1995) crossbred Anderson’s red-backed voles (Eim) from the Ki Peninsula with Anderson’s red-backed voles (Ean and E. niigatae; formerly Clethrionomys andersoni and C. niigatae) from Fukushima and Nagano Prefecture, obtaining fertile hybrids in either combination, and concluded, supporting Aimi’s (1980) opinion that Eim, Ean and E. niigatae are all conspecific. Although their crossbreeding experiments were reliable and significant, our chromosome and SC analyses revealed that Eim is apparently different from Ean in the size and morphology of the X chromosome, suggesting no genetic interchange between Eim and Ean. In fact, Eim which inhabits the restricted area of the Kii Peninsula has been geographically isolated from Ean, which ranges from the Chubu to the Tohoku districts. It remains unknown whether Eim and Ean are able to produce fertile hybrids in the wild. In the Chinese hamster Cricetulus griseus, there is a 1:1 relationship between the relative lengths of autosomal SCs and mitotic autosomes. The unpaired X- and Y-axes of pachytene spermatocytes shorten and lengthen, however, not necessarily matching in relative lengths the sex chromosomes of bone marrow metaphases, though the SC portion of XY- Synapsis is constant in length through most of the pachytene (Moses et al. 1977). This phenomenon is believed to be caused by the presence of a high amount of C-heterochromatin contained in the X and Y chromosomes. In all the vole species examined here, the X chromosome had a small amount of C-heterochromatin, which is detected as a centromeric 110 Mammal Study 24 (1999) C-band, and the Y chromosome had a deeply stained centromeric-to-proximal C-band and a Slightly lighter whole arm C-heterochromatin. If this view is correct, the variation in length of the X- and Y-axes of pachytene spermatocytes should be small in vole species, and therefore the XY-ratio of the SC-axis in pachytene should also be close to that of the sex chromosomes during metaphase. This relationship seems to be roughly compatible in all vole taxa examined. Thus, there may be a close relation, at least in the vole species examined, between the XY-ratios in pachytene spermatocytes and those in bone marrow metaphases. Moreover, the XY-synaptic regions of Crf, Crt, Ean and Eim were longer than those of Ekg and Esm (Figs. 3b-g). The differences in the synaptic conditions among these vole taxa may be have arisen naturally at the pairing region of the Y chromosome. Thus, it is considered that the differences in synaptic lengths between X and Y axes among the various combinations of the XY chromosomes (such as acrocentric X-small Y, sub- telocentric X-small Y, and subtelocentric X-medium Y), lead to that synaptic property dependent on the nature of the segment in the synaptic region of the Y chromosomes. Our chromosome and SC analyses clearly demonstrate that three vole species Crf, Crt and Ean have an acrocentric X -small Y combination (a small XY chromosome type) and two geographic forms Esm and Ekg have a subtelocentric X - medium Y combination (a large-medium type of XY) (Figs. 1 and 4). Of significance is the finding that the sex chromosomes of Eim were composed of a subtelocentric type X and a small type Y (a composite type of XY) (Figs. 1 and 4). In the light of these findings, Eim shares the X chromosome with the Esm - Ekg group, yet shares the Y chromosome with the Crf - Crt - Ean group. Therefore, it is tempting to consider that the X chromosome of Eim may have originated from the Esm - Ekg group and the Y chromosome from the Crf - Crt - Ean group. No significant difference in length of the SC-axis (X) was found among Esm, Ekg and Eim, whereas the SC-axis (Y) of Eim was statistically different in length from that of Ean, but not from that of Crf (P<0.05). So, the data from the XY-synapsis may suggest inheritance of the X chromosome from either Esm or Ekg, and the Y chromosome from Crf. However, the latter species has been isolated in Hokkaido, thus having been widely separated from the Kii population, and similarly Ekg is distributed east of the Chubu districts. Taking such geographic distribution into consideration, it is most likely that the X and Y chromosomes of Eim has been inherited, through speciation by hybrid formation, from Esm and Ean, respectively, even though inequality of the SC-axis (Y) between Eim and Ean still leaves much to be explained. Recently, Suzuki (1994) and Suzuki et al. (1999) studied the rDNA of several vole species including Eim by RFLP analysis, and found two types of rDNA, or Ean type and Esm - Ekg type in its genome in equal proportions. Based on their molecular findings they proposed that the ancestral form of Eim (probable Ean-type) had been distributed on the Kii Peninsula and that genetic interchange has occurred recently between Esm- Ekg and the ancestral form. Our evolutionary scenario of Japanese red-backed voles, in particular for Eim, sug- gests that Eim might be derived from hybridization between the ancestors of Ean and Esm on the basis of molecular phylogenetic findings (Suzuki 1994; Suzuki et al. 1999), and present data on the sex chromosome constitution of Eim is well compatible with these molecular viewpoints. Furthermore, the Y chromosomes of Crf, Crt, Ean and Eim are cytogenetically quite similar, on the basis of morphological and differential staining criteria (Tsuchiya 1981; Obara 1986; Tsuchiya et al. 1986; Ando et al. 1988; Yoshida et al. 1989; Obara et al. 1995; Iwasa et al., XY chromosomes of Clethrionomys and Eothenomys 111 Kitahara and Harada 1996) because the Y chromosomes of Ekg and Esm were more differentiated from the cytogenetic aspect in the voles (Yoshida et al. 1989; Hielscher et al. 1992; Iwasa and Tsuchiya unpublished data) including related species. From cytogenetic and other phylogenetic aspects, small Y chromosomes might occur through minor chromosomal rearrangements such as inversion, however, medium Y chromosomes carrying partially heterochromatic segments might be derived from more confused rearrangement than small ones. Further research focussing on the sex chromosome-linked genes such as Sry may provide a way of disclosing this issue. Acknowledgements: The authors wish to express their gratitude to the late Emeritus Professor Dr. K. Saitoh of Hirosaki University, and Dr. H. Suzuki of Hokkaido University, for their advice and expert criticism. We are also grateful to Dr. Oscar G. Ward, Associate Professor Emeritus of the University of Arizona, for reading and refining the original manuscript and for his expert criticism. We thank Dr. M. Brazil for improving the English manuscript. Special thanks are also due to Dr. K. Nakata of Hokkaido Forestry Research Institute, Dr. N. Takada of Fukui Medical College, Messrs. K. Saigusa, R. Hatano, S. Kawada, T. Yoshida, R. Yamamoto and F. Ishiguro, and Miss H. Shichiri for their kind co-operation in collecting the vole specimens. References Aimi, M. 1980. A revised classification of the Japanese red-backed voles. Memoirs of the Faculty of Science, Kyoto University, Series of Biology 8: 35-84. Ando, A., Shiraishi, S., Harada, M. and Uchida, T. A. 1988. A karyological study of two intraspecific taxa in Japanese Eothenomys (Mammalia: Rodentia). Journal of the Mammalogical Society of Japan 13: 93-104. Ando, A., Harada, M., Shiraishi, S. and Uchida, T. A. 1991. Variation of the X chromosome in the Smith’s red- backed vole Eothenomys smithii. Journal of the Mammalogical Society of Japan 15: 83-90. Ashley, T. and Fredga, K. 1994. The curious normality of the synaptic association between the sex chromosomes of two arvicoline rodents: Microtus oeconomus and Clethrionomys glareolus. Hereditas 120: 105-111. Gamperl, R. 1982. Chromosomal evolution in the genus Clethrionomys. Genetica 57: 193-197. Greenbaum, I. F., Hale, D. W. and Fuxa, K. P. 1986. The mechanism of autosomal synapsis and the substaging of zygonema and pachynema from deer mouse spermatocytes. Chromosoma 93: 203-212. Hielscher, K., Stubbe, A., Zernahle, K. and Samjaa, R. 1992. Karyotypes and systematics of Asian high-mountain voles, genus Alticola (Rodentia, Arvicolinae). Cytogenetics and Cell Genetics 59: 307-310. Howell, W. M. and Black, D. A. 1980. Controlled silver-staining of nucleolus organizer regions with a protective colloidal developer: a 1-step method. Experientia 36: 1014-1015. Imaizumi, Y. 1988. A World List of Mammals with Japanese Names. 980 pp., Heibonsha, Tokyo (in Japanese). Iwasa, M. A. 1998. Chromosomal and molecular variations in red-backed voles. Honyurui Kagaku [Mammalian Science] 38: 145-158 (in Japanese with English abstract). Iwasa, M. and Obara, Y. 1995. Presence of XY-synapsis in the Japanese grass vole, Microtus montebelli (Rodentia; Microtinae). Chromosome Information Service 59: 21-23. Jameson, E. W. Jr. 1961. Relationships of the red-backed voles of Japan. Pacific Science 15: 594-604. Japanese Environmental Agency. 1993. A list of Japanese wild animals: Vertebrates. Japan Wildlife Research Center, Tokyo, Japan (in Japanese). Kaneko, Y. 1994. Muridae. In A Pictorial Guide to the Mammals of Japan (H. Abe ed.). Pp. 90-109 and 168-183. Tokai Univ. Press, Tokyo (in Japanese). Kashiwabara, S. and Onoyama, K. 1988. Karyotypes and G-banding patterns of the red-backed voles, Clethrionomys montanus and C. rufocanus bedfordiae (Rodentia, Microtinae). Journal of the Mammalogical Society of Japan 13: 33-41. 112 Mammal Study 24 (1999) Kitahara, E. 1995a. Taxonomic status of Anderson’s red-backed vole on the Kii Peninsula, Japan, based on skull and dental characters. Journal of the Mammalogical Society of Japan 20: 9-28. Kitahara, E. 1995b. Growth and development of captive Anderson’s red-backed voles from the Kii Peninsula. Journal of the Mammalogical Society of Japan 20: 29-42. Kitahara, E. and Harada, M. 1996. Karyological identity of Anderson’s red-backed voles from the Kii peninsula and central Honshu in Japan. Bulletin of the Forestry and Forest Products Research Institute No. 370: 21-30. Kitahara, E. and Kimura, Y. 1995. Taxonomic reexamination among three local populations of Anderson’s red- backed voles from crossbreeding experiments. Journal of the Mammalogical Society of Japan 20: 43-49. Modi, W.S. 1987. Phylogenetic analyses of chromosomal banding patterns among the Nearctic Arvicolidae (Mammalia: Rodentia). Systematic Zoology 36: 109-136. Modi, W.S. and Gamperl, R. 1989. Chromosomal banding comparisons among American and European red- backed mice, genus Clethrionomys. Zeitschrift fir Saugetierkunde 54: 141-152. Moses, M. J. 1977. Synaptonemal complex karyotyping in spermatocytes of the Chinese hamster (Cricetulus griseus). 1. Morphology of the autosomal complement in spread preparartions. Chromosoma 60: 99-125. Moses, M. J., Slatton, G. H., Gambling, T. M. and Starmer, C. F. 1977. Synaptonemal complex karyotyping in spermatocytes of the Chinese hamster (Cricetulus griseus). III. Quantitative evaluation. Chromosoma 60: 345— 315). Nadler, C. F., Rausch, V.R., Lyapunova, E. A., Hoffmann, R.S. and Vorontsov, N.N. 1976. Chromosome banding patterns of the Holarctic rodents, Clethrionomys rutilus and Microtus oeconomus. Zeitschrift ftir Sdugetierkunde 41: 137-146. Obara, Y. 1982. Comparative analysis of karyotypes in the Japanese mustelids, Mustela nivalis namiyei and M. erminea nippon. Journal of the Mammalogical Society of Japan 9: 59-69. Obara, Y. 1986. G-band homology between the Japanese red-backed vole, Clethrionomys a. andersoni and the gray red-backed vole, C. rufocanus. Chromosome Information Service 40: 7-9. Obara, Y. and Yoshida, I. 1985. A case of X-autosome translocation in the Japanese red-backed vole, Clethrionomys andersoni andersoni. Chromosome Information Service 39: 3-5. Obara, Y., Kusakabe, H., Miyakoshi, K. and Kawada, S. 1995. Revised karyotypes of the Japanese northern red- backed vole, Clethrionomys rutilus mikado. Journal of the Mammalogical Society of Japan 20: 125-133. Rausch, R. L. and Rausch, V. R. 1975. Relationships of the red-backed vole, Clethrionomys rutilus (PALLAS), in North America: Karyotypes of the subspecies dawsoni and albiventer. Systematic Zoology 24: 163-170. Schmid, M., Johannison, R., Haaf, T. and Neitzel, H. 1987. The chromosomes of Micromys minutus (Rodentia, Murinae). II. Pairing pattern of X and Y chromosomes in meiotic prophase. Cytogenetics and Cell Genetics 45: 121-131. Solari, A. J. and Rahn, M.I. 1985. Asymmetry and resolution of the synaptonemal complex in the XY pair of Chinchilla laniger. Genetica 67: 63-71. Sudman, P. D. and Greenbaum, I. F. 1990. Unequal crossing over and heterochromatin exchange in the X-Y bivalents of the deer mouse, Peromyscus beatae. Chromosoma 99: 183-189. Sumner, A. T. 1972. A simple technique for demonstrating centromeric heterochromatin. Experimental Cell Research 75: 304-306. Suzuki, H. 1994. Genetic diversity of ribosomal DNA: phylogenetic analysis of small mammals. Honyurui Kagaku [Mammalian Science] 34: 67—79 (in Japanese with English abstract). Suzuki, H., Iwasa, M., Harada, M., Wakana, S., Sakaizumi, M., Han, S.H., Kitahara, E., Kimura, Y., Kartavtseva, I. and Tsuchiya, K. 1999. Molecular phylogeny of red-backed voles in Far East Asia based on variation in ribosomal and mitochondrial DNA. Journal of Mammalogy 80: 512-521. Tsuchiya, K. 1981. On the chromosome variations in Japanese cricetid and murid rodents. Honyurui Kagaku [Mammalian Science] 42: 51-58 (in Japanese). Tsuchiya, K., Kimura, Y. and Minato, S. 1986. Comparison of cytogenetics in Japanese red-backed voles. In Conservation and Rehabitation of Oze. Pp. 97-42. Fukushima Prefectural Project Report on the Conservation of Special Plant Species and Their Habitats, Fukushima Prefecture (in Japanese). Villagomez, D.A.F. 1993. Zygotene-pachytene substaging and synaptonemal complex karyotyping of boar spermatocytes. Hereditas 118: 87-99. Iwasa et al., XY chromosomes of Clethrionomys and Eothenomys 113 Yoshida, I., Obara, Y. and Matsuoka, N. 1989. Phylogenetic relationships among seven taxa of the Japanese microtine voles revealed by karyological and biochemical techniques. Zoological Science 6: 409-420. Received 30 June 1999. Accepted 5 November 1999. Mammal Study 24: 115-119 (1999) © the Mammalogical Society of Japan Short communication A record of the food retention time of the Asiatic elephant, Elephas maximus Udayani R. Weerasinghe!, Palitha Jayasekara” and Seiki Takatsuki> 1Laboratory of Wildlife Biology, School of Agriculture and Life Sciences, The University of Tokyo, Yayoi, Bunkyo-ku, 113-0032 Tokyo, Japan 2.3The University Museum, The University of Tokyo, Hongo 7-3-1, Bunkyo-ku, 113-0033 Tokyo, Japan We carried out a brief feeding experiment in order to measure the food retention time of the Asiatic elephant, Elephas maximus. For the experiment, a tame individual of the endemic Sri Lankan subspecies, E. m. maximus, was used. Compared with the African elephant, Loxodonta africana, the biology of the Asiatic elephant is poorly known, although there have been classic studies on its physiology (Benedict 1936) and ecology (Sukumar 1989). Because of economic development, the Sri Lankan elephant, whose present population is estimated to be 3,000 or 4,000 (Santiapillai and Jackson 1990; Jayewardene 1994), is confined in small areas. Because of their large body size, they sometimes heavily affect the vegetation of their habitat. For the better management of the elephants and their habitat, therefore, an understanding of the food-related biology of the Asiatic elephant is important. Food retention time has been studied in both African (Bax and Sheldrick 1963; Rees 1982) and Asiatic elephants (Benedict 1936). However, previous studies have only shown the elapsed time after intake to the first and last excretion of markers in the dung. During the present study, based on the exact excretion pattern of two types of markers, we were able to measure the elapsed time from the first intake to the first excretion, the time to peak of excretion, the time to last excretion, and the mean retention time. Materials and methods A 48-year-old tame male elephant was used for the feeding experiment. Based on the correlation between shoulder height and body weight of the Asiatic elephant (McKay 1973), this individual, which stood 265 cm high at the shoulder, was estimated to weigh 3.8 tons. The elephant was kept outside, and chained by his hind foot to a tree. Nearby ground- covering vegetation was cleared away and known amounts of forage were given as food. He was walked once a day to a pond, where he was able to drink water and bathe. Benedict (1936) and Vancuylenberg (1977) both reported that an Asiatic elephant eats about 150 kg of foods per day. On this basis, during the course of our experiment, from 19th to 26th May 1998, the tame elephant was fed 300 kg of fresh food at 15:00 everyday, which should have been more than sufficient for its needs. This consisted of 150 kg of leaves and twigs of Jak, Artocarpus heterophyllus; 100 kg of palm woods, Caryota urens; and 50 kg of grasses, mainly Panicum maximum. On the second day of the experiment, a piece of bread, inside which 1,000 plastic beads were hidden, was added to the daily ration. The 3To whom correspondence should be addressed. E-mail: taka@um.u-tokyo.ac.jp 116 Mammal Study 24 (1999) beads were about 2mm in diameter and 3mm long. On the third day, five melons were given as supplemental food as these contain many seeds. The melon seeds were flat and spindle-shaped, measuring 4mm in width, 6mm long and 1 mm thick. All of the elephant’s dung was collected at 08:00, 12:00 and 18:00. Each dropping was weighed to the nearest gram using a kitchen balance. In addition, dung was collected as frequently as possible, whenever the elephant was observed defecating. We sampled the collected dung, breaking the droppings in order to count the number of seeds and beads they contained. As most of the beads were found to have been completely or partly destroyed, presumably by mastication, we counted only beads which maintained more than half of their Original size, and ignored smaller portions. The weight contribution of the dung samples to the total dung was 43.5%. After the peaks of the appearance of the two kinds of markers, we extended the interval of fecal collection. As the intervals between dung collection were not constant, but longest during the night, seed and bead numbers recovered from the sample dung were converted to a total number according to dry weight, and then divided by the time interval (hr) of collection. We assumed that the density of markers in dung during each interval was constant. The mean retention time (WRT) was calculated by the formulae: MRT=>(Mx T)/=M Where 7 is the length of time between dosing and excretion in the feces, and M is the total amount of marker in that collection (Coombe and Kay 1965). Results The process of excretion of the dietary markers was expressed as a percentage of the number of markers recovered at collections to the total number voided. Melon seeds first appeared 14 hrs after ingestion, and quickly increased to reach a sharp peak (40.1% of the total number of excreted seeds) at 18 hrs after ingestion (Fig. 1). The seed numbers then decreased to 11.0%, and thereafter it gradually decreased until 48 hrs after dosing. The last seed was found 72 hrs after ingestion, though the single seed was found from over 5 kg of dung. The pattern of the passage of beads was similar to that of passing melon seeds. The beads first appeared in dung 17 hrs after ingestion, and rapidly increased to reach a peak at 25 hrs after ingestion. The peak, however, was not as sharp as found for melon seeds, and the decrease following the peak was also more gradual (Fig. 1). The continuous voiding of the beads continued up to 63 hrs after ingestion. Thereafter, no beads appeared for a while, but then one bead appeared at 73 hrs after dosing when we ended the collection. The mean retention time was calculated as 20.2 hrs for melon seeds and 29.7 hrs for beads. A total of 311 beads were recovered. From the total weight of dung voided, it was estimated that 714.9 beads (71.5%) appeared during the experiment, indicating that 28.5% were destroyed during the digestion process, probably mainly during mastication. Weerasinghe et al., Food retention time of elephant Ty 45 40 35 Fe © Melon seeds 4 ii e@ Beads 25 og 20 1.) Number (%) / hr Hours after ingestion Fig. 1. Numbers of beads and melon seeds recovered from dung of an Asiatic elephant after ingestion. The numbers are percentages of the total numbers recovered. Discussion Description of the experiment As soon as food was provided at 15:00 each day, the elephant began to eat, and clearly preferred the marker foods (the bread containing the beads, and the melons). During the first hour he ate great amounts of food, and thereafter fed at a more leisurely pace throughout the night (Somaratna personal communication). We did not see him eating in the mornings when we resumed dung collection at 08:00, which suggests that he was satisfied after feeding during the night. The average fresh weight (SD) of his daily intake was 123.8 (427.5) kg (Weerasinghe et al. unpubl.), which was similar to the amounts described in previous studies (McKay 1973; Vancuylenberg 1977). Markers It is known that retention times are different among different foods (Rees 1982). In this study, the bead markers appeared, and peaked, later than the melon seeds. The markers differed in two ways. They differed firstly in their quality. Since the beads were made from plastic, they were non-digestible despite having been heavily masticated and broken into smaller pieces, and this may have contributed to them being passed more slowly than the melon seeds. However, since we did not count the number of melon seeds in advance of the feeding experiment, the differences in the digestibility between the two markers is not known. Secondly, the difference in size and shape of the markers may have also affected their passage. The flatter shape of the melon seeds, together with the jelly-like attachment around them, may have facilitated their rapid passage, despite the fact that they were slightly larger than the beads. Relative weight may also affect passage rates. It seems possible that, because of their small size, if they were light, they would be passed to the 118 Mammal Study 24 (1999) lower tracts with liquids faster than fibrous plant materials. However, we did not measure the relative weights of the two markers. Pattern of passage Previous studies of through-put times for elephants have concentrated simply on show- ing the first and the last appearance of dietary markers (Benedict 1936; Bax and Sheldrick 1963; Rees 1982). Benedict (1936) fed rubber pieces to an Asiatic elephant and determined that the first and the last appearances were about 24 and 51 hrs after ingestion, respectively. Bax and Sheldrick (1963) briefly mentioned that an African elephant excreted orange seeds between 11 and 14 hrs after feeding and continued to produce them up to 19 hrs later. Rees (1982) fed beetroot to an African elephant and found that passage took between 21 and 46 hrs. This study then, is the first that has examined the patterns of excretion of dietary markers. The peaks of passage occurred between 17 and 25 hrs after ingestion. The retention time of the Asiatic elephant seems to be shorter than ruminants, when taking in to account their body size. The mean retention times of ungulates, which are much smaller than elephants, were 15-30 hrs for sheep, Ovis aries (Coombe and Kay 1965), 20-40 hrs for the white-tailed deer, Odocoileus virginianus (Mautz 1971), 35-45 hrs for the goat, Capra hircus (Castle 1956), and 70-90 hrs for cattle, Bos taurus (Balch 1950). Retention time, or the rate of passage of food through the digestive tract, can be expected to depend on the length of the digestive tract, and as ruminants have very long intestines, it is not surprising, therefore, that their retention times are very long for their body sizes. Unfor- tunately, no information is available on the length of the digestive tract of elephants. The short retention time of the Asiatic elephant may result from it having a simple stomach, and short intestines (Clements and Maloiy 1982). This simple digestive system seems to enable the ingesta to pass through the tracts rapidly, though the African elephant at least has a well-developed colon and caecum (Clements and Maloiy 1982). In contrast, ruminants have complex stomachs where the ingesta are retained and fermented, and hence food is passed very slowly through the alimentary canal. Acknowledgements: We greatly appreciate the assistance of Mr. Samantha Ariyasinghe, the owner of the elephant named Bande, in providing us with a chance to study Bande. Mr. Somaratna, Bande’s mahout, contributed valuable information on elephant behavior, and Mr. Shantha assisted us in collecting the droppings during our absences from the study site. We deeply appreciate Dr. M. Brazil who kindly read and improved our earlier draft. This study was partly supported by the Pro-Natura Foundation of the Nature Conservation Society of Japan. References Balch, C. C. 1950. Factors affecting the utilization of food by dairy cows, 1. The rate of passage of food through the digestive tract. British Journal of Nutrition 4: 361-388. Bax, N. P. and Sheldrick, D. L. W. 1963. Some preliminary observation on the food of elephants in the Tsavo Royal National Park (East) of Kenya. East African Wildlife Journal 1: 40-53. Benedict, F. G. 1936. The Physiology of the Elephant. Publ. No. 474, Carnegie Institute, Washington, 302 pp. Castle, E. J. 1956. The rate of passage of food stuffs through the alimentary tract of the goat, I. Studies on adult Weerasinghe et al., Food retention time of elephant 119 animals fed on hay and concentrates. British Journal of Nutrition 10: 15-23. Clements, E.T. and Maloiy, G.M.O. 1982. The digestive physiology of three East African herbivores: the elephant, rhinoceros and hippopotamus. Journal of Zoology, London 198: 141-156. Coombe, J. B. and Kay, R.N. B. 1965. Passage of digesta through the intestines of the sheep, retention times in the small and large intestines. British Journal of Nutrition 19: 325-338. Jayewardene, J. 1994. The Elephant in Sri Lanka. Colombo, 128 pp. McKay, G. M. 1973. Behavior and ecology of the Asiatic elephant in southeastern Ceylon. Smithsonian Contribu- tions to Zoology 125: 1-113. Mautz, W. W. 1971. Comparison of the *!CrCl,; ratio and total collection techniques in digestibility studies with a wild ruminant, white-tailed deer. Journal of Animal Science 32: 999-1002. Rees, P. A. 1982. Gross assimilation efficiency and food passage time in the African elephant. African Journal of Ecology 20: 193-198. Santiapillai, C. and Jackson, P. 1990. The Asian Elephant: An Action Plan for Its Conservation. IUCN. (cited in Jayewardene 1994) Sukumar, R. 1989. The Asian Elephant — ecology and management. Cambridge University Press, Cambridge, 251 pp. Vancuylenberg, B. W. B. 1977. Feeding behaviour of the Asiatic elephant in south-east Sri Lanka in relation to conservation. Biological Conservation 12: 33-54. Received 12 April 1999. Accepted 3 September 1999. enti? rinse ; a f reine Seral ue ne) Mammal Study 24: 121-124 (1999) © the Mammalogical Society of Japan Short communication Seasonal change in reproductive states of the Formosan squirrel on Izu-Oshima Island, Japan Noriko Tamura! Tama Forest Science Garden, Forestry and Forest Products Research Institute, Todori 1833, Hachioji, Tokyo 193-0843, Japan. The Formosan squirrel, Callosciurus erythraeus thaiwanensis, was introduced to Japan and now occurs in several areas of the country (Yamaguchi 1988; Kawamichi 1997). The breed- ing season of this species has been investigated in Taiwan, ROC, where it is indigenous. There, dissection of 100 females revealed that although they reproduce throughout the year there are two peaks, from January to March, and again from May to August (T’sui et al. 1982). In Kamakura, Japan, where the same species has been introduced, mating behavior has been observed throughout the year, but with two peaks, the first during March and April and the second from July to September (Tamura et al. 1988). In captivity, the gestation period of the Formosan squirrel is 47-49 days, and the young squirrels leave the nest 40-50 days after birth (Tamura and Terauchi 1994). On the basis of these captive studies, weaned juveniles can be expected to appear in the wild during July and August, and during the period from November to January. This expectation is borne out, with juveniles weighing less than 200 g (just after weaning) being captured in live-traps most frequently during these months (Tamura 1989). Formosan squirrels have also been introduced to Izu-Oshima (3445'N, 139°22’E), an island of approximately 9,100 ha south of Tokyo. Since their introduction there ca. 60 years ago they have increased rapidly and spread all over the island with the exception of the unvegetated volcanic areas. Because the squirrels feed on Camellia seeds and other agri- cultural products on the island, they are considered a pest and several hundreds individuals have been killed each year since 1970. The reproductive strategy of Formosan squirrels on Izu-Oshima has not previously been studied, so here I will present data on the breeding cycle of this species on this island, which may prove helpful in controlling the population. Methods Squirrels shot as pests during the period from November 1996 to February 1997, from May to October 1997, from February to April 1998, and from October to November 1998 were examined for this study. The squirrels had been shot at sites scattered across the island, with the exception of the area around the crater of Mt. Mihara in the center of the island, and the volcanic eastern part of the island. All specimens were sexed and weighed immediately after shooting, then frozen and transported to the laboratory for analysis. After subsequent thawing of the specimens, the snout-vent length of all females was ‘E-mail: haya@ffpri.afjrc.go.jp 122 Mammal Study 24 (1999) measured, and the condition of the teats and vaginal opening were recorded. The teats were defined as either projecting or not projecting, and used as an indication of whether females were lactating or not. The stage of estrous was assessed on the basis of the color of the vaginal opening. During the period 5-7 days before copulation the vaginal opening became pink and swollen whereas most of the time it was small, inconspicuous, and gray in color. More detailed analysis was made of the ovaries and uterine horns after they had been dissected out. Ovaries were sectioned longitudinally and the stage of developmental of the follicles was observed under a binocular microscope (x 80). Four stages of sexual maturity were recorded using T’sui et al.’s (1982) criteria. These were: 1) mature (ovary with Graafian follicles, and with projecting teats); 2) young mature (ovary with Graafian follicles, but non-projecting teats); 3) subadult (ovary with several secondary solid follicles and a few secondary vesicular follicles), and 4) immature (ovary with only primary follicles). The number of fetuses found in the uterine horns was also recorded. Results and discussion Of the total of 190 females, 132 with projecting teats, indicating that they had ex- perienced lactation, were defined as mature. The mean body weight of mature females was 376.5 g+29.6 (SD); range 320-440 g, n=132). The mean snout-vent length of the same females was 21.06 cm=+0.88 (SD); range: 19.5-23.3 cm, n=132). Forty-three of the mature females were carrying fetuses in their uterine horns. The remaining 58 females examined had non-projecting teats, however, one of them had fetuses in the uterus, and 10 of them had swollen vaginae, indicating that they were in heat. As these 11 individuals all had Graafian follicles in their ovaries, they were defined as young mature females. The mean body weight (+ SD) of these young mature females was 318.3 g+36.2 (range: 280-390 g, n=11), and their snout-vent length averaged 20.7 cm=+0.7 (range: 19.5-21.5 cm, n=11). Seven females with non-projecting teats and vesicular follicles in their ovaries were defined as subadults. They averaged 325.0g+22.9 (SD) (range: 300-360 g, n=7) and measured 20.4 cm=+0.8 (SD) (range: 19.0-22.0 cm, n=7) from snout to vent. The remaining 40 females with non-projecting teats, had no vesicular follicles in their ovaries, so they were defined as immature. The mean body weight (+ SD) of these immature Table 1. The reproductive state of female squirrels each month. Numerals in parentheses indicate the number of females in estrous. Reproductive States Jan. Feb. Mar. Apr. May Jun. “Jul: Aus. “Sept Oct aNows = Dee: Mature 4 De 9 Vf 4 2) 7 19 8 11 10 9 (0) (3) (0) (0) (0) (6) (3) (1) (1) (1) (0) (3) Young mature 0 0 1 1 1 4 2, 0 0 1 1 0 (0) (0) (1) (1) (1) (3) (2) (0) (0) (0) (1) (0) Subadult 0 0 0 0 0 0 0 1 0 1 3 2 Immature 4 2 4 4 3 5 3 6 1 2 4 2 Total 8 24 14 12 8 3) 12 26 9 13) 18 13 Tamura, Breeding season of the Formosan squirrel 123 10 60 1996 m 1997 % pregnant Jan. eld, Juee, LN ores May Jun. Jul Aue Sep. Oct. 1 DECK Month Fig. 1. Seasonal changes in the percentage of pregnant females. Numerals above bars indicate sample sizes. females was 298.8 g+ 42.2 g (range: 195-350 g, n=40), and they averaged 19.9 cm+1.3 (SD) (range: 17.0-22.0 cm, n=40) from snout to vent. There were no apparent seasonal changes in the proportion of squirrels in each of the four reproductive states (Table 1). The proportion of immature females in relation to the total number of females caught each month, showed no seasonal trend, and ranged from 8% to 50% with a mean of 23.6%. This proportion was similar to that found in Taiwan (20.5%; T’sui et al. 1982). Although the sample size was small, females in estrous were captured more frequently during February, June and July than in other months (Table 1). A total of 44 females was found with pregnancies recorded in every month except December. The pregnancy rate was highest during March to April and again from July to October (Fig. 1). These seasonal trends in pregnancy rates were coincident with the number of estrous females. The seasonal changes in the pregnancy rates observed on Izu-Oshima were similar to those in Kamakura, Kanagawa Prefecture (Tamura 1989; estimated from the dates litters were weaned). In Taiwan, however, pregnancies peaked during the period from January to March, and also from May to August, two months earlier than on Izu-Oshima and in Kamakura (T’sui et al. 1982). Although the number of fetuses recorded ranged from one to four with a mean of Table 2. The number of fetuses observed among 44 pregnant females. No. fetuses 1 D, 3 4 Total No. females 4 23 15 y 44 124 Mammal Study 24 (1999) 2.4+0.7 (SD) (see Table 2), the number of weaned juveniles observed in Kamakura, Japan, was one or two with a mean of 1.30.5 (SD; n=47), and in Kenting, Taiwan, the number of weaned juveniles was 1.1+0.3 (SD; n=29) (Tamura 1989). In neither Kamakura nor Kenting did I observe females accompanied by more than two weaned juveniles, indicating that not all neonates survive to be weaned. Acknowledgements: I thank Mr. S. Suganuma and Mr. K. Doi in the Oshima Government Office for their help in collecting samples, and Dr. Mark A. Brazil for kind revision of the manuscript. References Kawamichi, T. (ed.) 1997. Red List of Japanese Mammals by the Red Data Committee of the Mammalogical Society of Japan. Bunichisougou-shuppan, Tokyo, 279 pp. (in Japanese). Tamura, N., Hayashi, F. and Miyashita, K. 1988. Dominance hierarchy and mating behavior of the Formosan squirrel, Callosciurus erythraeus thaiwanensis. Journal of Mammalogy 69: 320-331. Tamura, N. 1989. Sociobiological studies on the Formosan squirrel, Callosciurus erythraeus thaiwanensis (Bonhote). Ph.D. thesis, Tokyo Metropolitan University, Tokyo, 138 pp. Tamura, N. and Terauchi, M. 1994. Variation in body weight among three populations of the Formosan squirrel, Callosciurus erythraeus thaiwanensis. Journal of Mammalogical Society of Japan 19: 101-111. T’sui, W.H., Lin, F. Y. and Huang, C.C. 1982. The reproductive biology of the red-bellied tree squirrel, Callosciurus erythraeus, at Ping-Lin, Taipei Hsien. Proceedings of National Science of Council, Sec. B, ROC. 6 (4): 443-451. Yamaguchi, Y. 1988. Formosan squirrels and Siberian chipmunks. In (Museum of Kanagawa Prefecture ed.) Introduced Animals in Japan. Pp. 52-54. Nogeinsatu-sha, Kanagawa (in Japanese). Received 3 August 1999. Accepted 12 October 1999. ACTA THERI OLOGICA Auctore Augusto Dehnel condita Founded by August Dehnel in 1954 is an international journal of mammalogy, covering all aspects of mammalian biology. It publishes original research reports, short communications (Fragmenta Theriologica), and book reviews. The journal also includes review papers. Editor-in-Chief: Zdzistaw PUCEK Assistant Editors: Anna M. WOJCIK, Jan M. WOJCIK Current Editorial Board: Roman Andrzejewski (Warszawa), Wiestaw Bogdanowicz (Warszawa), Gilbert L. Dryden (Ashland), Jifi Gaisler (Brno), Joanna Gliwicz (Warszawa), Ilkka Hanski (Helsinki), Lennart Hansson (Uppsala), Kazimierz Kowalski (Krakéw), William Z. Lidicker (Berkeley), Sandro Lovari (Sienna), Brian K. McNab (Gainesville), Gerhard Storch (Frankfurt am Main), Peter Vogel (Lausanne), Nikolay N. Vorontsov (Moscow), January Weiner (Krakéw). e Among subjects included are ecology, behaviour, bioenergetics, morphology, development, reproduction, nutrition, paleontology and evolution of mammals. Papers demonstrating a comparative perspective in anatomy and physiology of mammals are also welcomed. Papers represent mammalogical research in over 40 countries, including Eastern Europe and the Commonwealth of Independent States. Published now quarterly, in English. Exchanged or subscribed in 63 countries. Indexed in: Biological Abstracts, Elsevier BIOBASE/Current Awareness in Biological Sciences, Current Contents A, B & ES, Ecological Abstracts, Polish Scientific Journals Contents—Agric. & Biol. Sci., Referativnyi Zhurnal, Science Citation Index, Wildlife Review, Zoological Record. Edited since 1958, and now also published by the Mammal Research Institute, Polish Academy of Sciences, Biatowieza, Poland. Special emphasis is payed on a series of papers e Bisoniana — over 110 papers devoted to anatomy, physiology, ecology, behaviour, of the European bison and its hybrids with domestic cattle. e Studies on the European hare — over 50 papers have been published on hare morphology, reproduction, and different aspects of population ecology. e@ Monothematic issues or supplements — Ecology of the bank vole (1983), Ecological genetics in mammals I (1993), II (1995), III (1998), Developmental homeostasis in natural populations of mammals: phenetic approach (1997). More information are available on Internet: http://bison.zbs.bialowieza.pl/acta/acta.html Manuscripts for consideration should be sent to: The Editor, Acta Theriologica, c/o Mammal Research Institute, Polish Academy of Sciences, 17-230 Biatowieza, Poland e@ Manuscripts are peer-reviewed @ No page charges e Fifty reprints free of charge Subscribe today or request a free sample copy by filling in the order form Subscription rates: Institutions 102.00 USD per volume, Individuals 68.00 per volume Postage included. Full air mail delivery (on request) is possible. Back issues are available. ORDER FORM for PERSONAL/INSTITUTIONAL SUBSCRIPTION Please tick appropriate box and send an order card to: Polish Academy of Sciences, Mammal Research Institute, 17-230 Bialowieza, Poland, e-mail: acta@bison.zbs.bialowieza.pl LJ Please enter my subscription, beginning with: Volume 42/1997, Volume 43/1998, Volume 44/1999 L} Please accept my cheque for CL} Please send me a sample copy. UI Please send me instructions for contributors. EVOLUTION OF SHREWS Edited by JM. WOJCIK and M. WOLSAN In spite of an apparent recent increase of interest in shrews (Soricidae) and an impressive bibliogra- phy on the evolution of this fascinating group of mammals, until now there has been no compre- hensive work that deals with current problems in shrew evolutionary research. This book represents an attempt to redress this omission, by offering a volume that seeks to review the present state of our knowledge of shrew evolutionary biology. CONTENTS: Introduction; A Classification of the fossil and Recent shrews; Fossil history of shrews in Europe; Fossil history of shrews in Asia; Fossil history of shrews in Africa; Fossil history of shrews in North America; Dental adaptations in shrews; Chromosomal evolution in shrews; Chromosomal evolution: the case of Sorex araneus; Protein evolution in shrews; Mitochondrial DNA evolution in shrews; Evolution of energetic strategies in shrews; Evolution of social systems in shrews; Shrew mating systems; Appendix: A list of the living species of shrews; Taxonomic index. Published by Mammal Research Institute, Polish Academy of Sciences Date of publication: May 1998 Number of pages: xii + 458 ISBN 83-90752 1-0-7 Cover: hardback Price: 38 USD + postage To order and for further information please contact: Library, Mammal Research Institute, Polish Academy of Sciences, 17-230 Biatowieza, Poland; Tel./Fax (+48) 85 6812289 E-mail: evolbook @ bison.zbs.bialowieza.pl To order by Internet see: http://bison.zbs.bialowieza.pl/evol/evol.htm ORDER FORM Please fill in this order card and send it to the above address. O Yes, | would like to order... copy/ies of Evolution of Shrews EY Please Dill’ me/IMy IMSUMUTION -....cc. cc cecccscseeccccesssceconscecceteteersebcteereceesesdessacesrveieete eugene oy ones err Name CFE a 1 ES ae oe Eee oe aon ad suas caacudcoonoa desc ocooaccucacnacsoccotoae PROGRESS: ccc ee ON i es Instructions to contributors Mammal Study publishes original Articles, Short Communications and Reviews, written in English, on all aspects of mammalogy. In principle, membership of the Society is pre- requisite for the submission of papers except for invited papers, but non-members may be co-authors. Manuscripts are submitted to qualified referees for critical scientific reviewing. Authors are notified, with referees’ comments, on acceptance, rejection or need for revision within three months. The editor also customarily sends accepted manuscripts to qualified reviewers for English editing. Manuscripts should be submitted typewritten on one side of the paper (use A4 21.0 x 29.7 cm paper), and double-spaced. An approximately 3 cm margin should be left on all sides. Do not hyphenate words at the right margin. Manuscripts should be arranged in the following order: the title, name(s) of author(s) and affiliation, fax number and E-mail address, abstract (fewer than 200 words) and key words (five words or fewer), main text, acknowledgments, references, tables, figure legends, figures. Titles of papers must be ac- curate and concise, and (for abstraction services) include any relevant taxonomic name. Text pages should be numbered through from title to references. Manuscripts should be line-numbered, every five lines, in the left margin. Short Communications do not exceed four printed pages. Abstracts and key words are omitted from Short Communications. Tables and figures should be simple and self-explanatory, and their preferred locations should be indicated in the right margin of the text. The author’s name and figure numbers should be written on the back of original figures and on the surface of copies. Scientific names should be written in italic. All measurements should be in metric units. The following abbreviations should be used. Length: km, m, cm, mm, etc.; area: km?, m2, etc.; volume: km?, m?, kl, 1, ml, etc.; weight: kg, g, mg, etc.; time: hr, min, sec, etc.; others: cal, kcal, °C, Hz, df, P (probability), SD, SE, CV, etc. Arabic numerals should be used for numbers exceeding 10. References in the text should follow the forms: “Uchida and Shiraishi (1985) stated that ..., (Abe and Kawamichi 1990), and (Miura et al. 1993). More than one reference within the same parentheses should be listed chronologically, alphabetically if of the same year. Full references cited must be listed alphabetically by the first author according to the fol- lowing examples: Abe, H., Shiraishi, S. and Arai, S. 1991. A new mole from Uotsuri-jima, the Ryukyu Is- lands. Journal of the Mammalogical Society of Japan 15: 47-60. Eisenberg, J. F. 1981. The Mammalian Radiations. University of Chicago Press, Chicago, 610 pp. Geist, V. 1982. Adaptive behavioral strategies. In (J. W. Thomas and D. E. Toweill, eds.) Elk of North America. Pp. 219-277. Stackpole, Harrisburg. Obara, Y. 1991. Karyosystematics of the mustelid carnivores of Japan. Honyurui Kagaku [Mammalian Science] 30: 197-220 Gn Japanese with English abstract). Authors are recommended to refer to recent issues of the journal for details of style and layout. Manuscripts should be submitted in triplicate, with a separate sheet giving the title, author(s), name(s), and address(es) for editorial correspondence, a running head (fewer than 20 letters), the numbers of main text pages, tables and figures. Do not send original figures until the paper has been accepted. Galley proofs will be sent to the author. Reprints may be purchased in blocks of 50. Mammal Study Vol. 24, No. 2, December 1999 ‘Contents Original papers Ne - eo Takada, Y., Sakai, E., Uematsu, y. and Tateishi, T.: Morphometric variation | of house mice (Mus musculus) on the Izu Islands --2:2--+-:- BopcopoReL gabon o: ee : Dokuchaev, N.E., Ohdachi, S. and Abe, H.: Morphometric status of s shrews: bie : of the Sorex caecutiens/shinto group in Japan QubSocsaascoo age: pebagbes 2c: Sones ss 67 Jiang, Z. and Takatsuki, S.: Constraints on feeding type in ruminants: a CaSe a for morphology over phylogeny MN | Ochiai, K.: Diet of the Japanese serow (Capricornis crispus) on the Shimokita i) ll - Peninsula, northern J agen in reference to variations with a 16-year | TEE illest sed he ene eso tan Oa hh ome een oe eae ner eee shoe) foe 8 91 | Iwasa, M. A., Obara, Y., Kitahara, E. and Kimura, Y:: Synaptonemal | com- plex analyses in the XY chromosomes of six taxa of Clethrionomys and uk Eothenomys from Japan : SGUDHOOUBSOOSODOCOOUUOOODDOC OO HC OOUOOD COO Ce ON Ma OS Short communications Weerasinghe, U.R., Jayasekara, P. and Takatsuki, S.: A record of the food ae a retention time of the Asiatic elephant, Elephas maximus ------.-~- ores 6 bol Tamura, N.: Seasonal change in reproductive states of the Formosan squirrel Sa on Ikan Oshima Island, Japan ---: tenets = al ae ee see 121 — jae The Mammalogical Society of Japan HECKMAN BalN GD wee Rey; IGNEG: Bound-To-Please® MAY 00 N. MANCHESTER, INDIANA 46962 ASHP dy Mev Shee HST, Cette te Le: ho Oe hete sa, f. oe335) WP er, 2 date ae Whe ee 7 4 ey > 2 Les r ti a y s > t.. Fa 23 Fi ‘+ : f \ Ys eee Sa ht Toe va ye See Od tate BS Ht we o Pah oes AIP Whar yme tes Wee ea ee Ley ek Sestoue, FENPUS RP YS EPUTE eo iia ree Stresecs “S* SSS > ey x SPER Gat i a ie useEe ETE TRPLN Ses =r ew one py bored uty We Wee is ey sterting fee u= Suey s) eyrlisive athe » a me x feu Bicboie 9 U7 Bs be pasar yh weer Wen ering ees ic Breceeys a SREB Pe yveg sciu Saran vga PGi BS yey ¥ FERS opie bam Uxiegeae mae Riga y Gace ee ae niecene HLPse he ATE SBS Sey sritin sy; ia biscet mentaner Mop Set aa) Maa URGES PRA © Neataraery PREVA RUT oy = D8 arn rsr any Pes \ Sh Sey ay eet SVE Day. POSE ae aS VENUS sh ty a benoit ge eet a TOS UNO Water k SHEADMIAD fy AFany PEP NPYROT pares SS eiSte fin ty f ay Uhl ai oy UPD RD utr gs Deyimyuns v he) KNEEU UPTO SH Ta Ses dia ys yyune: eh ris Late Pour hve se FEV MME Beery siege PUEMYE HESS BiS\EEyynicgrdnite fe PMT Nae) PUP EOYs TUTE raays Mreueciy DEM SUPD HS Begin. seo eeay Satyr i beg WG Webs Phere pap gYesy= ke EY Rata tee Dury prey Chery asar ey ge” Wars erene 952) FUSE i BiyGcoe ices AY ure i ! Bian Nts SS Voth Beye aD be ces aL erat Te erteh ery rf Uilegioyiye PRSU Hind Het unis ks Wap DRe wie Poverty hele: Rosy Uitiba Ya Vat Bre un) Caray. We oh vee UNSER ant _ Awe PUPUSS Face CPR OGL aH a PSPOP MEd Wy veins rahe NS PDESIRES INS CRUD AT ¢ tira PAF ru WP read WADE ia NYG Varig y